نشكر جوردون فريمان لتوفير الحجب الأجسام المضادة لمكافحة PD-L1. نشكر الكادر الطبي والمختبر في مستشفى ماساتشوستس العام وجميع المشاركين في الدراسة لدور لا تقدر بثمن في هذا المشروع. وأيد هذه الدراسة من قبل المعهد الوطني للحساسية والأمراض المعدية التابع لمعاهد الصحة القومية (PO1 AI-080192؛ دك)، والرئة القومي للقلب والدم المعهد من المعاهد الوطنية للصحة (RO1 HL-092565؛ دك). ويدعم دك من قبل جائزة شهادة باحث من صندوق البحوث الصحية كيبيك (FRQS). ويدعم FP من خلال منحة زمالة من ماساتشوستس العام اللجنة التنفيذية مستشفى للبحوث ومعهد هارفارد للصحة العالمية (HGHI).

1. استنزاف وعزل PBMCs عبر Ficoll فصل <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تستنفد خلايا CD8 + T بإضافة الإنسان CD8 + استنفاد كوكتيل في 50 ميكرولتر / مل من الدم الكامل. </li><li style=";text-align:right;direction:rtl"> تخلط جيدا واحتضان لمدة 20 دقيقة في درجة حرارة الغرفة (18-25 درجة مئوية). </li><li style=";text-align:right;direction:rtl"> بعد الحضانة، ومزج الدم الكامل مع HBSS (محلول الملح المتوازن هانك دون كا 2 + أو 2 ملغ +) وطبقة أكثر Histopaque. تدور في إطار التعاون الإقليمي 340 لمدة 30 دقيقة (لا الفرامل، والتسارع البطيء). </li><li style=";text-align:right;direction:rtl"> جمع PBMCs ونقل إلى 50ML المخروطية جديدة. غسل 2X مع 45 مل 1640 RPMI تستكمل مع 50 وحدة دولية البنسلين، 50 ميكروغرام / مل الستربتوميسين، 2 مم L-الجلوتامين، و 1٪ HEPES من خلال الدوران لمدة 10 دقيقة في 340 إطار التعاون الإقليمي. </li></ol> 2. حصار الأجسام المضادة وتحفيز المستضد محددة من الخلايا <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Resuspend الخلايا في 2X10 6 في حالة في 1640 RPMI تحتوي على 10٪ مصل الإنسان تستكمل مع 50 وحدة دولية البنسلين، 50 ميكروغرام / مل الستربتوميسين، 2 مم L-الجلوتامين، و 1٪ HEPES،وهو ما يمثل 500 ميكرولتر لكل حالة. </li><li style=";text-align:right;direction:rtl"> قسامة 500 ميكرولتر من تعليق الخلية في أنبوب FACS. </li><li style=";text-align:right;direction:rtl"> تبعا لمسار التحقيق، إضافة PD-L1، IL-10Rα منع الأجسام المضادة و / أو ضوابط نمط إسوي في 10 ميكروغرام / مل واحتضان لمدة 15 دقيقة عند 37 درجة مئوية، 5٪ CO 2. </li><li style=";text-align:right;direction:rtl"> تحفيز الخلايا مع حمام سباحة الببتيد HIV-1 الكمامة في 1 ميكروغرام / مل / الببتيد تركيز النهائي. وتشمل أيضا &quot;لا التحفيز&quot; التحكم لكل حالة حظر. احتضان عند 37 درجة مئوية، 5٪ CO 2 لمدة 48 ساعة. </li></ol> 3. جمع وتحليل طاف <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> بعد 48 ساعة، وتدور أسفل أنابيب نظام مراقبة الأصول الميدانية لمدة 7 دقائق في 340 إطار التعاون الإقليمي. </li><li style=";text-align:right;direction:rtl"> جمع بعناية 2 × 225 ميكرولتر طاف في أنابيب إيبندورف لLUMINEX صفائف حبة من دون إزعاج بيليه. </li><li style=";text-align:right;direction:rtl"> تعطيل الفيروس في طاف جمعها مع 25 ميكرولتر 0.5٪ PBS-توين لإعطاء تركيز النهائي من 0.05٪ PBS-توين. </li><li style=";text-align:right;direction:rtl"> مخزن جمع supernatants التي ليست immedتستخدم iately في الفريزر -80 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> قياس تركيزات خلوى المطلوب باستخدام ميليبور LUMINEX عدة وفقا لبروتوكول الشركة المصنعة. </li></ol> 4. جمع وتحليل المظهري من الخلايا عن طريق التدفق الخلوي <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> بعد جمع طاف، وغسل الخلايا في برنامج تلفزيوني 3ML. تدور الخلايا لمدة 7 دقائق في إطار التعاون الإقليمي و340 صب غسل الزائدة. </li><li style=";text-align:right;direction:rtl"> وصمة عار للبقاء باستخدام ايف / الميت الميت قابل للتثبيت اللطخة خلية كيت وفقا لبروتوكول الشركة المصنعة. </li><li style=";text-align:right;direction:rtl"> غسل الخلايا في برنامج تلفزيوني لمدة 7 دقائق في إطار التعاون الإقليمي و340 في 4 درجات مئوية. resuspend في 100 ميكرولتر PBS 1٪ FBS. </li><li style=";text-align:right;direction:rtl"> إذا تلطيخ لحيدات أو الخلايا مستضد تقديم غيرها، والمستقبلات كتلة التيسير عن طريق إضافة 1.4 ميكرولتر من كاشف FCR حجب ودوامة لخلط. </li><li style=";text-align:right;direction:rtl"> احتضان لمدة 10 دقيقة في 4 درجات مئوية. </li><li style=";text-align:right;direction:rtl"> إضافة الأجسام المضادة السطحية، الدوامة، واحتضان لمدة 20 دقيقة على 4 درجات مئوية في الظلام. </li><li style=";text-align:right;direction:rtl"> غسل الخلايا مع برنامج تلفزيوني 1٪ FBS، صب غسل الزائدة، وإضافة 200 ميكرولتر بارافورمالدهيد 4٪. احتضانفي درجة حرارة الغرفة لمدة 20 دقيقة في الظلام. </li><li style=";text-align:right;direction:rtl"> غسل الخلايا مع برنامج تلفزيوني 1٪ FBS، resuspend في 250 ميكرولتر PBS 1٪ FBS، والحصول على تدفق عداد الكريات multilaser (على سبيل المثال BD LSRII أو Fortessa). </li></ol> 5. تحليل الخلايا عن طريق QRT-PCR <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> لخلايا لا تحليلها عن طريق التدفق الخلوي: بعد جمع طاف، وخلايا ليز في 300 ميكرولتر العازلة في Qiagen RLT تحتوي على 1٪ بيتا المركابتويثانول. إذا لم المستمر مع بروتوكول، يمكن تجميد الخلايا في -80 درجة مئوية بعد هذه النقطة. </li><li style=";text-align:right;direction:rtl"> عزل الحمض النووي الريبي باستخدام عدة عزل الحمض النووي الريبي التالية بروتوكول الشركة المصنعة. </li><li style=";text-align:right;direction:rtl"> توليف [كدنا] من الحمض النووي الريبي باستخدام التوليف [كدنا] طقم التالية بروتوكول الشركة المصنعة. </li><li style=";text-align:right;direction:rtl"> أداء الكمي PCR باستخدام تقنية SYBR الأخضر. </li><li style=";text-align:right;direction:rtl"> خلق مزيج التمهيدي لكل التمهيدي المستخدمة بما في ذلك الجينات التدبير المنزلي (مثل IL-13، IL-10، الإنترفيرون γ، GAPDH) وذلك بإضافة الاشعال لنوكلياز خالية من المياه لإعطاء تركيز النهائي من 10ميكرومتر. الحفاظ على الجليد. </li><li style=";text-align:right;direction:rtl"> إنشاء مزيج الرئيسي لكل التمهيدي بإضافة 10.5 ميكرولتر nuclease خالية من المياه، 12.5 ميكرولتر SYBR الخضراء، و 1 ميكرولتر مزيج التمهيدي في لوحة جيدا. الحفاظ على الجليد. </li><li style=";text-align:right;direction:rtl"> ماصة 24 ميكرولتر مزيج الرئيسي في كل بئر من لوحة التي سيتم استخدامها. </li><li style=";text-align:right;direction:rtl"> إضافة 1 ميكرولتر [كدنا] إلى كل بئر وفقا للقالب. </li><li style=";text-align:right;direction:rtl"> سقف الآبار وأجهزة الطرد المركزي لوحة لمدة 3 دقائق في 800 إطار التعاون الإقليمي. </li><li style=";text-align:right;direction:rtl"> تشغيل لوحة على جهاز QRT-PCR، مثل أداة Stratagene MX3005P. </li></ol> 6. التكيف للداخل الخلايا تلطيخ خلوى في 48 ساعة إضافة Brefeldin ومونينسين 6 ساعة قبل الخلايا تلطيخ خلوى. يضاف Brefeldin بتركيز 10 ميكروغرام / مل بينما يتم إضافة مونينسين وفقا لتعليمات الشركة الصانعة. للراحة، Brefeldin يمكن إضافة 12 ساعة قبل وصمة عار بتركيز من 5 ميكروغرام / مل. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> بعد وصمة عار السطح، وغسل الخلايا مع برنامج تلفزيوني 1٪ FBS وصمة عار لفيالسيتوكينات tracellular مثل IL-12، الإنترفيرون γ، وTNF-α استخدام عدة التثبيت / Permeabilization الحل والبروتوكول. </li><li style=";text-align:right;direction:rtl"> غسل الخلايا، resuspend في 250 ميكرولتر PBS 1٪ FBS، وتعمل على تدفق عداد الكريات multilaser (على سبيل المثال BD LSR الثاني أو Fortessa). </li></ol> 7. التكيف لفرز الخلايا <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> 16 ساعة بعد التحفيز، وصمة عار للبقاء باستخدام ايف / الميت قابل للتثبيت الميت وصمة عار خلية كيت وفقا لبروتوكول الشركة المصنعة. تبقي الخلايا على الجليد خلال الإجراء بأكمله. </li><li style=";text-align:right;direction:rtl"> غسل الخلايا مع برنامج تلفزيوني لمدة 7 دقائق في إطار التعاون الإقليمي و340 في 4 درجات مئوية. resuspend في 100 ميكرولتر PBS 1٪ FBS. </li><li style=";text-align:right;direction:rtl"> إضافة الأجسام المضادة السطحية، ودوامة لخلط، واحتضان الخلايا على الجليد في الظلام لمدة 20 دقيقة. </li><li style=";text-align:right;direction:rtl"> غسل الخلايا مع برنامج تلفزيوني 1٪ FBS في إطار التعاون الإقليمي و340 في 4 درجات مئوية وresuspend في 500 ميكرولتر RPMI الباردة 1640 تحتوي على 10٪ مصل بقري جنيني تستكمل مع 50 وحدة دولية البنسلين، 50 ميكروغرام / مل الستربتوميسين، 2 مم L-الجلوتامين، و 1٪ HEPES. </li><li style=";text-align:right;direction:rtl"> تصفية الخلايا باستخدام 5 مل البوليرينيه أنبوب الجولة القاع مع غطاء الخلوي مصفاة. </li><li style=";text-align:right;direction:rtl"> إعداد أنابيب جمع لنوع بإضافة 200 ميكرولتر 1640 RPMI تحتوي على 10٪ مصل بقري جنيني تستكمل مع 50 وحدة دولية البنسلين، 50 ميكروغرام / مل الستربتوميسين، 2 مم L-الجلوتامين، و 1٪ HEPES لكل أنبوب. إبقاء جميع أنابيب على الجليد أثناء الفرز. </li><li style=";text-align:right;direction:rtl"> يعيش فرز مجموعات فرعية من الخلايا في المصالح على صك (على سبيل المثال BD FACS الأغنية II) يقع في منشأة مجهزة للمواد biohazardous. </li><li style=";text-align:right;direction:rtl"> بعد أن تم فرز الخلايا، وخلايا المكان مرة أخرى في الحاضنة لمدة المبلغ المطلوب من الوقت والمتابعة مع تحليل جمع طاف / LUMINEX وتحليل خلية جمع بيليه / PCR. </li></ol>

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

يعلن الكتاب أنه ليس لديهم مصالح مالية المتنافسة.

جمع طاف هو جزء حتمي من هذا التصميم التجريبي. عندما حصاد supernatants لفحص LUMINEX، أدلى مأخوذة والاحتفاظ بها في -80 درجة مئوية لمنع تدهور البروتين بسبب تجميد أذاب دورات. تجميد والذوبان يمكن أن تكون عمليات قاسية للبروتينات، والتقليل من تجميد يذوب، سيتم مكبر إشارة في المقايسات. ل...

خلال العدوى الفيروسية المستمرة، وخلايا محددة-T فيروس اكتساب عيوب وظيفية في عملية تعرف باسم الخلايا التائية الإرهاق. في الدراسات المجراة في نموذج الفئران من LCMV عدوى فيروسية مزمنة في وقت مبكر إلى أن الخلايا T الفيروس محددة استنفدت خفضت وظيفة لحل الخلايا ضد الخلايا المصابة فيروسي، وتفقد قدرتها على التكاثر وخفضت القدرة على إنتاج السيتوكينات مثل IL-2، TNF- α الإنترفيرون γ و1،2. شبكة معقدة من الممرات مناعة، مثل PD-1 و IL-10، وupregulated خلال الالتهابات المزمنة وتسهم في ضعف الخلايا التائية (إعادة النظر في 3،4). في الجسم الحي إدارة منع الأجسام المضادة ضد هذه الممرات المثبطة في الماوس LCMV نموذج استعادة وظيفة خلايا تي فيروس محددة استنفدت وتعزيز إزالة الفيروسية، مشيرا إلى أن استنفاد الخلايا التائية هي ظاهرة عكسها جزئيا (مراجعة في 5). النتائج على التم تمديد ه نموذج LCMV بسرعة للعدوى الفيروسية المزمنة مثل الإنسان HBV، HCV وفيروس نقص المناعة البشرية 5. في المزمنة عدوى HIV-1، وupregulated PD-1 و IL-10 مسارات في مواضيع المصابة وترتبط مع معلمات من تطور المرض، مباشرة مع الحمل الفيروسي وعكسيا مع عدد CD4 6-8. الحصار الضد من PD-1 أو IL-10 مسارات في المختبر استعادة انتشار خلايا CD4 و CD8 T فيروس نقص المناعة البشرية محددة تشير إلى أن، على غرار نموذج LCMV الماوس، T استنفاد الخلايا لدى البشر هي ظاهرة عكسها جزئيا. ولكن نظرا إلى الطبيعة دقيق من التجارب على العينات البشرية فضلا عن القيود في حساسية في المختبر فحوصات، تحقيق شامل في الأوضاع استعادة الفنية من خلال هذه التدخلات حققت غائب لافت للنظر. وكانت فحوصات الانتشار، حتى الآن، والوحيدة التي يعول عليها في المختبر اختبار في معظم الدراسات الفحص، ولكن هناك نقصا ملحوظا من الأدلة على أثر هذه أمورالتدخالت على: 1) قدرة قتل الخلايا التائية السامة، 2) تأثير مضاد للفيروسات من خلايا T على تكاثر الفيروس، 3) الشخصى إفراز السيتوكينات، و 4) تأثير على CD4 الخلايا التائية المساعدة على مجموعات فرعية الخلايا الأخرى. الخلايا تلطيخ خلوى (ICS) هو مفيد جدا وتستخدم على نطاق واسع على أساس مقايسة تدفق الخلوي الذي يستخدم للكشف عن إنتاج السيتوكينات في مختلف أنواع الخلايا في كل من الفئران والبشر. كما تم استخدامه لدراسة تأثير الحصار الضد من المسارات المثبطة. في المقايسات ICS، يتم حظر إفراز خلوى من خلال إضافة Brefeldin و / أو مونينسين. السيتوكينات المحاصرين داخل الخلايا ثم يتم الكشف عن الأجسام المضادة مع الفلورسنت باستخدام متعدد الألوان التدفق الخلوي. مدة الفحص عادة يقتصر على 6 أو 12 ساعة بعد التحفيز مستضد لأن كلا Brefeldin ومونينسين، والتي عادة المضافة داخل 2 ساعة من إضافة مستضد، هي سامة للخلايا. مقايسة ICS هي تقنية قوية التي كانت ط مفيدةن التحقيق من تأثير في الجسم الحي إدارة منع التدخل الأجسام المضادة في الفئران حيث تم استخراج الخلايا بعد فترة معينة من الوقت بعد التعرض الضد 9. ومع ذلك، هناك العديد من القيود لتطبيق هذا النهج التجريبية لتقييم أثر الحصار المفروض على المستقبلات المثبطة في العينات البشرية. عند تنفيذ التدخلات الضد من المسارات المثبطة في 6 أو 12 ساعة التحفيز في المختبر (عادة الحال مع العينات البشرية)، الحصار من المستقبلات المثبطة في معظم الحالات لا يغير من وتيرة الاستجابة خلايا T مستضد محددة مقاسا المقايسات ICS القياسية 6، 7. أعطت قياسات الإنتاج خلوى في خلايا مقاسا متوسط ​​أو متوسط ​​كثافة مضان نتائج غير متناسقة 6، 7، 10. من ناحية أخرى، عندما يتم تنفيذ ICS عند نقطة أواخر الوقت بعد التحفيز (أي ستة أيام)، والتغييرات في عدد من إفراز السيتوكينات جويمكن ملاحظة أذرع. الاختلافات هي التأثير المشترك للتغير الانتشار والبقاء، والتغيرات في وظيفة المستجيب التي تتراكم على مدى فترة محددة من الوقت 6. طريقة واحدة للتغلب على هذه القيود جزئيا هو احتضان لفترات أطول من الوقت (على سبيل المثال 36 ساعة، 60 ساعة، الخ.) مع مستضد قبل إضافة مانع إفراز خلوى دون انتظار انتشار تحدث. وقد استخدمنا بنجاح هذا الأسلوب لتحديد حركية إفراز السيتوكينات من الخلايا بفيروس نقص المناعة البشرية محددة CD4 و CD8 T 11،12، ولكن هذا النهج ليس قادرا على الكشف عن الاستجابات الصغيرة ولن يعطي نتيجة متكاملة من إفراز السيتوكينات مجموع تحدث منذ التحفيز. لذا، ICS ليست طريقة حساسة بما يكفي للكشف عن تأثير الحصار من مسارات المثبطة على كمية من السيتوكينات التي تنتجها الخلايا التائية تفعيلها مقارنة مع خلوى مرنا الكميات أو قياسات من إفراز خلوى في supernatanر في الوقت نفسه نقطة. بالإضافة إلى ذلك، فإن معظم السيتوكينات التي تنتجها الخلايا التائية تنشيط العمل في الأزياء autocrine من خلال المساهمة في ردود فعل إيجابية أو سلبية حلقات عبر التفاعل مع الخلايا مستضد تقديم. لذلك، إضافة Brefeldin أو مونينسين خلال فحص ICS يمنع إفراز السيتوكينات، وبالتالي تحفيز خلايا T ليس الأمثل. أخيرا، كشف عن السيتوكينات متعددة مع ICS محدودة بسبب توافر وحساسية الأجسام المضادة للكشف عن السيتوكينات مع التدفق الخلوي فضلا عن القيود في عدد من fluorochromes التي يمكن استخدامها في وقت واحد في أي لوحة معينة. قمنا بتطوير نهج حساسة للغاية في المختبر التجريبي لتقييم تأثير مسارات مناعة في تنظيم إفراز السيتوكينات من الخلايا بفيروس نقص المناعة البشرية CD4 T محددة وبالتالي CD4 تساعد على تقديم المستضد خلايا (ناقلات الجنود المدرعة) والخلايا القاتلة الطبيعية (الخلايا القاتلة الطبيعية). ويمكن أيضا أن تستخدم هذه الطريقة لتقييم السلطة الإسرائيليةط الحصار من الجزيئات المثبطة CD8 T على وظيفة الخلية عن طريق استنزاف خلايا CD4 T من PBMCs أو من خلال تحفيز الببتيدات مع الأمثل التي يتم التعرف عليها إلا من خلال خلايا CD8 T. وعلى النقيض من الخلايا تلطيخ خلوى المقايسات، قررنا عدم التدخل في إفراز السيتوكينات من الخلايا بفيروس نقص المناعة البشرية CD4 T محددة من أجل أن يكون قادرا على: 1) إجراء تقدير أكثر دقة لمستويات خلوى المنتجة؛ 2) التحقيق في لجنة أوسع السيتوكينات أو الجزيئات المستجيب، و 3) تقييم أثر السيتوكينات التي تنتجها الخلايا بفيروس نقص المناعة البشرية CD4 T محددة على مجموعات فرعية الخلايا الأخرى. نحن تحفيز PBMCs المنضب CD8 مع HIV-1 الكمامة تجمع الببتيد في وجود أجسام مضادة لعرقلة مسار مناعة من الفائدة. بعد الوقت المطلوب من الحضانة، عادة 48 ساعة، ونحن جمع supernatants لقياس إفراز السيتوكينات مع صفائف حبة وجمع الكريات الخلايا إما لتحليل المظهري من مجموعات فرعية مختلفة من الخلايا لتحليلها أو النسخي. علما، في رله 48 نقطة زمنية ساعة، ونحن لا كشف عدد كبير من السكان من الخلايا المتكاثرة T 12. هذا هو نهج مرن والعديد من التعديلات من هذا التصميم يمكن تطبيقها لمعالجة الفرضيات المختلفة. على سبيل المثال، مجموعات فرعية الخلايا الفردية (مثل خلايا CD4 T فيروس نقص المناعة البشرية محددة أو PD-1 خلايا CD4 T عالية، الخ.) يمكن فرزها بعد 12 ساعة من الحضانة قبل مزيد من الحضانة لمدة 36 ساعة تليها مجموعة من supernatants وكريات خلية للتحقيق بشكل أكثر تحديدا تأثير التدخلات الحصار على إفراز السيتوكينات من مجموعات سكانية فرعية محددة من PBMCs.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent/Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		 </tr>
		 <tr>
			<td>Hanks Balanced Salt Solution without Ca2+ or Mg2+</td>
			<td>Sigma</td>
			<td>H9394</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RPMI 1640</td>
			<td>Sigma</td>
			<td>R0883</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Histopaque-1077</td>
			<td>Sigma</td>
			<td>10771</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Human Serum AB</td>
			<td>Gemini BioProducts</td>
			<td>100-512</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Penicillin/Streptomycin</td>
			<td>Mediatech</td>
			<td>30 001 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>L-glutamine</td>
			<td>Mediatech</td>
			<td>25 005 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>HEPES buffer</td>
			<td>Mediatech</td>
			<td>25060CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>FcR blocking reagent, human</td>
			<td>Miltenyi</td>
			<td>130-059-901</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RosetteSep Human CD8+ Depletion Cocktail </td>
			<td>Stem Cell </td>
			<td>15663</td>
			<td></td>
		 </tr>
		 <tr>
			<td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td>
			<td>Invitrogen</td>
			<td>L23105</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Rneasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Improm-II Reverse Transcription System</td>
			<td>Promega</td>
			<td>A3800</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Brilliant II SYBR qPCR Low Rox Master Mix</td>
			<td>Agilent</td>
			<td>600830</td>
			<td></td>
		 </tr>
		 <tr>
			<td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td>
			<td>BD</td>
			<td>554714</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Tween-20</td>
			<td>Fisher</td>
			<td>BP337100</td>
			<td></td>
		 </tr>
		 <tr>
			<td>IFN-&gamma; primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td>
		 </tr>
		 <tr>
			<td>GAPDH primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td>
		 </tr>
		</tbody>
 </table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

T خلية الإرهاق هو عامل رئيسي في إزالة الممرض فشلت خلال العدوى الفيروسية المزمنة. وupregulated مسارات مناعة، مثل PD-1 و IL-10، على هذا المستضد التعرض المستمر وتساهم في فقدان الانتشار، وانخفاض وظيفة لحل الخلايا، وضعف إنتاج السيتوكينات من قبل خلايا CD4 و CD8 T. في نموذج الفئران من الإصابة LCMV، إدارة منع الأجسام المضادة ضد هذه الممرات اثنين زيادة استجابات الخلايا التائية. ومع ذلك، لا يوجد حاليا أي فحص في المختبر لقياس أثر هذه الحصار على إفراز السيتوكينات في الخلايا من عينات الإنسان. لدينا بروتوكول والمنهج التجريبي تمكننا من تحديد بدقة وكفاءة إعادة إنتاج السيتوكينات من الخلايا بفيروس نقص المناعة البشرية CD4 T محددة من الموضوعات فيروس نقص المناعة البشرية المصابة. هنا، ونحن تصور وتصميم التجارب في المختبر تمكن من قياسات إفراز السيتوكينات من الخلايا CD4 T فيروس نقص المناعة البشرية محددة وتأثيرها على سل أخرىمجموعات فرعية ل. تم استنفاد خلايا CD8 T من الدم الكامل وتم عزل PBMCs المتبقية عبر Ficoll طريقة الانفصال. ثم تم تحضين PBMCs المنضب CD8 مع منع الأجسام المضادة ضد PD-L1 و / أو IL-10Rα، وبعد التحفيز مع حمام سباحة الكمامة الببتيد HIV-1، وحضنت الخلايا عند 37 درجة مئوية، 5٪ CO 2. بعد أن جمعت 48 ساعة، طاف للتحليل خلوى بواسطة صفائف الخرز وكريات خلية تم جمعها للتحليل المظهري إما باستخدام التدفق الخلوي أو تحليل النسخي باستخدام QRT-PCR. لتحليل أكثر تفصيلا، تم الحصول على السكان مختلفة من الخلايا عن طريق استنزاف فرعية انتقائية من PBMCs أو عن طريق الفرز باستخدام التدفق الخلوي قبل أن يتم تقييمها في نفس المقايسات. توفر هذه الأساليب نهج حساسة للغاية ومحددة لتحديد التشكيل الإنتاج خلوى من قبل خلايا تي المساعد مستضد محددة وتحديد التفاعلات الوظيفية بين مجموعات مختلفة من الخلايا المناعية.

عند تنفيذ القياسات خلوى استخدام هذا النظام في المختبر، فمن الضروري أن تكون قادرة على التمييز بين الاستجابات مستضد محددة بالمقارنة مع أي سيطرة التحفيز. بشكل عام، درسنا ردودا إيجابية عن أي قيم التحفيز الأنتيجين التي تعطي زيادة على الأقل ثلاثة أضعاف في مستويات خل?...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

وضعنا مقايسة في المختبر للتحقيق في دور مسارات مناعة في تنظيم إفراز السيتوكينات من الخلايا بفيروس نقص المناعة البشرية CD4 T محددة.

في المختبر الفحص لتقييم أثر مناعة مقررات تمهيدية بشأن فيروس نقص المناعة CD4 T محددة المستجيب خلية وظيفة

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

in-vitro-assay-to-evaluate-impact-immunoregulatory-pathways-on-hiv

Research

JoVE Journal

Immunology and Infection

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

14.0K Views.  The Ragon Institute of MGH, MIT and Harvard.  وضعنا مقايسة في المختبر للتحقيق في دور مسارات مناعة في تنظيم إفراز السيتوكينات من الخلايا بفيروس نقص المناعة البشرية CD4 T محددة. 

Video: In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&amp;#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

العزلة والتمايز TH17 من السذاجة CD4 T الخلايا اللمفاوية

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Transplantation of Tail Skin to Study Allogeneic CD4 T Cell Responses in Mice

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and host T cells, to easily monitor the graft, and to adapt the system in order to answer different immunological questions. Medawar and colleagues established allogeneic tail-skin transplantation in mice in 1955. Since then, the skin transplantation model has been continuously modified and adapted to answer specific questions. The use of tail-skin renders this model easy to score for graft rejection, requires neither extensive preparation nor deep anesthesia, is applicable to animals of all genetic background, discourages ischemic necrosis, and permits chemical and biological intervention. 
In general, both CD4+ and CD8+ allogeneic T cells are responsible for the rejection of allografts since they recognize mismatched major histocompatibility antigens from different mouse strains. Several models have been described for activating allogeneic T cells in skin-transplanted mice. The identification of major histocompatibility complex (MHC) class I and II molecules in different mouse strains including C57BL/6 mice was an important step toward understanding and studying T cell-mediated alloresponses. In the tail-skin transplantation model described here, a three-point mutation (I-Abm12) in the antigen-presenting groove of the MHC-class II (I-Ab) molecule is sufficient to induce strong allogeneic CD4+ T cell activation in C57BL/6 mice. Skin grafts from I-Abm12 mice on C57BL/6 mice are rejected within 12-15 days, while syngeneic grafts are accepted for up to 100 days. The absence of T cells (CD3-/- and Rag2-/- mice) allows skin graft acceptance up to 100 days, which can be overcome by transferring 2 x 104 wild type or transgenic T cells. Adoptively transferred T cells proliferate and produce IFN-&#947; in I-Abm12-transplanted Rag2-/- mice.

Tail-skin transplantation is a powerful model for studying T cell-dependent rejection and tolerance induction during allogeneic immune responses in mice. The advantages of this protocol are minor invasive surgery, and ease of monitoring with no need to sacrifice the recipient mouse.

زرع الجلد الذيل لدراسة خيفي CD4 T الردود الخليوي في الفئران

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and ...

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte function, in general these are limited in terms of the information they can provide. For example, most existing assays merely provide a percentage of how many granulocytes are activated following a single, fixed length incubation. Complicating matters, most assays focus on only one aspect of function due to limitations in detection technology. This report demonstrates a technique for simultaneous measurement of granulocyte phagocytosis of bacteria and oxidative burst. By measuring both of these functions at the same time, three unique phenotypes of activated granulocytes were identified: 1) Low Activation (minimal phagocytosis, no oxidative burst), 2) Moderate Activation (moderate phagocytosis, some oxidative burst, but no co-localization of the two functional events), and 3) High Activation (high phagocytosis, high oxidative burst, co-localization of phagocytosis and oxidative burst). A fourth population that consisted of inactivated granulocytes was also identified. Using assay incubations of 10, 20, and 40-min the effect of assay incubation duration on the redistribution of activated granulocyte phenotypes was assessed. A fourth incubation was completed on ice as a control. By using serial time incubations, the assay may be able to able to detect how a treatment spatially affects granulocyte function. All samples were measured using an image-based flow cytometer equipped with a quantitative imaging (QI) option, autosampler, and multiple lasers (488, 642, and 785 nm).

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

This method demonstrates a technique for assessing granulocyte function by simultaneously measuring phagocytosis of bacteria and oxidative burst. Image-based flow cytometry allowed for the identification of three distinct subsets of activated granulocytes that all differed in their relative functional capacity.

الصورة القائمة على التدفق الخلوي وتقنيات لتقييم التغيرات في الحبيبية وظيفة<em&gt; في المختبر</em

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

تحريض الفئران المعوية التهاب عن طريق نقل بالتبني من المستجيب CD4<sup&gt; +</sup&gt; CD45RB<sup&gt; عالية</sup&gt; خلايا T في الفئران العوز المناعي

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition of cognate antigen presented on MHC class II. The cytokine signals present in the environment at the time of TCR activation are a major factor in determining the effector fate of a na&#239;ve CD4+ T cell. Although the cytokine environment during na&#239;ve T cell activation may be complex and involve both redundant and opposing signals in vivo, the addition of various cytokine combinations during naive CD4+ T cell activation in vitro can readily promote the establishment of effector T helper lineages with hallmark cytokine and transcription factor expression. Such differentiation experiments are commonly used as a first step for the evaluation of targets believed to promote or inhibit the development of certain CD4+ T helper subsets. The addition of mediators, such as signaling agonists, antagonists, or other cytokines, during the differentiation process can also be used to study the influence of a particular target on T cell differentiation. Here, we describe a basic protocol for the isolation of na&#239;ve T cells from mouse and the subsequent steps necessary for polarizing na&#239;ve cells to various T helper effector lineages in vitro.

Mouse Na&amp;#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Na&#239;ve CD4+ T cells polarize to various subsets depending on the environment at the time of activation. The differentiation of na&#239;ve CD4+ T cells to various effector subsets can be achieved in vitro through the addition of T cell receptor stimuli and specific cytokine signals.

الماوس السذاجة CD4<sup&gt; +</sup&gt; عزل T خلية و<em&gt; في المختبر</em&gt; التمايز إلى T مجموعات فرعية خلية

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition ...

Application of Long-term cultured Interferon-&#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is controlled up to 95 % of the T cells generated during the expansion phase are eliminated (i.e., contraction phase) and memory T cells remain, sometimes for a lifetime. In humans, two functionally distinct subsets of memory T cells have been described based on the expression of lymph node homing receptors. Central memory T cells express C-C chemokine receptor 7 and CD45RO and are mainly located in T-cell areas of secondary lymphoid organs. Effector memory T cells express CD45RO, lack CCR7 and display receptors associated with lymphocyte homing to peripheral or inflamed tissues. Effector T cells do not express either CCR7 or CD45RO but upon encounter with antigen produce effector cytokines, such as interferon-&#947;. Interferon-&#947; release assays are used for the diagnosis of bovine and human tuberculosis and detect primarily effector and effector memory T cell responses. Central memory T cell responses by CD4+ T cells to vaccination, on the other hand, may be used to predict vaccine efficacy, as demonstrated with simian immunodeficiency virus infection of non-human primates, tuberculosis in mice, and malaria in humans. Several studies with mice and humans as well as unpublished data on cattle, have demonstrated that interferon-&#947; ELISPOT assays measure central memory T cell responses. With this assay, peripheral blood mononuclear cells are cultured in decreasing concentration of antigen for 10 to 14 days (long-term culture), allowing effector responses to peak and wane; facilitating central memory T cells to differentiate and expand within the culture.

Application of Long-term cultured Interferon-&amp;#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Long-term cultured interferon-&#947; enzyme-linked immunospot assay is used as a measure of central memory responses and correlates with protective anti-mycobacterial vaccine responses. With this assay, peripheral blood mononuclear cells are stimulated with mycobacterial antigens and interleukin-2 for 14 days, enabling differentiation and expansion of central memory T cells.

تطبيق على المدى الطويل مثقف انترفيرون γ انزيم مرتبط Immunospot الفحص لتقييم المستجيب والذاكرة T الردود خلية في الماشية

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

التصوير CD4 T خلية الخلالية الهجرة في الأدمة الملتهبة

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

ل<em&gt; في المختبر</em&gt; نموذج من حاجز الدم في الدماغ عن طريق التحليل الطيفي المعاوقة: التركيز على التفاعل خلية تي خلية البطانية

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, including phagocytosis of damaged synapses or cells, debris, and/or invading pathogens. Impaired phagocytic function has been implicated in the pathogenesis of diseases such as Alzheimer's and age-related macular degeneration, where amyloid-&#946; plaque and drusen accumulate, respectively. Despite its importance, microglial phagocytosis has been challenging to assess in vivo. Here, we describe a simple, yet robust, technique for precisely monitoring and quantifying the in vivo phagocytic potential of retinal microglia. Previous methods have relied on immunohistochemical staining and imaging techniques. Our method uses flow cytometry to measure microglial uptake of fluorescently labeled particles after intravitreal delivery to the eye in live rodents. This method replaces conventional practices that involve laborious tissue sectioning, immunostaining, and imaging, allowing for more precise quantification of microglia phagocytic function in just under six hours. This procedure can also be adapted to test how various compounds alter microglial phagocytosis in physiological settings. While this technique was developed in the eye, its use is not limited to vision research.

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglial phagocytosis is critical for the maintenance of tissue homeostasis and inadequate phagocytic function has been implicated in pathology. However, assessing microglia function in vivo is technically challenging. We have developed a simple but robust technique for precisely monitoring and quantifying the phagocytic potential of microglia in a physiological setting.

تقييم الشبكية دبقية أكلة وظيفة<em&gt; في فيفو</em&gt; باستخدام الفحص القائمة على الخلوي التدفق

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, ...

In Vitro Differentiation of Human CD4+FOXP3+ Induced Regulatory T Cells (iTregs) from Na&#239;ve CD4+ T Cells Using a TGF-&#946;-containing Protocol

Regulatory T cells (Tregs) are an integral part of peripheral tolerance, suppressing immune reactions against self-structures and thus preventing autoimmune diseases. Clinical approaches to adoptively transfer Tregs, or to deplete Tregs in cancer, are underway with promising first outcomes. 
Because the number of naturally occurring Tregs (nTregs) is very limited, studying certain Treg features using in vitro induced Tregs (iTregs) can be advantageous. To date, the best although not absolutely specific protein marker to delineate Tregs is the transcription factor FOXP3. Despite the importance of Tregs including non-redundant roles of peripherally induced Tregs, the protocols to generate iTregs are currently controversial, particularly for human cells. This protocol therefore describes the in vitro differentiation of human CD4+FOXP3+ iTregs from human na&#239;ve T cells using a range of Treg-inducing factors (TGF-&#946; plus IL-2 only, or their combination with retinoic acid, rapamycin or butyrate) in parallel. It also describes the phenotyping of these cells by flow cytometry and qRT-PCR. 
These protocols result in reproducible expression of FOXP3 and other Treg signature genes and enable the study of general FOXP3-regulatory mechanisms as well as protocol-specific effects to delineate the impact of certain factors. iTregs can be utilized to study various phenotypic aspects as well as molecular mechanisms of Treg induction. Detailed molecular studies are facilitated by relatively large cell numbers that can be obtained. 
A limitation for the application of iTregs is the relative instability of FOXP3 expression in these cells compared to nTregs. iTregs generated by these protocols can also be used for functional assays such as studying their suppressive function, in which iTregs induced by TGF-&#946; plus retinoic acid and rapamycin display superior suppressive activity. However, the suppressive capacity of iTregs can differ from nTregs and the use of appropriate controls is crucial.

&lt;em&gt;In Vitro&lt;/em&gt; Differentiation of Human CD4&lt;sup&gt;+&lt;/sup&gt;FOXP3&lt;sup&gt;+&lt;/sup&gt; Induced Regulatory T Cells (iTregs) from Na&amp;#239;ve CD4&lt;sup&gt;+&lt;/sup&gt; T Cells Using a TGF-&amp;#946;-containing Protocol

This protocol describes the reproducible generation and phenotyping of human induced regulatory T cells (iTregs) from na&#239;ve CD4+ T cells in vitro. Different protocols for FOXP3 induction allow for the study of specific iTreg phenotypes obtained with respective protocols.

التمايز في المختبر من خلايا CD4 الإنسان + FOXP3 + المستحثة تنظيم الخلايا التائية (iTregs) من خلايا CD4 + T السذاجة باستخدام بروتوكول تحتوي على TGF-β-