شكرا جزيلا لسيلك كيبر سارة كيفر، مايكل فايس، كوني بارتش وسيلكه فويت-Heucke لجمع العينات حماسا في الميدان، لJanett في Birkenfeld عن المساعدة المستمرة، إلى العلا Kobalz عن المواد الهلامية جميلة وتوبياس كراوس عن الدعم المعنوي.

تم تنفيذ كافة الإجراءات وفقا للقانون الألماني لحماية الحيوان (TierSchG). 1. إعداد الكواشف والمواد المستهلكة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد 5٪ (ث / ث) Chelex-100 حل في الماء الصف الجزيئية. إعداد aliquots من 200 ميكرولتر في مستوى رد الفعل أنابيب 1.5 مل. كما يترسب الراتنج Chelex سريع عن تعليق فمن الضروري لإعادة التجانس-تعليق باستمرار أثناء إعداد مأخوذة. فإنه من المستحسن للتحضير 50 ​​مل أو أكثر دفعة واحدة والحفاظ على التعليق المتجانس باستخدام محرك مغناطيسي. ويمكن تخزين الحل Chelex لسنوات في الظروف المحيطة. </li><li style=";text-align:right;direction:rtl"> قطع قطعة من الورق WHATMAN مع عرض أصغر من عرض منقار الطيور لفحصها. طول الورقة يعتمد على طريقة لأخذ عينة: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> باستخدام ملقط، يجب أن تكون قطعة طويلة بما يكفي لتمكين جمع العينات دون ملقط يجري إدراجها في منقار الطير. كما وتقدير تقريبي، لطول المنقار من 0.5 سم قطعة من الورق مع طول 1 سم وينبغي أن يكون على ما يرام. </li><li style=";text-align:right;direction:rtl"> إذا لم تكن تستخدم ملقط، يجب أن يكون قطعة أطول، ولكن صلابة من قطعة لا يزال ينبغي السماح أخذ عينات من الخلايا الظهارية. </li></ol></li><li style=";text-align:right;direction:rtl"> إعداد قسامة واحدة من PCR بريمكس لكل عينة لتحليلها. لPCR في الحجم الكلي لل25 ميكرولتر من مزيج يحتوي على 0.18 ملي dNTPs، 2 مم MgCl 2، 70 ملي تريس، حمض الهيدروكلوريك، كبريتات الامونيوم 17.25 ملم، 0.1٪ توين 20، 0.32 ميكرومتر P2 التمهيدي (TCTGCATCGCTAAATCCTTT)، 0.32 ميكرومتر P8 التمهيدي (CTCCCAAGGATGAGRAAYTG) 16 و 2 وحدة طق البلمرة. محلية الصنع طق البلمرة 17 يمكن استخدامها. للسماح إضافة أكبر قدر ممكن من الحمض النووي الحل، وهو بريمكس 6 ميكرولتر يمكن إعداد وتخزينها في -20 درجة مئوية لعدة أسابيع. </li></ol> 2. جمع العينات ارتداء القفازات ليست ضرورية لتحديد الجنس الطيور كما الاشعال PCR لا يمكن أن يصلب على الحمض النووي البشري. إلىأغراض أخرى التنميط الجيني قد يكون من المستصوب. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> التقاط الطيور من الفائدة وبلطف الاحتفاظ بها في جهة على سبيل المثال مع &#39;قبضة المسابقة في&#39; 18. تأكد من عدم الضغط على الطيور. </li><li style=";text-align:right;direction:rtl"> عقد قطعة من الورق WHATMAN مع ملقط وانتقد عدة مرات عبر داخل الخدين، واللسان والمنعر. عادة ما يتم الحصول على العينات في غضون أقل من 30 ثانية. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> الحيوانات الكبار: تبعا للأنواع قد يكون من الصعب الحصول على الطيور لفتح منقاره. وعادة ما لمس جانب من منقار وتطبيق ضغط لطيف العمل. </li><li style=";text-align:right;direction:rtl"> الصقور الصغيرة: أخذ العينات من سلحفاة صغيرة أو الصقور الصغيرة من السهل خاصة باستخدام هذه التقنية، كما يوفر سلوك التسول على سهولة الوصول إلى داخل المنقار. قد يكون من الممكن الحصول على عينة من دون التعامل معها على الإطلاق، لأنها التسول بسهولة على سبيل المثال عندما يتم فتح nestbox بهم. </li></ol></li><li style=";text-align:right;direction:rtl"> تخزين فورا الصحيفة في استعداد إحتوى أنبوب رد فعلنينغ 200 ميكرولتر من 5٪ (ث / ث) Chelex-100 الحل. </li></ol> إذا كنت تنوي أيضا / بحاجة للاحتفال الكتاكيت، تفعل ذلك الآن كما هو موضح في القسم 6. 3. تخزين العينات قبل استخراج الحمض النووي <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إذا كان يعمل في المختبر، وعينات تخزينها في -20 درجة مئوية. إذا كان هذا غير ممكن أو صعب (على سبيل المثال في الميدان) عينات تخزينها في درجات الحرارة المحيطة. </li><li style=";text-align:right;direction:rtl"> ويمكن تخزين العينات لأكثر من 3 سنوات في درجات حرارة تتراوح من درجة حرارة الغرفة إلى -20 درجة مئوية. </li></ol> 4. استخراج الحمض النووي <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إذا تم تجميد العينة، ذوبان الجليد في درجة حرارة الغرفة. </li><li style=";text-align:right;direction:rtl"> تأكد من أن قطعة من الورق على الجزء السفلي من الأنبوب المغمور في حل Chelex-100. </li><li style=";text-align:right;direction:rtl"> احتضان العينات لمدة 15 دقيقة في 56 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> لفترة وجيزة دوامة وتدور باستمرار محتوى الأنبوب. </li><li style=";text-align:right;direction:rtl"> احتضان العينات لمدة 8 دقائق في 100 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> تدور العينات في 15،000 x ج لمدة 3 دقائق. </li><li style=";text-align:right;direction:rtl"> استخدام قupernatant عن التنميط الجيني لاحقة. </li></ol> 5. الجزيئية الجنس تقدير <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد واحد أنبوب PCR مع 6 ميكرولتر لكل عينة بريمكس بالاضافة الى اثنين من أنابيب إضافية لالسلبية (إلزامي) وإيجابية التحكم (اختياري). لتحديد الجنس الروتيني تشمل عينة من آخر [سإكسينغ ناجحة كعنصر تحكم إيجابية. </li><li style=";text-align:right;direction:rtl"> إضافة 19 ميكرولتر من طاف من استخراج الحمض النووي للبريمكس PCR. تأكد من ماصة من على سطح الأرض من الحل لتجنب المرحل من الخرز Chelex. هذا أمر بالغ الأهمية، كما هو Chelex مبادل الموجبة، وبالتالي يمنع بشدة جميع التفاعلات الأنزيمية. </li><li style=";text-align:right;direction:rtl"> تشغيل البرنامج PCR التالية: الحضانة في 94 درجة مئوية لمدة 3 دقائق، كل 45 دورات مع ذوبان الخطوة 30 ثانية 94 درجة مئوية، تليها خطوة الصلب 30 ثانية في 55 درجة مئوية، تليها خطوة استطالة 45 ثانية في 72 ° C. في نهائي مطاردة قبالة الخطوة، يتم تحضين ردود الفعل لمدة 5 دقائق عند 72 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> إعداد معيار TBE 2٪ أو TAE agaro<html> حد ذاتها هلام لفصل المنتجات PCR. </li><li style=";text-align:right;direction:rtl"> تشغيل هلام الاغاروز مع إعدادات الجهد المناسب. </li><li style=";text-align:right;direction:rtl"> تصور العصابات تحت ضوء الأشعة فوق البنفسجية والتقاط صورة. تأكد من يتم فصل اثنين من العصابات في العينات القادمة من الإناث أيضا. </li><li style=";text-align:right;direction:rtl"> تمييز الذكور من الإناث عينات من وجود واحد (الذكور) أو اثنين (أنثى) العصابات. </li></ol> 6. تمييز الكتاكيت <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تحقق أعشاش للالكتاكيت حديثة الفقس على جدول زمني مناسب للأنواع / دراسة (مثل الشيكات يوميا في الصباح وينصح لأن معظم الكتاكيت يفقس ثم). </li><li style=";text-align:right;direction:rtl"> قطع الريش أسفل كل فرخ داخل العش في مكان سمة مختلفة. في العصافير حمار وحشي خصلات من الهبوط تنمو في أربعة مجالات مميزة ومتميزة في جميع أنحاء الجسم (الشكل 4A) في عشش و. لكل كتكوت خفض منطقة واحدة (الشكل 4B). إذا كان هناك أكثر من أربعة فراخ داخل عش واحد، ويمكن الجمع بين فريدة من نوعها &quot;حلاقة&quot; الأربعة. </li></ol>ove_content &quot;&gt; للالعصافير حمار وحشي: تطبيق نطاقات الساق في آخر عشرة أيام الفقس عندما تصبح أسفل الريش من الصعب الكشف عن حجم وعشش يسمح الرنين.

<ol>
	<li>Russell, W. M. S., Burch, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+principles+of+humane+experimental+technique.">The principles of humane experimental technique.</a> , (1959).</li><li>Robertson, B. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+kakapo,+Strigops+habroptilus+Aves,+from+feces.">Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces.</a> Mol. Ecol. 8, 1349-1350 (1999).</li><li>Yannic, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Description+of+microsatellite+markers+and+genotyping+performances+using+feathers+and+buccal+swabs+for+the+Ivory+gull+(Pagophila+eburnea).">Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea).</a> Mol. Ecol. Resour. 11, 877-889 (2011).</li><li>Bello, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+feathers.">Isolation of genomic DNA from feathers.</a> J. Vet. Diagn. Invest. 13, 162-164 (2001).</li><li>Handel, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+buccal+swabs+for+sampling+DNA+from+nestling+and+adult+birds.">Use of buccal swabs for sampling DNA from nestling and adult birds.</a> Wildl. Soc. Bull. 34, 1094-1100 (2006).</li><li>Brubaker, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+noninvasive,+direct+real-time+PCR+method+for+sex+determination+in+multiple+avian+species.">A noninvasive, direct real-time PCR method for sex determination in multiple avian species.</a> Mol. Ecol. Resour. 11, 415-417 (2011).</li><li>Arima, H., Ohnishi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Usefulness+of+avian+buccal+cells+for+molecular+sexing.">Usefulness of avian buccal cells for molecular sexing.</a> Ornithological Science. 5, 139-143 (2006).</li><li>Seki, S. -. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+Ryukyu+Robins+Erithacus+komadori+using+buccal+cells+as+a+non-invasive+source+of+DNA.">Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA.</a> Ornithological Science. 2, 135-137 (2003).</li><li>Wellbrock, A. H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Buccal+swabs+as+a+reliable+source+of+DNA+for+sexing+young+and+adult+Common+Swifts+(Apus+apus).">Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus).</a> J. Ornithol. 153, 991-994 (2012).</li><li>Marion, W. R., Shamis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotated-Bibliography+of+Bird+Marking+Techniques.">Annotated-Bibliography of Bird Marking Techniques.</a> Bird Banding. 48, 42-61 (1977).</li><li>Scharff, C., Adam, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurogenetics+of+birdsong.">Neurogenetics of birdsong.</a> Curr. Opin. Neurobiol. , (2012).</li><li>Griffith, S. C., Buchanan, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Zebra+Finch:+the+ultimate+Australian+supermodel.">The Zebra Finch: the ultimate Australian supermodel.</a> Emu. 110, 5-12 (2010).</li><li>Fee, M. S., Scharff, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+songbird+as+a+model+for+the+generation+and+learning+of+complex+sequential+behaviors.">The songbird as a model for the generation and learning of complex sequential behaviors.</a> Ilar J. 51, 362-377 (2010).</li><li>Honarmand, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stressful+dieting:+nutritional+conditions+but+not+compensatory+growth+elevate+corticosterone+levels+in+zebra+finch+nestlings+and+fledglings.">Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings.</a> PLoS On. 5, (1371).</li><li>Krause, E. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebra+finch+nestlings+beg+more+under+better+nutritional+conditions.">Zebra finch nestlings beg more under better nutritional conditions.</a> Behaviour. 148, 1239-1255 (2011).</li><li>Griffiths, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA+test+to+sex+most+birds.">A DNA test to sex most birds.</a> Mol. Ecol. 7, 1071-1075 (1998).</li><li>Pluthero, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+purification+of+high-activity+Taq+DNA+polymerase.">Rapid purification of high-activity Taq DNA polymerase.</a> Nucleic Acids Res. 21, 4850-4851 (1993).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Joint+Working+Group+on+Refinement.+Laboratory+birds:+refinements+in+husbandry+and+procedures.+Fifth+report+of+BVAAWF/FRAME/RSPCA/UFAW+Joint+Working+Group+on+Refinement.">Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement.</a> Lab Anim. 35, 1-163 (2001).</li></ol>

والكتاب ليس لديهم ما يكشف.

تلفيق من مسحات الشدق باستخدام Chelex أظهرت نسبة نجاح عالية للغاية. الريش أسفل قطع فقس البيض لتمكين التفريق بين الصقور الصغيرة حتى كان ربط الساق ممكن. استخراج الحمض النووي من Chelex مسحات الشدق أسفرت عن الحمض النووي كافية لتنفيذ [سإكسين...

الاعتراف الفردي، [سإكسينغ والتنميط الجيني هي الشروط الأساسية في مجموعة متنوعة من الدراسات التجريبية. وينبغي الحصول على الحمض النووي والمواد التي تحمل العلامات المواضيع لا لبس فيه (حتى في سن مبكرة) لها تأثير ضئيل على علم وظائف الأعضاء والسلوك، والبقاء على قيد الحياة. كلما كان ذلك ممكنا، وينبغي تجنب الإجراءات الغازية وفقا لمبدأ RRR 1. أساليب غير الغازية ليست فقط مفيدة للحيوان ولكن أيضا قد تؤدي إلى تحسين البيانات التي تم الحصول عليها كما هي أقل تأثرا من الحيوانات العلاجات. في الطيور، [سإكسينغ الحمض النووي لا يمكن أن يؤديها على عدد من المواد التي يمكن الحصول عليها غير جراحية مثل فضلات 2، 3،4 الريش أو مسحات الشدق 3،5،9. بغض النظر عن حالة والعمر مسحات الشدق الموضوع هي الأسلوب المفضل ل[سإكسينغ الطيور، لأنها سهلة لتنفيذ، ونادرا ما تفشل والمناولة قصيرة. حتى الآن، والحمض النووي من مسحات الشدقتم استخراج إما مع مجموعات المتاحة تجاريا 3،6 أو مضيعة للوقت قياسي بروتوكولات استخراج الحمض النووي 3،6-8. مجموعات ليست فقط مكلفة نوعا ما، ولكن يمكن بروتوكولاتها تفرض تحديات للعمل الميداني. بعض التفاصيل الإجرائية، مثل التجفيف وحضانة العينات، ليست عملية في هذا المجال. خصوصا في وضع حيث تتطلب البروتوكولات التجريبية الجنس العلاج تعتمد في وقت مبكر من بضع دقائق الفقس آخر، هناك حث للطريقة سريعة وغير الغازية وموثوقة وسهلة للحصول على نتائج. عبر أصناف الطيور وقد تم تطوير مجموعة أدوات كبيرة للأفراد بمناسبة 10. مجموعة واسعة من التقنيات المتاحة لحسابات متنوعة من أهداف البحث والأنواع والميزانيات. ومع ذلك، بمناسبة الصقور الصغيرة صغيرة واجهت الباحثين مع تحديات إضافية. في بعض الأنواع (مثل العصفوريات) فراخ صغيرة جدا لتطبيق نطاقات الساق وتتطلب طرق بديلة، والتيلا تغير سلوك الآباء والأبناء. كما الوعي والاهتمام في تحسين الرفاهية والتقنيات في الدراسات الميدانية والمختبرية الحيوان ينمو، واستخدام تقنيات غير الغازية ويشجع بقوة وفضل. يوفر هذا البروتوكول لذلك، طريقة سريعة، يمكن التعرف عليها بسهولة ومستمرة غير الغازية للاحتفال بشكل فردي الصقور الصغيرة مبكرة جدا قبل تطبيق نطاقات الساق هو ممكن عمليا. يتم إدخال هذه الطريقة لوضع علامات على واحدة من أهم الأنواع نموذج مختبر الطيور، زيبرا فينش (Taeniopygia الرقشاء) 11-13. بروتوكول يتوافق مع جميع الأهداف التي تم نشرها مسبقا لتقنيات بمناسبة الفردية 10 وتم تطبيقه بالفعل بنجاح 14،15.

<table border="0" cellpadding="0" cellspacing="0" width="702">
	<tbody>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">Whatman 3MM Chromatography paper</td>
			<td style="width:163px;">e.g. Fisher Scientific</td>
			<td style="width:269px;">No.:3030-153</td>
			<td style="width:80px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:191px;">Chelex 100 Resin</td>
			<td style="width:163px;">Biorad</td>
			<td style="width:269px;">#143-2832</td>
			<td></td>
		</tr>
		<tr height="50">
			<td height="50" style="height:50px;width:191px;">Taq polymerase</td>
			<td style="width:163px;">addgene</td>
			<td style="width:269px;">http://www.addgene.org/25712/</td>
			<td></td>
		</tr>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">leg band (Flexi number rings for birds, diameter 2,5 mm)</td>
			<td style="width:163px;">Horst Stengel &#38; Sohn</td>
			<td style="width:269px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

who is who? non-invasive methods to individually sex and mark altricial chicks

العديد من التجارب تتطلب تحديد النسل في وقت مبكر من الجنس وكذلك وضع العلامات المبكرة لحديثي الولادة للاعتراف الفردية. وفقا للمبادئ التوجيهية الرفق بالحيوان، ينبغي تفضيل تقنيات غير الغازية متى شاءت. في مجموعتنا، ونحن نعمل على أنواع مختلفة من الطيور الأغنية في المختبر أو في الميدان، ونجحنا في تطبيق أساليب غير الغازية لممارسة الجنس وبشكل فردي بمناسبة الكتاكيت. تعرض هذه الورقة غير الغازية أداة مربع شاملة. تلفيق الطيور قبل التعبير عن الصفات الجنسية الثانوية يتطلب جمع المواد DNA الحاملة للPCR. أنشأنا طريقة سريعة وسهلة للطيور الجنس في أي عمر (آخر الفقس) عن طريق استخراج الحمض النووي من مسحات الشدق. ويمكن الحصول على نتائج في غضون 3 ساعات. ليتم قطع الريش أسفل الفردية فرخ وسم في أنماط محددة تسمح بتحديد سريع داخل النظام الفقس. هذه مجموعة من الأساليب ينطبق بسهولة في المختبر القياسية مجهزة ومناسبة خاصة لركينمطلوب ز في الميدان وعدم وجود معدات خاصة لأخذ العينات والتخزين. يتم التقليل من التعامل مع الدجاج ووضع العلامات وتلفيق تقنيات غير الغازية مما يدعم RRR-مبدأ من المبادئ التوجيهية رعاية الحيوان.

<html> ويمكن استخدام مسحات الشدق للحصول على الحمض النووي لتحديد الجنس في مجموعة متنوعة من الطيور الصغيرة تم جمع عينات من طيور البرقش زيبرا (Taeniopygia الرقشاء، 99 الأفراد، والعمر 0 أيام - 5 سنوات)، جزر الخالدات (Serinus كناريا)، البنغا?...

Watch this Scientific Journal Video about Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks at JoVE.com

Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

يوفر هذا البروتوكول مجموعة مريحة من الأساليب، والتي تمكن سريع للغاية، وسهلة وغير الغازية وموثوقة ومنخفضة التكلفة، وتحديد الجنس الجزيئية من الطيور وعلى غير الغازية، سريعة وآمنة ويمكن التعرف عليها بسهولة بمناسبة بعد وقت قصير من الفقس. مطلوب فقط معالجة محدودة من الكتاكيت. هذه الأدوات ملائمة لأساليب يتوافق تماما مع المبادئ التوجيهية-RRR.

من هو من؟ طرق غير الغازية إلى الجنس بشكل فردي ومارك Altricial الفراخ

Many experiments require early determination of offspring's sex as well as early marking of newborns for individual recognition. According to animal ...

who-is-who-non-invasive-methods-to-individually-sex-mark-altricial

Research

JoVE Journal

Biology

18.2K Views.  Freie Universität Berlin.  يوفر هذا البروتوكول مجموعة مريحة من الأساليب، والتي تمكن سريع للغاية، وسهلة وغير الغازية وموثوقة ومنخفضة التكلفة، وتحديد الجنس الجزيئية من الطيور وعلى غير الغازية، سريعة وآمنة ويمكن التعرف عليها بسهولة بمناسبة بعد وقت قصير من الفقس. مطل?...

Video: Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Labeling hESCs and hMSCs with Iron Oxide Nanoparticles for Non-Invasive in vivo Tracking with MR Imaging

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative medicine. A non-invasive method to monitor the transplanted stem cells repeatedly in vivo would greatly enhance our ability to understand the mechanisms that control stem cell death and identify trophic factors and signaling pathways that improve stem cell engraftment. MR imaging has been proven to be an effective tool for the in vivo depiction of stem cells with near microscopic anatomical resolution. In order to detect stem cells with MR, the cells have to be labeled with cell specific MR contrast agents. For this purpose, iron oxide nanoparticles, such as superparamagnetic iron oxide particles (SPIO), are applied, because of their high sensitivity for cell detection and their excellent biocompatibility. SPIO particles are composed of an iron oxide core and a dextran, carboxydextran or starch coat, and function by creating local field inhomogeneities, that cause a decreased signal on T2-weighted MR images. This presentation will demonstrate techniques for labeling of stem cells with clinically applicable MR contrast agents for subsequent non-invasive in vivo tracking of the labeled cells with MR imaging.

For the evaluation of new stem cell therapies it is important to non-invasively track the injected cells in vivo. This video will show you how to label human mesenchymal and embryonic stem cells with iron oxide based contrast agents in vivo for subsequent MR imaging in vivo.

ووضع العلامات hESCs hMSCs مع أوكسيد الحديد النانوية لعدم الغازية في تعقب المجراة مع التصوير بالرنين المغناطيسي

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative ...

Labeling Stem Cells with Fluorescent Dyes for non-invasive Detection with Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo labeling of stem cells with a fluorescent dye, subsequent intravenous injection of the labeled cells and visualization of their accumulation in specific target organs or pathologies. The presented technique demonstrates how we label human mesenchymal stem cells (hMSC) by simple incubation with the lipophilic fluorescent dye DiD (C67H103CIN2O3S) and how we label human embryonic stem cells (hESC) with the FDA approved fluorescent dye Indocyanine Green (ICG). The uptake mechanism is via adherence and diffusion of the lypophilic dye across the phospholipid cell membrane bilayer. The labeling efficiency is usually improved if the cells are incubated with the dye in serum-free media as opposed to incubation in serum-containing media. Furthermore, the addition of the transfection agent Protamine Sulfate significantly improves contrast agent uptake.

This video shows techniques for labeling of human embryonic stem cells and mesenchymal stem cells with fluorescent dyes. This technique can be used for an in vivo tracking of transplanted stem cells with optical imaging and for histopathological correlations with fluorescence microscopy.

وسم الخلايا الجذعية مع الأصباغ نيون للمنظمات غير الغازية مع الكشف عن التصوير الضوئي

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo ...

Non-invasive 3D-Visualization with Sub-micron Resolution Using Synchrotron-X-ray-tomography

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard cuticle which makes it difficult to use protocols of classical histology. In addition, histological sectioning destroys the sample and can therefore not be used for unique material. Hence, a non-destructive method is desirable which allows to view inside small samples without the need of sectioning.
We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) in Grenoble (France) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows us to reconstruct the internal organization in its natural state without the artefacts produced by histological sectioning. These date can be used for quantitative morphology, landmarks, or for the visualization of animated movies to understand the structure of hidden body parts and to follow complete organ systems or tissues through the samples.

We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows the reconstruction of internal structures in their natural state without the artefacts produced by histological sectioning.

غير الغازية مع التصور 3D - الفرعية ميكرون القرار باستخدام السنكروترون - X - أشعة التصوير المقطعي

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard ...

A Magnetic Tether System to Investigate Visual and Olfactory Mediated Flight Control in Drosophila

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. As such, visual stabilization of upwind tracking directly aids in odor tracking. But do olfactory signals directly influence visual tracking behavior independently from wind cues? Also, the recent deluge of research on the neurophysiology and neurobehavioral genetics of olfaction in Drosophila has motivated ever more technically sophisticated and quantitative behavioral assays. Here, we modified a magnetic tether system originally devised for vision experiments by equipping the arena with narrow laminar flow odor plumes. A fly is glued to a small steel pin and suspended in a magnetic field that enables it to yaw freely. Small diameter food odor plumes are directed downward over the fly s head, eliciting stable tracking by a hungry fly. Here we focus on the critical mechanics of tethering, aligning the magnets, devising the odor plume, and confirming stable odor tracking.

Here we describe how to tether a fly in an olfactory magnetic-tether (OMT) apparatus. We describe how to align the rare-earth magnets and odor ports, and how to set mass flow rates for both the stimulus delivery and vacuum suction to achieve optimal odor tracking.

: نظام الحبل المغناطيسي بالتحقيق البصرية والشمية التحكم الطيران توسط في ذبابة الفاكهة

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. ...

Cell Block Preparation from Cytology Specimen with Predominance of Individually Scattered Cells

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually scattered cells and small cell groups. This technique uses HistoGel (Thermo Scientific) with conventional laboratory equipment.
The use of cell block sections is a valuable ancillary tool for evaluation of non-gynecologic cytology. They enable the cytopathologist to study additional morphologic specimen detail including the architecture of the lesion. Most importantly, they allow for the evaluation of ancillary studies such as immunocytochemistry, in-situ hybridization tests (FISH/CISH) and in-situ polymerase chain reaction (PCR). Traditional cell block preparation techniques have mostly been applied to non-gynecologic cytology specimens, typically for body fluid effusions and fine needle aspiration biopsies.
Liquid based cervicovaginal specimens are relatively less cellular than their non-gynecologic counterparts with many individual scattered cells. Because of this, adequate cellularity within the cell block sections is difficult to achieve. In addition, the histotechnologist sectioning the block cannot visualize the level at which the cells are at the highest concentration. Therefore, it is difficult to monitor the appropriate level at which sections can be selected to be transferred to the glass slides for testing. As a result, the area of the cell block with the cells of interest may be missed, either by cutting past or not cutting deep enough. Current protocol for Shidham's method addresses these issues. Although this protocol is standardized and reported for gynecologic liquid based cytology specimens, it can also be applied to non-gynecologic specimens such as effusion fluids, FNA, brushings, cyst contents etc for improved quality of diagnostic material in cell block sections.

Shidham's method for preparation of cell blocks with AV-marker from cytology specimens containing individually scattered cells and small cell groups.

خلية إعداد كتلة من العينة مع غلبة علم الخلايا من خلايا منفردة غيوم

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually ...

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing and adult tissue. An advance in this concept is Genetic Inducible Fate Mapping (GIFM), linking gene expression, cell fate, and cell behaviors in vivo, to create fate maps based on genetic lineage.
GIFM exploits X-CreER lines where X is a gene or set of gene regulatory elements that confers spatial expression of a modified bacteriophage protein, Cre recombinase (CreERT). CreERT contains a modified estrogen receptor ligand binding domain which renders CreERT sequestered in the cytoplasm in the absence of the drug tamoxifen. The binding of tamoxifen releases CreERT, which translocates to the nucleus and mediates recombination between DNA sequences flanked by loxP sites. In GIFM, recombination typically occurs between a loxP flanked Stop cassette preceding a reporter gene such as GFP.
Mice are bred to contain either a region- or cell type-specific CreER and a conditional reporter allele. Untreated mice will not have marking because the Stop cassette in the reporter prevents further transcription of the reporter gene. We administer tamoxifen by oral gavage to timed-pregnant females, which provides temporal control of CreERT release and subsequent translocation to the nucleus removing the Stop cassette from the reporter. Following recombination, the reporter allele is constitutively and heritably expressed. This series of events marks cells such that their genetic history is indelibly recorded. The recombined reporter thus serves as a high fidelity genetic lineage tracer that, once on, is uncoupled from the gene expression initially used to drive CreERT.
We apply GIFM in mouse to study normal development and ascertain the contribution of genetic lineages to adult cell types and tissues. We also use GIFM to follow cells on mutant genetic backgrounds to better understand complex phenotypes that mimic salient features of human genetic disorders.
This video article guides researchers through experimental methods to successfully apply GIFM. We demonstrate the method using our well characterized Wnt1-CreERT;mGFP mice by administering tamoxifen at embryonic day (E)8.5 via oral gavage followed by dissection at E12.5 and analysis by epifluorescence stereomicroscopy. We also demonstrate how to micro-dissect fate mapped domains for explant preparation or FACS analysis and dissect adult fate-mapped brains for whole mount fluorescent imaging. Collectively, these procedures allow researchers to address critical questions in developmental biology and disease models.

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Genetic Inducible Fate Mapping (GIFM) marks and tracks cells with fine spatial and temporal control in vivo and elucidates how cells from a specific genetic lineage contribute to developing and adult tissues. Demonstrated here are the techniques required to fate map E12.5 mouse embryos for epifluorescent and explant analysis.

نهج عملي لرسم الخرائط الوراثية محرض مصير : دليل مرئي لمارك وتعقب خلايا في فيفو</em

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing ...

A Reversible, Non-invasive Method for Airway Resistance Measurements and Bronchoalveolar Lavage Fluid Sampling in Mice

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated procedures to obtain such measurements in the same animal are generally not feasible.  Here, we demonstrate protocols for obtaining from mice repeated measurements of AHR and bronchoalveolar lavage fluid samples.  Mice were challenged intranasally seven times over 14 days with a potent allergen or sham treated.  Prior to the initial challenge, and within 24 hours following each intranasal challenge, the same animals were anesthetized, orally intubated and mechanically ventilated.  AHR, assessed by comparing dose response curves of respiratory system resistance (RRS) induced by increasing intravenous doses of acetylcholine (Ach) chloride between sham and allergen-challenged animals, were determined.  Afterwards, and via the same intubation, the left lung was lavaged so that differential enumeration of airway cells could be performed.  These studies reveal that repeated measurements of AHR and BAL fluid collection are possible from the same animals and that maximal airway hyperresponsiveness and airway eosinophilia are achieved within 7-10 days of initiating allergen challenge.  This novel technique significantly reduces the number of mice required for longitudinal experimentation and is applicable to diverse rodent species, disease models and airway physiology instruments.  

Repeated measurements of rodent respiratory physiology and sampling of airway inflammatory cells are desirable, but generally not feasible. Here we describe a repeatable method for orally intubating mice that permits repeated measurements of airway hyperreactivity and sampling of airway inflammatory cells.

A عكسية ، غير الغازية طريقة لقياس مقاومة مجرى الهواء وأخذ عينات السوائل غسل القصبات في الفئران

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

برازي تحليل جلايكورتيكود: رصد الغدة الكظرية غير الغازية في الخيليات

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

Methods to Discover Alternative Promoter Usage and Transcriptional Regulation of Murine Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually untranslated &#8212; first exons. Bcrp1 (Abcg2), the murine orthologue of the ABC transporter Breast Cancer Resistance Protein (BCRP, ABCG2), has at least four alternative promoters that are designated by the corresponding four alternative first exons produced: E1U, E1A, E1B, and E1C. Herein, in-silico protocols are presented to predict alternative promoter usage for Bcrp1. Furthermore, reporter assay methods are described to produce reporter constructs for alternative promoters and to determine the functionality of putative promoters upstream of the alternative first exons that are identified.

With the murine ABC transporter Bcrp1 (Abcg2) as an example, in-silico protocols are presented to detect alternative promoter usage in genes expressed in mouse tissues, and to evaluate the functionality of the alternative promoters identified using reporter assays.

طرق لاكتشاف المروج البديل الاستخدام وتنظيم الترانسكربتي من الفئران Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually ...

Methods to Classify Cytoplasmic Foci as Mammalian Stress Granules

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to stress conditions, are implicated in various aspects of cell metabolism and survival. SGs modulate cellular signaling pathways, post-transcriptional gene expression, and stress response programs. The formation of these mRNA-containing granules is directly connected to cellular translation. SG assembly is triggered by inhibited translation initiation, and SG disassembly is promoted by translation activation or by inhibited translation elongation. This relationship is further highlighted by SG composition. Core SG components are stalled translation pre-initiation complexes, mRNA, and selected RNA-binding Proteins (RBPs). The purpose of SG assembly is to conserve cellular energy by sequestering translationally stalled housekeeping mRNAs, allowing for the enhanced translation of stress-responsive proteins. In addition to the core constituents, such as stalled translation preinitiation complexes, SGs contain a plethora of other proteins and signaling molecules. Defects in SG formation can impair cellular adaptation to stress and can thus promote cell death. SGs and similar RNA-containing granules have been linked to a number of human diseases, including neurodegenerative disorders and cancer, leading to the recent interest in classifying and defining RNA granule subtypes. This protocol describes assays to characterize and quantify mammalian SGs.

Stress Granules (SGs) are nonmembranous cytoplasmic structures that form in cells exposed to a variety of stresses. SGs contain mRNAs, RNA-binding proteins, small ribosomal subunits, translation-related factors, and various cell signaling proteins. This protocol describes a workflow that uses several experimental approaches to detect, characterize, and quantify bona fide SGs.

طرق لتصنيف البؤر السيتوبلازمية كما حبيبات الإجهاد الثدييات

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to ...