We thank Gordon Freeman for providing the anti-PD-L1 blocking antibody. We thank the clinical and laboratory staff at the Massachusetts General Hospital and all study participants for their invaluable role in this project.
This study was supported by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health (PO1 AI-080192; D.E.K), the National Heart Lung and Blood Institute of the National Institutes of Health (RO1 HL-092565; D.E.K). D.E.K is supported by a Research Scholar Career Award of the Quebec Health Research Fund (FRQS). FP is supported by a fellowship grant of the Massachusetts General Hospital Executive Committee on Research and the Harvard Global Health Institute (HGHI).&#160;

1. Depletion and Isolation of PBMCs via Ficoll Separation
<ol>
	<li>Deplete CD8+ T cells by adding Human CD8+ Depletion Cocktail at 50 &#956;l/ml of whole blood.</li>
	<li>Mix well and incubate for 20 min at room temperature (18-25 &#176;C).</li>
	<li>After incubation, mix whole blood with HBSS (Hank&#39;s Balanced Salt Solution without Ca2+ or Mg2+) and layer over Histopaque. Spin at 340 rcf for 30 min (no brake, slow acceleration).</li>
	<li>Collect PBMCs and transfer to a new 50ml conical. Wash 2x with 45 ml RPMI 1640 supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES by spinning for 10 min at 340 rcf.</li>
</ol>
2. Antibody Blockade and Antigen-Specific Stimulation of Cells
<ol>
	<li>Resuspend cells at 2x106 per condition in RPMI 1640 containing 10% Human Serum supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES, accounting for 500 &#956;l per condition.</li>
	<li>Aliquot 500 &#956;l of cell suspension per FACS tube.</li>
	<li>Depending on the pathway investigated, add PD-L1, IL-10R&#945; blocking antibodies and/or isotype controls at 10 &#956;g/ml and incubate for 15 min at 37 &#176;C, 5% CO2.</li>
	<li>Stimulate cells with an HIV-1 Gag peptide pool at 1 &#956;g/ml/peptide final concentration. Also include a &#34;no stimulation&#34; control for each blocking condition. Incubate at 37 &#176;C, 5% CO2 for 48 hr.</li>
</ol>
3. Collection and Analysis of Supernatant
<ol>
	<li>After 48 hr, spin down FACS tubes for 7 min at 340 rcf.</li>
	<li>Carefully collect 2 x 225 &#956;l supernatant in Eppendorf tubes for Luminex bead arrays without disturbing the pellet.</li>
	<li>Inactivate virus in the collected supernatant with 25 &#956;l 0.5% PBS-Tween to give a final concentration of 0.05% PBS-Tween.</li>
	<li>Store collected supernatants that are not immediately used in a -80 &#176;C freezer.</li>
	<li>Measure desired cytokine concentrations using Millipore Luminex kit according to manufacturer&#39;s protocol.</li>
</ol>
4. Collection and Phenotypic Analysis of Cells via Flow Cytometry
<ol>
	<li>After collecting supernatant, wash cells in 3ml PBS. Spin cells for 7 min at 340 rcf and decant excess wash.</li>
	<li>Stain for viability using a LIVE/DEAD Fixable Dead Cell Stain Kit according to manufacturer&#39;s protocol.</li>
	<li>Wash cells in PBS for 7 min at 340 rcf and at 4 &#176;C. Resuspend in 100 &#956;l PBS 1% FBS.</li>
	<li>If staining for monocytes or other antigen presenting cells, block Fc receptors by adding 1.4 &#956;l of FcR blocking reagent and vortex to mix.</li>
	<li>Incubate for 10 min at 4 &#176;C.</li>
	<li>Add surface antibodies, vortex, and incubate for 20 min at 4 &#176;C in the dark.</li>
	<li>Wash cells with PBS 1% FBS, decant excess wash, and add 200 &#956;l 4% paraformaldehyde. Incubate at room temperature&#160;for 20 min in the dark.</li>
	<li>Wash cells with PBS 1% FBS, resuspend in 250 &#956;l PBS 1% FBS, and acquire on a multilaser flow cytometer (e.g.&#160;BD LSRII or Fortessa).</li>
</ol>
5. Analysis of Cells via qRT-PCR
<ol>
	<li>For cells not analyzed via flow cytometry: after supernatant collection, lyse cells in 300 &#956;l Qiagen Buffer RLT containing 1% beta-mercaptoethanol. If not continuing with protocol, cells can be frozen at -80 &#176;C after this point.</li>
	<li>Isolate RNA using an RNA isolation kit following the manufacturer&#39;s protocol.</li>
	<li>Synthesize cDNA from RNA using a cDNA synthesis kit following the manufacturer&#39;s protocol.</li>
	<li>Perform quantitative PCR using SYBR Green technology.</li>
	<li>Create a primer mix for each primer used including housekeeping genes (e.g.&#160;IL-13, IL-10, IFN-&#947;, GAPDH) by adding primers to nuclease-free water to give a final concentration of 10 &#956;M. Keep on ice.</li>
	<li>Create a master mix for each primer by adding 10.5 &#956;l nuclease-free water, 12.5 &#956;l SYBR green, and 1 &#956;l primer mix per plate well. Keep on ice.</li>
	<li>Pipette 24 &#956;l master mix into each well of the plate that will be used.</li>
	<li>Add 1 &#956;l cDNA to each well according to template.</li>
	<li>Cap wells and centrifuge plate for 3 min&#160;at 800 rcf.</li>
	<li>Run plate on a qRT-PCR machine, e.g.&#160;a Stratagene MX3005P instrument.</li>
</ol>
6. Adaptation for Intracellular Cytokine Staining at 48 hr
Add Brefeldin and Monensin 6 hr prior to intracellular cytokine staining. Brefeldin is added at a concentration of 10 &#956;g/ml while Monensin is added according to manufacturer&#39;s instructions. For convenience, Brefeldin can be added 12 hr prior to stain at a concentration of 5 &#956;g/ml.
<ol>
	<li>After surface stain, wash cells with PBS 1% FBS and stain for intracellular cytokines such as IL-12, IFN-&#947;, and TNF-&#945; using a Fixation/Permeabilization Solution kit and protocol.</li>
	<li>Wash cells, resuspend in 250 &#956;l PBS 1% FBS, and run on a multilaser flow cytometer (e.g. BD LSR II or Fortessa).</li>
</ol>
7. Adaptation for Sorting Cells
<ol>
	<li>16 hr after stimulation, stain for viability using LIVE/DEAD Fixable Dead Cell Stain Kit according to manufacturer&#39;s protocol. Keep cells on ice during entire procedure.</li>
	<li>Wash cells with PBS for 7 min at 340 rcf and at 4 &#176;C. Resuspend in 100 &#956;l PBS 1% FBS.</li>
	<li>Add surface antibodies, vortex to mix, and incubate cells on ice in the dark for 20 min.</li>
	<li>Wash cells with PBS 1% FBS at 340 rcf and at 4 &#176;C and resuspend in 500 &#956;l cold RPMI 1640 containing 10% Fetal Bovine Serum supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES.</li>
	<li>Filter cells using 5 ml Polystyrene Round-Bottom Tube with Cell-Strainer cap.</li>
	<li>Prepare collection tubes for sort by adding 200 &#956;l RPMI 1640 containing 10% Fetal Bovine Serum supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES to each tube. Keep all tubes on ice during sort.</li>
	<li>Live sort the cell subsets of interest on an instrument (e.g.&#160;BD FACS Aria II) located in a facility equipped for biohazardous material.</li>
	<li>After cells have been sorted, place cells back in the incubator for desired amount of time and follow with supernatant collection/Luminex analysis and cell pellet collection/PCR analysis.</li>
</ol>

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

The authors declare that they have no competing financial interests.

Supernatant collection is an imperative part of this experimental design. When harvesting supernatants for the Luminex assay, aliquots were made and kept at -80 &#176;C to prevent protein degradation due to freeze-thaw cycles. Freezing and thawing can be harsh processes for proteins, and by minimizing freeze-thaws, signal will be maximized in assays. Therefore, it is easier to obtain repeatable and more accurate data when working from aliquots that have been freeze-thawed the same number of times.
<p class="jove_cont...

During persistent viral infections, virus specific-T cells acquire functional defects in a process known as T cell exhaustion. Early in vivo studies in the murine LCMV model of chronic viral infection indicated that exhausted virus-specific T cells have reduced cytolytic function against virally infected cells, lose their ability to proliferate and have reduced capacity to produce cytokines such as IL-2, TNF-&#945; and IFN-&#947;1,2. A complex network of immunoregulatory pathways, such as PD-1 and IL-10, are upregulated during chronic infections and contribute to T cell dysfunction (reviewed in3,4). In vivo administration of blocking antibodies against these inhibitory pathways in the LCMV mouse model restored function of exhausted virus-specific T cells and enhanced viral clearance, indicating that T cell exhaustion is a partially reversible phenomenon (reviewed in 5).
Findings on the LCMV model were quickly extended to human chronic viral infections such as HBV, HCV and HIV5. In chronic HIV-1 infection, PD-1 and IL-10 pathways are upregulated in infected subjects and correlate with parameters of disease progression, directly with the viral load and inversely with the CD4 count6-8. Antibody blockade of the PD-1 or IL-10 pathways in vitro restored proliferation of HIV-specific CD4 and CD8 T cells indicating that, similar to the LCMV mouse model, T cell exhaustion in humans is a partially reversible phenomenon. However, due to the delicate nature of experiments on human samples as well as limitations in the sensitivity of in vitro assays, thorough investigation of the functional restoration profiles achieved by these interventions is strikingly absent. Proliferation assays have been, so far, the only reliable in vitro assay tested in most studies, yet there is a remarkable lack of evidence on the impact of these interventions on: 1) the killing capacity of cytotoxic T cells, 2) the antiviral effect of T cells on viral replication, 3) the cytokine secretion profile, and 4) the effect on CD4 T cell help on other cell subsets.
Intracellular cytokine staining (ICS) is a very useful and widely used flow cytometry based assay that is used to detect production of cytokines in various cell types in both mice and humans. It has also been used to investigate the effect of antibody blockade of inhibitory pathways. In ICS assays, cytokine secretion is blocked by the addition of Brefeldin and/or Monensin. Cytokines trapped inside the cells are then detected with fluorescent antibodies using polychromatic flow cytometry. The duration of the assay is usually limited to 6 or 12 hr after antigen stimulation since both Brefeldin and Monensin, which are typically added within 2 hr&#160;of antigen addition, are toxic to the cells. The ICS assay is a powerful technique that has been useful in the investigation of the effect of in vivo administration of blocking antibody intervention in mice where cells were extracted after a certain period of time after antibody exposure9. However, there are several limitations for the application of this experimental approach to evaluate the impact of blockade of inhibitory receptors in human samples. When performing antibody interventions of inhibitory pathways in a 6 or 12 hr stimulation in vitro (typically the case with human samples), blockade of inhibitory receptors in most cases does not alter the frequency of responding antigen-specific T cells as measured by standard ICS assays6, 7 . Measurements of per-cell cytokine production as measured by mean or median fluorescence intensity have given inconsistent results6, 7, 10. On the other hand, when ICS is performed at a late time point after stimulation (i.e. six days), changes in the number of cytokine-secreting cells can be observed. The differences are a combined effect of altered proliferation, survival, and changes in effector function that accumulate over the specified period of time6. One way to partially overcome these limitations is to incubate for longer periods of time (e.g. 36 hr, 60 hr, etc.) with the antigen before the addition of the cytokine secretion blocker without waiting for proliferation to occur. We have successfully used this method to determine the kinetics of cytokine secretion by HIV-specific CD4 and CD8 T cells11,12; however, this approach is not able to detect small responses and will not give an integrated result of the total cytokine secretion occurring since stimulation. Therefore, ICS is not a sensitive enough method to detect the impact of blockade of inhibitory pathways on the quantity of cytokines produced by activated T cells compared with cytokine mRNA quantitation or measurements of cytokine secretion in the supernatant at the same time points. Additionally, most of the cytokines produced by activated T cells act in autocrine fashion by contributing to either positive or negative feedback loops through interaction with antigen presenting cells. Therefore, addition of Brefeldin or Monensin during the ICS assay prevents cytokine secretion and thus stimulation of T cells is not optimal. Finally, detection of multiple cytokines with ICS is limited by the availability and sensitivity of antibodies for detection of cytokines with flow cytometry as well as by constraints in the number of fluorochromes that can be used simultaneously in any given panel.
We developed a highly sensitive in vitro experimental approach to evaluate the impact of immunoregulatory pathways in regulating cytokine secretion by HIV-specific CD4 T cells and subsequently CD4 help to antigen presenting cells (APCs) and natural killer cells (NK cells). This method can also be used to evaluate the impact of blockade of inhibitory molecules on CD8 T cell function by depleting the CD4 T cells from PBMCs or by stimulating with optimal peptides that are recognized only by CD8 T cells. In contrast to intracellular cytokine staining assays, we decided not to interfere with the cytokine secretion by HIV-specific CD4 T cells in order to be able to: 1) perform a more accurate quantification of the cytokine levels produced; 2) investigate a broader panel of cytokines or effector molecules; and 3) evaluate the impact of cytokines produced by HIV-specific CD4 T cells on other cell subsets. We stimulate CD8 depleted PBMCs with an HIV-1 Gag peptide pool in the presence of blocking antibodies for the immunoregulatory pathway of interest. After the desired time of incubation, usually 48 hr, we collect the supernatants to measure cytokine secretion with bead arrays and collect the cell pellets either for phenotypic analysis of the different cell subsets or for transcriptional analysis. Of note, at this 48 hr time point, we do not detect a significant population of proliferating T cells12. This is a flexible approach and several adaptations of this design can be applied to address different hypotheses. For example, the individual cell subsets (such as HIV-specific CD4 T cells or PD-1 high CD4 T cells, etc.) can be sorted after 12 hr of incubation before further incubation for 36 hr followed by collection of supernatants and cell pellets to investigate more specifically the impact of blockade interventions on cytokine secretion by defined subpopulations of PBMCs.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent/Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		 </tr>
		 <tr>
			<td>Hanks Balanced Salt Solution without Ca2+ or Mg2+</td>
			<td>Sigma</td>
			<td>H9394</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RPMI 1640</td>
			<td>Sigma</td>
			<td>R0883</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Histopaque-1077</td>
			<td>Sigma</td>
			<td>10771</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Human Serum AB</td>
			<td>Gemini BioProducts</td>
			<td>100-512</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Penicillin/Streptomycin</td>
			<td>Mediatech</td>
			<td>30 001 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>L-glutamine</td>
			<td>Mediatech</td>
			<td>25 005 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>HEPES buffer</td>
			<td>Mediatech</td>
			<td>25060CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>FcR blocking reagent, human</td>
			<td>Miltenyi</td>
			<td>130-059-901</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RosetteSep Human CD8+ Depletion Cocktail </td>
			<td>Stem Cell </td>
			<td>15663</td>
			<td></td>
		 </tr>
		 <tr>
			<td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td>
			<td>Invitrogen</td>
			<td>L23105</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Rneasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Improm-II Reverse Transcription System</td>
			<td>Promega</td>
			<td>A3800</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Brilliant II SYBR qPCR Low Rox Master Mix</td>
			<td>Agilent</td>
			<td>600830</td>
			<td></td>
		 </tr>
		 <tr>
			<td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td>
			<td>BD</td>
			<td>554714</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Tween-20</td>
			<td>Fisher</td>
			<td>BP337100</td>
			<td></td>
		 </tr>
		 <tr>
			<td>IFN-&gamma; primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td>
		 </tr>
		 <tr>
			<td>GAPDH primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td>
		 </tr>
		</tbody>
 </table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are upregulated upon this ongoing antigen exposure and contribute to loss of proliferation, reduced cytolytic function, and impaired cytokine production by CD4 and CD8 T cells. In the murine model of LCMV infection, administration of blocking antibodies against these two pathways augmented T cell responses. However, there is currently no in vitro assay to measure the impact of such blockade on cytokine secretion in cells from human samples. Our protocol and experimental approach enable us to accurately and efficiently quantify the restoration of cytokine production by HIV-specific CD4 T cells from HIV infected subjects.
Here, we depict an in vitro experimental design that enables measurements of cytokine secretion by HIV-specific CD4 T cells and their impact on other cell subsets. CD8 T cells were depleted from whole blood and remaining PBMCs were isolated via Ficoll separation method. CD8-depleted PBMCs were then incubated with blocking antibodies against PD-L1 and/or IL-10R&#945; and, after stimulation with an HIV-1 Gag peptide pool, cells were incubated at 37 &#176;C, 5% CO2. After 48 hr, supernatant was collected for cytokine analysis by beads arrays and cell pellets were collected for either phenotypic analysis using flow cytometry or transcriptional analysis using qRT-PCR. For more detailed analysis, different cell populations were obtained by selective subset depletion from PBMCs or by sorting using flow cytometry before being assessed in the same assays. These methods provide a highly sensitive and specific approach to determine the modulation of cytokine production by antigen-specific T-helper cells and to determine functional interactions between different populations of immune cells.

When performing cytokine measurements using this in vitro system, it is essential to be able to distinguish the antigen-specific responses compared to the no stimulation control. In general, we considered positive responses as any values of the antigenic stimulation that give at least three-fold increase in cytokine levels compared to the no stimulation control and which were within the linear range of the assay. We are using high sensitivity bead array assays that can detect concentrations of cytokines as low a...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

We developed an in vitro assay to investigate the role of immunoregulatory pathways in the regulation of cytokine secretion by HIV-specific CD4 T cells.

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

in-vitro-assay-to-evaluate-impact-immunoregulatory-pathways-on-hiv

Research

JoVE Journal

Immunology and Infection

14.0K Views.  The Ragon Institute of MGH, MIT and Harvard. We developed an in vitro assay to investigate the role of immunoregulatory pathways in the regulation of cytokine secretion by HIV-specific CD4 T cells.