우리는 항 PD-L1 차단 항체를 제공 고든 프리먼 감사합니다. 우리는 매사 추세 츠 종합 병원이 프로젝트에 자신의 귀중한 역할에 대한 모든 연구 참가자의 임상 및 실험실 직원을 감사드립니다. 국립 심장 폐 건강의 국립 연구소의 혈액 연구소 (RO1 HL-092565, DEK)이 연구는 알레르기의 국립 연구소와 국립 보건원 (DEK PO1 AI-080192)의 전염병에 의해 지원되었다. DEK는 퀘벡 건강 연구 기금의 연구 학술 경력 수상 (FR​​QS)에 의해 지원된다. FP는 연구와 하버드 글로벌 건강 연구소 (HGHI)에 매사 추세 츠 종합 병원 집행위원회의 화목 교부금에 의해 지원됩니다.

1. 피콜 분리를 통해 고갈 된 PBMC의 분리 <ol><li> 전체 혈액의 50 μL / ㎖에서 인간 CD8 + 공핍 칵테일을 첨가하여 CD8 + T 세포를 고갈. </li><li> 잘 섞어 실온 (18-25 ℃)에서 20 분 동안 품어. </li><li> 배양 후, (칼슘 + 마그네슘 또는 2 +없이 행크의 균형 소금 솔루션) HBSS로 전체 혈액을 혼합 Histopaque을 통해 계층. 30 분 (노 브레이크, 느린 가속) 340 RCF에 스핀. </li><li> PBMC를 수집하고 새로운 50 ML 원뿔로 전송할 수 있습니다. 340 RCF에서 10 분 동안 회전시켜 50 IU 페니실린, 50 ㎍ / ml의 스트렙토 마이신, 2 밀리미터 L-글루타민, 1 %의 HEPES와 보충 45 ML의 RPMI 1640 워시 2 배. </li></ol> 2. 항체 봉쇄 및 세포의 항원 특이적인 자극 <ol><li> 50 IU 페니실린, 50 ㎍ / ml의 스트렙토 마이신, 2 밀리미터 L-글루타민, 1 % HEPES와 보충 10 % 인간 혈청이 포함 된 RPMI 1640 상태 당 2 × 6에서 재현 탁 세포,조건 당 500 μL를 차지한다. </li><li> FACS 튜브 당 세포 현탁액의 나누어지는 500 μL. </li><li> 조사 경로에 따라, PD-L1, 10 ㎍ / ml로 항체 및 / 또는 이소 컨트롤을 차단하는 IL-10Rα를 추가하고 37 ° C, 5 % CO 2에서 15 분 동안 품어. </li><li> 1 ㎍ / ㎖ / 펩타이드 최종 농도에서 HIV-1 개그 펩티드 풀과 세포를 자극한다. 또한 각각의 차단 상태에 대해 &quot;자극 없음&quot;컨트롤을 포함. 37 ° C, 48 시간 동안 5 % CO 2에서 배양한다. </li></ol> 3. 수집 및 상층의 분석 <ol><li> 48 시간 후, 340 RCF에서 7 분 동안 FACS 튜브를 스핀 다운. </li><li> 조심스럽게 펠렛을 방해하지 않고 루미 넥스 비드 배열의 에펜 도르프 튜브에 2 × 225 ㎕의 상층 액을 수집합니다. </li><li> 0.05 % PBS-트윈 (Tween)의 최종 농도를 제공하기 위해 25 ㎕의 0.5 % PBS-트윈 (Tween)으로 수집 된 상청액에서 바이러스를 비활성화. </li><li> IMMED하지 스토어 수집 상층 액iately -80 ° C 냉동고에 사용됩니다. </li><li> 제조자의 프로토콜에 따라 밀리 포어 루미 넥스 키트를 사용하여 원하는 사이토 카인 농도를 측정한다. </li></ol> 4. 유동 세포 계측법을 통해 수집 및 세포의 표현형 분석 <ol><li> 상층 액을 수집 한 후, 3 ㎖ PBS로 세포를 씻어. 340 RCF에서 7 분 동안 세포를 스핀 과잉 세척을 가만히 따르다. </li><li> 제조 업체의 프로토콜에 따라 죽은 고칠 / 라이브 죽은 세포 얼룩 키트를 사용하여 생존을위한 얼룩. </li><li> 340 RCF에서 4 ℃에서 12 분 동안 PBS에 세포를 씻으십시오 100 ㎕의 PBS 1 % FBS에 재현 탁. </li><li> 의 FcR 시약과 혼합하는 소용돌이를 차단의 1.4 μl를 추가하여 단​​핵구 또는 다른 항원 제시 세포, 블록의 Fc 수용체 발현이 관찰합니다. </li><li> 4 ℃에서 10 분 동안 품어 </li><li> 표면 항체, 소용돌이를 추가하고 어둠 속에서 4 ° C에서 20 분 동안 품어. </li><li> , PBS 1 % FBS로 세포를 씻어 초과 세척을 가만히 따르다, 200 ㎕의 4 % 파라 포름 알데히드를 추가합니다. 품다어둠 속에서 20 분 동안 실온에서. </li><li> 250 ㎕의 PBS 1 % FBS에서 PBS 1 % FBS,에 resuspend로 세포를 씻어 흐름 cytometer multilaser에 취득 (예 : BD LSRII 또는 Fortessa). </li></ol> 5. QRT-PCR을 통해 세포의 분석 <ol><li> 세포에 대한 유동 세포 계측법을 통해 분석되지 : 상층 액을 수집 한 후, 1 % 베타 - 머 캅토 에탄올을 포함하는 300 ㎕의 키아 버퍼 RLT의 세포를 Lyse. 프로토콜을 계속하지 않으면 세포는이 시점 후 -80 ° C에서 고정 할 수 있습니다. </li><li> 제조 업체의 프로토콜을 다음 RNA 분리 키트를 사용하여 RNA를 분리합니다. </li><li> 제조 업체의 프로토콜을 다음 cDNA 합성 키트를 사용하여 RNA로부터 cDNA를 합성. </li><li> SYBR 녹색 기술을 사용하여 정량 PCR을 수행합니다. </li><li> 10의 최종 농도가 물없는 클레아하는 프라이머를 추가로 하우스 키핑 유전자 (예 : IL-13, IL-10, IFN-γ, GAPDH)을 포함하여 사용되는 각 프라이머 프라이머 믹스를 만들기μM. 얼음에 보관하십시오. </li><li> 물론 10.5 μL의 nuclease가없는 물, 12.5 μL의 SYBR 녹색, 접시 당 1 μL 프라이머 믹스를 추가하여 각각의 프라이머에 대한 마스터 믹스를 만듭니다. 얼음에 보관하십시오. </li><li> 사용되는 플레이트의 각 웰에 피펫 24 μL 마스터 믹스. </li><li> 템플릿에 따라 각도에 1 μL의 cDNA를 추가. </li><li> 800 RCF에서 3 분 동안 우물과 원심 분리 판을 모자. </li><li> QRT-PCR 기계, 예를 들어 스트라 타진 MX3005P 악기 판을 실행합니다. </li></ol> 6. 48 시간에 세포 내 사이토 카인 염색법에 대한 적응 Brefeldin와 모 넨신 이전의 세포 내 사이토 카인 염색법에 6 시간을 추가합니다. 모 넨신은 제조업체의 지시에 따라 첨가되는 동안 Brefeldin은 10 ㎍ / ㎖의 농도로 첨가된다. 편의상 Brefeldin은 5 ㎍ / ㎖의 농도로 염색하기 전에 12 시간을 추가 할 수있다. <ol><li> 표면의 얼룩 후,에 대한 PBS 1 % FBS와 얼룩 세포를 씻어이러한 IL-12, IFN-γ, 및 고정 / Permeabilization 솔루션 키트 및 프로토콜을 사용하여 TNF-α와 같은 사이토 카인 tracellular. </li><li> 250 ㎕의 PBS 1 % FBS에서 세포에 resuspend을 세척하고, (예를 들어, BD의 LSR II 또는 Fortessa) 유동 세포 multilaser에서 실행됩니다. </li></ol> 7. 셀 정렬에 대한 적응 <ol><li> 생존을위한 자극, 염색 후 16 시간은 제조 업체의 프로토콜에 따라 LIVE / DEAD 고칠 죽은 세포 얼룩 키트를 사용. 전체 절차를 수행하는 동안 얼음에 세포를 보관하십시오. </li><li> 340 RCF에서 4 ℃에서 12 분 동안 PBS로 세포를 씻어 100 ㎕의 PBS 1 % FBS에 재현 탁. </li><li> 혼합 표면 항체, 소용돌이를 추가하고 20 분 동안 어둠 속에서 얼음에 세포를 배양한다. </li><li> 340 RCF에서 4 ° C에서 PBS 1 % FBS와 세포를 세척하고 500 μL에 재현 탁은 10 % 소 태아 혈청을 함유하는 차가운 RPMI 1640 50 IU 페니실린, 50 ㎍ / ml의 스트렙토 마이신, 2 밀리미터 L-글루타민, 1 %로 보충 HEPES. </li><li> 5 ㎖ 폴리스티렌을 사용하여 필터 세포셀 스트레이너 캡 르네 둥근 바닥 관. </li><li> 태아 혈청 50 IU 페니실린, 50 ㎍ / ml의 스트렙토 마이신, 2 밀리미터 L-글루타민, 각 튜브에 1 % HEPES와 보충 10 %가 포함 된 200 μL의 RPMI 1640에 추가하여 정렬에 수집 튜브를 준비합니다. 정렬하는 동안 얼음에 모든 튜브를 유지합니다. </li><li> 라이브 악기 생물학적 위험 물질에 장착 된 시설에 위치 (예 : BD FACS 아리아 II)에 대한 관심의 세포 부분 집합을 정렬 할 수 있습니다. </li><li> 세포가 분류 한 후, 다시 시간이 원하는 양에 대한 보육 및 상층 액을 수집 / 루미 넥스 분석 및 세포 펠렛 수집 / PCR 분석을 수행 장소 세포. </li></ol>

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

저자는 더 경쟁 재정적 이익이 없다는 것을 선언합니다.

뜨는 컬렉션이 실험 설계의 필수적인 부분입니다. 루미 넥스 분석을위한 상층 액을 수확하면, 분액 만들어주기 - 해동 동결에 의한 단백질 분해를 방지하기 위해 -80 ° C에 보관 하였다. 냉동과 해동 단백질 및 동결 해빙을 최소화하여 가혹한 과정이 될 수 있습니다, 신호 분석에 극대화 될 것입니다. 따라서, 동일한 횟수를 동결 - 해동 된 분액에서 작업 할 때 반복 가능하고보다 정확한 데이터를 ?...

영구 바이러스 감염 동안 바이러스의 특정 T-세포는 T 세포의 고갈로 알려진 과정에서 기능적 결함을 취득. 초기 만성 바이러스 감염의 쥐 LCMV 모델에서 생체 내 연구에 지쳐 바이러스 특정 T 세포는 바이러스 성 감염 세포에 대한 세포 용해 기능을 감소 증식 할 수있는 능력을 잃게하고 IL-2, TNF-와 같은 사이토 카인을 생산하는 능력을 감소 한 것으로 나타났다 α 1,2를 IFN-γ는. 같은 PD-1과 IL-10 등의 면역 조절 경로의 복잡한 네트워크는 만성 감염시 상향 조절 및 (3,4 검토) T 세포 기능 장애에 기여하고 있습니다.에서 LCMV 마우스에이 억제 경로에 대한 항체를 차단 생체 관리 모델은 T 세포 고갈 (5 검토) 부분적으로 가역적 인 현상임을 나타내는 소진 바이러스 특정 T 세포의 기능 및 향상된 바이러스 제거를 복원. 일에 발견전자 LCMV 모델은 신속하게 HBV, HCV와 HIV 5와 같은 인간의 만성 바이러스 성 감염으로 확장되었다. 만성 HIV-1 감염, PD-1과 IL-10 경로는 감염된 과목에서 상향 조절하고 CD4와 반대로 바이러스 부하와 직접, 질병의 진행의 매개 변수와 상관 관계가 6-8을 계산합니다. LCMV 마우스 모델과 비슷, 인간의 T 세포 고갈이 부분적으로 가역적 인 현상, 나타내는 HIV 특정 CD4와 CD8 T 세포의 체외 복원 증식 PD-1, IL-10 경로의 항체 봉쇄. 그러나, 섬세한 인간의 샘플에 대한 실험의 성격뿐만 아니라 체외 분석, 이러한 개입에 의해 달성되는 기능 복원 프로필의 철저한 조사의 감도의 한계로 인해 막히게 결석. 대량 살상 무기 확산의 분석은, 지금까지 대부분의 연구에서 시험 만 신뢰할 수있는 시험 관내 분석했습니다, 그러나이 상호의 영향에 대한 증거의 놀라운 부족하다에 ventions : 세포 독성 T 세포의 1) 살상 능력, 2) 바이러스 복제에 대한 T 세포의 항 바이러스 효과, 3) 사이토 카인 분비 프로필 및 다른 세포 서브셋에 CD4 T 세포 도움에 4) 효과. 세포 내 사이토 카인 염색법 (ICS)는 매우 유용하고 널리 사용되는 유동 마우스 및 인간 모두에서 다양한 종류의 세포에서 사이토 카인의 생산을 검출하는 데 사용되는 기초 세포 계측법 분석이다. 또한 억제 경로의 항체 봉쇄의 효과를 조사하기 위해 사용되어왔다. ICS 내 분석, 사이토 카인 분비는 Brefeldin 및 / 또는 모 넨신의 첨가에 의해 차단된다. 세포 안에 갇혀 사이토 카인은 다음 다색 유동 세포 계측법을 사용하여 형광 항체로 검출된다. 일반적으로 항원 첨가 2 시간 이내에 첨가 Brefeldin 및 모 넨신, 모두 세포에 독성 때문에 분석의 기간은 일반적으로 항원 자극 후 10 또는 12 시간으로 제한된다. ICS 분석에 유용 내가되었습니다 강력한 기술이다N 세포를 항체에 노출 후 15 시간의 특정 기간 후에 압축 해제 된 마우스에서 항체 개입 차단의 생체 내 투여의 효과의 조사. 그러나, 인간의 샘플에서 억제 수용체의 봉쇄의 영향을 평가하는이 실험 방법의 응용 프로그램에 대한 몇 가지 제한 사항이 있습니다. 체외에서 10 또는 12 시간 자극 (인간 샘플 전형적 케이스)의 억제 경로의 항체 중재를 수행 할 때 표준 ICS 분석법에 의해 측정 한, 대부분의 경우에 억제 수용체의 봉쇄가 항원 특이적인 T 세포 응답의 주파수를 변경하지 않는다 6, 7. 평균 또는 평균 형광 강도로 측정 한 셀 당 사이토 카인 생산의 측정은 일치하지 않는 결과 6, 7, 10을 받고 있습니다. 한편, ICS는 이후 늦은 시점에서 수행 될 때 자극 (즉 육일), 사이토 카인 분비 C의 개수의 변화ELL 학생은 관찰 할 수있다. 차이가 변경된 증식, 생존, 그리고 6시 지정된 기간 동안 축적 이펙터 기능의 변화의 결합 된 효과입니다. 부분적으로 이러한 한계를 극복하기위한 한 가지 방법은 증식이 발생하기를 기다리지 않고 사이토 카인 분비 차단제의 첨가 전에 항원으로 오랜 기간 (예를 들면 36 시간, 60 시간, 등.) 동안 배양한다. 우리는 성공적 HIV 특정 CD4 및 CD8 T 세포 11,12 의해 사이토 카인 분비의 동력학을 결정하기 위해이 방법을 사용하고 있으나,이 방법은 작은 반응을 검출 할 수없고, 전체 사이토 카인 분비가 발생의 통합 결과를주지 않을 것이다 자극입니다. 따라서, ICS가 supernatan에서 사이토 카인의 mRNA 정량 또는 사이토 카인 분비의 측정에 비해 활성화 된 T 세포에 의해 생산 된 사이토 카인의 양에 억제 경로의 봉쇄의 영향을 검출하는 방법에 충분히 민감 아니다같은 시간 지점에서 t. 또한, 활성화 된 T 세포에 의해 생성되는 사이토 카인의 대부분이 긍정적이거나 부정적인 피드백에 기여에 의해 분비 방식으로 행동은 항원 제시 세포와의 상호 작용을 반복합니다. 따라서, ICS 분석 중에 Brefeldin 또는 모 넨신 첨가는 사이토 카인 분비를 방지하고, 따라서 T 세포의 자극은 최적이 아니다. 마지막으로, ICS 여러 사이토 카인의 검출은 유동 세포 계측법과 사이토 카인의 검출뿐만 아니라 특정 패널에 동시에 사용할 수있는 형광 색소의 수에 제약 조건에 대한 가용성과 항체의 감도에 의해 제한됩니다. 우리는 세포 (장갑차) 및 자연 살해 세포 (NK 세포)를 항원 제시하는 HIV 특정 CD4 T 세포에 의해 사이토 카인 분비를 조절하고 이후 CD4 도움말에서 면역 조절 경로의 영향을 평가하는 매우 중요한 생체 외 실험 방법을 개발했다. 이 방법은 또한 IMPA을 평가할 수있다PBMC를에서 CD4 T 세포를 파괴하거나 만 CD8 T 세포에 의해 인식되는 최적의 펩티드로 자극하여 CD8 T 세포의 기능에 억제 분자의 봉쇄 CT. 2) 넓은 패널을 조사 1) 제조 사이토킨 수준의 더 정확한 정량화를 수행 세포 내 사이토 카인 염색법 어 세이는 달리, 우리는 행 수 있도록하기 위해 HIV 특정 CD4 T 세포에 의한 사이토 카인의 분비를 방해하지 않기로 사이토 카인 또는 이펙터 분자, 3) 다른 세포 서브셋에 HIV 특정 CD4 T 세포에 의해 생산 된 사이토 카인의 영향을 평가. 우리는 관심의 면역 조절 경로에 대한 항체를 차단 존재 HIV-1 개그 펩티드 풀과 CD8 고갈 된 PBMC를 자극한다. 배양, 보통 48 시간 원하는 시간 후, 우리는 비드 어레이와 사이토 카인의 분비를 측정하고 다른 세포 부분 집합의 표현형 분석을 위해 또는 전사 분석을위한 하나 세포 펠렛을 수집하는 상층 액을 수집합니다. 의 t에서,주의그의 48 시간 시점, 우리는 T 세포 (12) 증식의 중요한 인구를 감지하지 않습니다. 이것은 유연한 접근이며,이 설계의 여러 가지 다른 적응 가설을 해결하기 위해 적용될 수있다. 예를 들어, (예 등 HIV 특정 CD4 T 세포 또는 PD-1 높은 CD4 T 세포, 등.) 개별 셀의 부분 집합은 상층 액과 세포 펠렛을 수집 한 다음 36 시간 동안 추가 배양하기 전에 배양 12 시간 후 정렬 할 수 있습니다 더 구체적으로 된 PBMC의 정의 모집단에 의한 사이토 카인 분비에 봉쇄 개입의 영향을 조사한다.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent/Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		 </tr>
		 <tr>
			<td>Hanks Balanced Salt Solution without Ca2+ or Mg2+</td>
			<td>Sigma</td>
			<td>H9394</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RPMI 1640</td>
			<td>Sigma</td>
			<td>R0883</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Histopaque-1077</td>
			<td>Sigma</td>
			<td>10771</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Human Serum AB</td>
			<td>Gemini BioProducts</td>
			<td>100-512</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Penicillin/Streptomycin</td>
			<td>Mediatech</td>
			<td>30 001 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>L-glutamine</td>
			<td>Mediatech</td>
			<td>25 005 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>HEPES buffer</td>
			<td>Mediatech</td>
			<td>25060CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>FcR blocking reagent, human</td>
			<td>Miltenyi</td>
			<td>130-059-901</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RosetteSep Human CD8+ Depletion Cocktail </td>
			<td>Stem Cell </td>
			<td>15663</td>
			<td></td>
		 </tr>
		 <tr>
			<td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td>
			<td>Invitrogen</td>
			<td>L23105</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Rneasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Improm-II Reverse Transcription System</td>
			<td>Promega</td>
			<td>A3800</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Brilliant II SYBR qPCR Low Rox Master Mix</td>
			<td>Agilent</td>
			<td>600830</td>
			<td></td>
		 </tr>
		 <tr>
			<td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td>
			<td>BD</td>
			<td>554714</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Tween-20</td>
			<td>Fisher</td>
			<td>BP337100</td>
			<td></td>
		 </tr>
		 <tr>
			<td>IFN-&gamma; primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td>
		 </tr>
		 <tr>
			<td>GAPDH primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td>
		 </tr>
		</tbody>
 </table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

T 세포 고갈은 만성 바이러스 감염 동안 실패 병원체 정리의 주요 요인이다. 같은 PD-1과 IL-10 등의 면역 조절 경로는이 지속적인 항원 노출에 상향 조절 및 확산의 손실 감소 세포 용해 기능에 기여하고, CD4와 CD8 T 세포에 의해 사이​​토 카인의 생산을 손상됩니다. LCMV 감염의 뮤린 모델에서 T 세포 반응을 증강 이러한 두 경로에 대한 항체를 블로킹 투여. 그러나, 사람의 샘플에서 세포의 사이토 카인 분비와 같은 차단의 효과를 측정하는 시험 관내 분석은 현재 존재하지 않는다. 우리의 프로토콜과 실험 방법은 정확하고 효율적으로 HIV에 감염된 과목에서 HIV 특정 CD4 T 세포에 의한 사이토 카인 생산의 복원을 정량화 할 수있게. 여기, 우리는 HIV 특정 CD4 T 세포와 다른 CEL에 미치는 영향에 의해 사이토 카인의 분비를 측정 할 수있는 시험 관내 실험 설계를 묘사L의 부분 집합. CD8 T 세포는 전혈로부터 고갈시키고, 잔존 된 PBMC는 피콜 분리 방법을 통해 분리 하였다. CD8 고갈 된 PBMC는 다음 HIV-1 개그 펩타이드 수영장 자극 한 후, 세포를 37 ° C, 5 % CO 2에서 배양하고, PD-L1 및 / 또는 IL-10Rα에 대한 항체를 차단하고 함께 배양 하였다. 48 시간, 상층 액 구슬의 배열 및 세포 펠렛에 의해 사이​​토 카인 분석을 위해 수집 한 후 QRT-PCR을 이용하여 세포 계측법 또는 전사 분석 흐름을 이용하여 표현형 분석도 수집했다. 더 자세한 분석을 위해, 서로 다른 세포 집단이 된 PBMC에서 선택적 집합 고갈 또는 같은 분석에서 평가되기 전에 유동 세포 계측법을 사용하여 정렬을 얻을 수 있었다. 이들 방법은 항원 특이적인 T-헬퍼 세포에 의해 시토 킨 생산의 조절을 결정하고, 면역 세포의 개체군 간의 기능적 상호 작용을 결정하는 매우 민감하고 구체적인 방법을 제공한다.

이 시험 관내 시스템을 사용하여 사이토 카인을 측정 할 때, 자극 제어 명에 비해 항원 특이적인 반응을 구별 할 수있을 것이 필수적이다. 일반적으로, 우리는 자극 제어하는​​ 분석의 선형 범위 내에서 있었다 없음에 비해 사이토 카인 수준의 최소 3 배 증가를 제공 항원 자극의 값으로 긍정적 인 반응을 고려했다. 우리는 약한 항원 특이 CD4 T 세포 반응을 관찰하기 위해 우리를있게, 0.16 P...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

우리는 HIV 특정 CD4 T 세포에 의한 사이토 카인 분비의 조절에 면역 경로의 역할을 조사하기 위해 시험 관내 분석을 개발 하였다.

시험 관내 분석에서 HIV 특정 CD4 T 세포의 이펙터 기능에 면역 경로의 영향을 평가하기

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

in-vitro-assay-to-evaluate-impact-immunoregulatory-pathways-on-hiv

Research

JoVE Journal

Immunology and Infection

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

14.0K 조회수.  The Ragon Institute of MGH, MIT and Harvard.  우리는 HIV 특정 CD4 T 세포에 의한 사이토 카인 분비의 조절에 면역 경로의 역할을 조사하기 위해 시험 관내 분석을 개발 하였다. 

비디오: In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&amp;#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

분리 및 나이브 CD4 T 림프구의 TH17 분화

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

연구

면역학 및 감염병학

Transplantation of Tail Skin to Study Allogeneic CD4 T Cell Responses in Mice

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and host T cells, to easily monitor the graft, and to adapt the system in order to answer different immunological questions. Medawar and colleagues established allogeneic tail-skin transplantation in mice in 1955. Since then, the skin transplantation model has been continuously modified and adapted to answer specific questions. The use of tail-skin renders this model easy to score for graft rejection, requires neither extensive preparation nor deep anesthesia, is applicable to animals of all genetic background, discourages ischemic necrosis, and permits chemical and biological intervention. 
In general, both CD4+ and CD8+ allogeneic T cells are responsible for the rejection of allografts since they recognize mismatched major histocompatibility antigens from different mouse strains. Several models have been described for activating allogeneic T cells in skin-transplanted mice. The identification of major histocompatibility complex (MHC) class I and II molecules in different mouse strains including C57BL/6 mice was an important step toward understanding and studying T cell-mediated alloresponses. In the tail-skin transplantation model described here, a three-point mutation (I-Abm12) in the antigen-presenting groove of the MHC-class II (I-Ab) molecule is sufficient to induce strong allogeneic CD4+ T cell activation in C57BL/6 mice. Skin grafts from I-Abm12 mice on C57BL/6 mice are rejected within 12-15 days, while syngeneic grafts are accepted for up to 100 days. The absence of T cells (CD3-/- and Rag2-/- mice) allows skin graft acceptance up to 100 days, which can be overcome by transferring 2 x 104 wild type or transgenic T cells. Adoptively transferred T cells proliferate and produce IFN-&#947; in I-Abm12-transplanted Rag2-/- mice.

Tail-skin transplantation is a powerful model for studying T cell-dependent rejection and tolerance induction during allogeneic immune responses in mice. The advantages of this protocol are minor invasive surgery, and ease of monitoring with no need to sacrifice the recipient mouse.

마우스에 동종 CD4 T 세포 반응을 연구하기 위해 테일 피부 이식

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and ...

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte function, in general these are limited in terms of the information they can provide. For example, most existing assays merely provide a percentage of how many granulocytes are activated following a single, fixed length incubation. Complicating matters, most assays focus on only one aspect of function due to limitations in detection technology. This report demonstrates a technique for simultaneous measurement of granulocyte phagocytosis of bacteria and oxidative burst. By measuring both of these functions at the same time, three unique phenotypes of activated granulocytes were identified: 1) Low Activation (minimal phagocytosis, no oxidative burst), 2) Moderate Activation (moderate phagocytosis, some oxidative burst, but no co-localization of the two functional events), and 3) High Activation (high phagocytosis, high oxidative burst, co-localization of phagocytosis and oxidative burst). A fourth population that consisted of inactivated granulocytes was also identified. Using assay incubations of 10, 20, and 40-min the effect of assay incubation duration on the redistribution of activated granulocyte phenotypes was assessed. A fourth incubation was completed on ice as a control. By using serial time incubations, the assay may be able to able to detect how a treatment spatially affects granulocyte function. All samples were measured using an image-based flow cytometer equipped with a quantitative imaging (QI) option, autosampler, and multiple lasers (488, 642, and 785 nm).

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

This method demonstrates a technique for assessing granulocyte function by simultaneously measuring phagocytosis of bacteria and oxidative burst. Image-based flow cytometry allowed for the identification of three distinct subsets of activated granulocytes that all differed in their relative functional capacity.

이미지 기반 유동 세포 계측법 기술은 과립구 기능의 변화를 평가하기<em&gt; 체외</em

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

이펙터 CD4의 입양 전송하여 쥐과 장내 염증의 유도<sup&gt; +</sup&gt; CD45RB<sup&gt; 높은</sup&gt; 면역 결핍 마우스에게 T 세포

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition of cognate antigen presented on MHC class II. The cytokine signals present in the environment at the time of TCR activation are a major factor in determining the effector fate of a na&#239;ve CD4+ T cell. Although the cytokine environment during na&#239;ve T cell activation may be complex and involve both redundant and opposing signals in vivo, the addition of various cytokine combinations during naive CD4+ T cell activation in vitro can readily promote the establishment of effector T helper lineages with hallmark cytokine and transcription factor expression. Such differentiation experiments are commonly used as a first step for the evaluation of targets believed to promote or inhibit the development of certain CD4+ T helper subsets. The addition of mediators, such as signaling agonists, antagonists, or other cytokines, during the differentiation process can also be used to study the influence of a particular target on T cell differentiation. Here, we describe a basic protocol for the isolation of na&#239;ve T cells from mouse and the subsequent steps necessary for polarizing na&#239;ve cells to various T helper effector lineages in vitro.

Mouse Na&amp;#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Na&#239;ve CD4+ T cells polarize to various subsets depending on the environment at the time of activation. The differentiation of na&#239;ve CD4+ T cells to various effector subsets can be achieved in vitro through the addition of T cell receptor stimuli and specific cytokine signals.

마우스 나이브 CD4<sup&gt; +</sup&gt; T 세포의 분리 및<em&gt; 시험관</em&gt; T 세포 하위 집합으로 차별화

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition ...

Application of Long-term cultured Interferon-&#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is controlled up to 95 % of the T cells generated during the expansion phase are eliminated (i.e., contraction phase) and memory T cells remain, sometimes for a lifetime. In humans, two functionally distinct subsets of memory T cells have been described based on the expression of lymph node homing receptors. Central memory T cells express C-C chemokine receptor 7 and CD45RO and are mainly located in T-cell areas of secondary lymphoid organs. Effector memory T cells express CD45RO, lack CCR7 and display receptors associated with lymphocyte homing to peripheral or inflamed tissues. Effector T cells do not express either CCR7 or CD45RO but upon encounter with antigen produce effector cytokines, such as interferon-&#947;. Interferon-&#947; release assays are used for the diagnosis of bovine and human tuberculosis and detect primarily effector and effector memory T cell responses. Central memory T cell responses by CD4+ T cells to vaccination, on the other hand, may be used to predict vaccine efficacy, as demonstrated with simian immunodeficiency virus infection of non-human primates, tuberculosis in mice, and malaria in humans. Several studies with mice and humans as well as unpublished data on cattle, have demonstrated that interferon-&#947; ELISPOT assays measure central memory T cell responses. With this assay, peripheral blood mononuclear cells are cultured in decreasing concentration of antigen for 10 to 14 days (long-term culture), allowing effector responses to peak and wane; facilitating central memory T cells to differentiate and expand within the culture.

Application of Long-term cultured Interferon-&amp;#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Long-term cultured interferon-&#947; enzyme-linked immunospot assay is used as a measure of central memory responses and correlates with protective anti-mycobacterial vaccine responses. With this assay, peripheral blood mononuclear cells are stimulated with mycobacterial antigens and interleukin-2 for 14 days, enabling differentiation and expansion of central memory T cells.

소에 이펙터 및 메모리 T 세포 반응을 평가하기위한 장기 배양 인터페론-γ 효소 링크 된 Immunospot 분석의 응용 프로그램

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

염증이 진피의 이미징 CD4 T 세포 간질 마이그레이션

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

<em&gt; 체외</em&gt; 임피던스 분광학을 사용하여 혈액 - 뇌 장벽 모델 : T 세포 - 내피 세포 상호 작용에 초점

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, including phagocytosis of damaged synapses or cells, debris, and/or invading pathogens. Impaired phagocytic function has been implicated in the pathogenesis of diseases such as Alzheimer's and age-related macular degeneration, where amyloid-&#946; plaque and drusen accumulate, respectively. Despite its importance, microglial phagocytosis has been challenging to assess in vivo. Here, we describe a simple, yet robust, technique for precisely monitoring and quantifying the in vivo phagocytic potential of retinal microglia. Previous methods have relied on immunohistochemical staining and imaging techniques. Our method uses flow cytometry to measure microglial uptake of fluorescently labeled particles after intravitreal delivery to the eye in live rodents. This method replaces conventional practices that involve laborious tissue sectioning, immunostaining, and imaging, allowing for more precise quantification of microglia phagocytic function in just under six hours. This procedure can also be adapted to test how various compounds alter microglial phagocytosis in physiological settings. While this technique was developed in the eye, its use is not limited to vision research.

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglial phagocytosis is critical for the maintenance of tissue homeostasis and inadequate phagocytic function has been implicated in pathology. However, assessing microglia function in vivo is technically challenging. We have developed a simple but robust technique for precisely monitoring and quantifying the phagocytic potential of microglia in a physiological setting.

망막 미세 아교 식세포의 기능을 평가<em&gt; 생체</em&gt;은 유동 세포 계측법 기반 분석을 사용하여

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, ...

In Vitro Differentiation of Human CD4+FOXP3+ Induced Regulatory T Cells (iTregs) from Na&#239;ve CD4+ T Cells Using a TGF-&#946;-containing Protocol

Regulatory T cells (Tregs) are an integral part of peripheral tolerance, suppressing immune reactions against self-structures and thus preventing autoimmune diseases. Clinical approaches to adoptively transfer Tregs, or to deplete Tregs in cancer, are underway with promising first outcomes. 
Because the number of naturally occurring Tregs (nTregs) is very limited, studying certain Treg features using in vitro induced Tregs (iTregs) can be advantageous. To date, the best although not absolutely specific protein marker to delineate Tregs is the transcription factor FOXP3. Despite the importance of Tregs including non-redundant roles of peripherally induced Tregs, the protocols to generate iTregs are currently controversial, particularly for human cells. This protocol therefore describes the in vitro differentiation of human CD4+FOXP3+ iTregs from human na&#239;ve T cells using a range of Treg-inducing factors (TGF-&#946; plus IL-2 only, or their combination with retinoic acid, rapamycin or butyrate) in parallel. It also describes the phenotyping of these cells by flow cytometry and qRT-PCR. 
These protocols result in reproducible expression of FOXP3 and other Treg signature genes and enable the study of general FOXP3-regulatory mechanisms as well as protocol-specific effects to delineate the impact of certain factors. iTregs can be utilized to study various phenotypic aspects as well as molecular mechanisms of Treg induction. Detailed molecular studies are facilitated by relatively large cell numbers that can be obtained. 
A limitation for the application of iTregs is the relative instability of FOXP3 expression in these cells compared to nTregs. iTregs generated by these protocols can also be used for functional assays such as studying their suppressive function, in which iTregs induced by TGF-&#946; plus retinoic acid and rapamycin display superior suppressive activity. However, the suppressive capacity of iTregs can differ from nTregs and the use of appropriate controls is crucial.

&lt;em&gt;In Vitro&lt;/em&gt; Differentiation of Human CD4&lt;sup&gt;+&lt;/sup&gt;FOXP3&lt;sup&gt;+&lt;/sup&gt; Induced Regulatory T Cells (iTregs) from Na&amp;#239;ve CD4&lt;sup&gt;+&lt;/sup&gt; T Cells Using a TGF-&amp;#946;-containing Protocol

This protocol describes the reproducible generation and phenotyping of human induced regulatory T cells (iTregs) from na&#239;ve CD4+ T cells in vitro. Different protocols for FOXP3 induction allow for the study of specific iTreg phenotypes obtained with respective protocols.