Name: microscopy-based assays for high-throughput screening of host factors involved in brucella infection of hela cells
Uploaded: 2016-08-05T14:00:00
Description: Watch this Scientific Journal Video about Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells at JoVE.com

This work was supported by grants 51RT 0_126008 and 51RTP0_151029 for the Research and Technology Development (RTD) project InfectX and TargetInfectX, respectively, in the frame of SystemsX.ch, the Swiss Initiative for Systems Biology. We acknowledge grant 310030B_149886 from the Swiss National Science Foundation (SNSF). Work of S.H.L and A.C. was supported by the International PhD Program "Fellowships for Excellence" of the Biozentrum. Simone Muntwiler is acknowledged for technical assistance. We would like to thank Dirk Bumann for providing pNF106 and Jean Celli for pJC43 and pJC44.

Note: All work with live Brucella abortus strains must be performed inside a biosafety level 3 (BSL3) laboratory considering all required regulations and safety precautions.
1. Preparation of Screening Plates and Culturing of Bacteria and Cells
<ol>
	<li>Preparation of Brucella abortus Starter Cultures
	<ol>
		<li>Streak Brucella abortus 2308 (B. abortus) from -80 &#176;C milk stock on a Tryptic Soy Agar (TSA) plate containing 50 &#181;g/ml kanamycin (TSA/...

<ol>
	<li>Pappas, G., Papadimitriou, P., Akritidis, N., Christou, L., Tsianos, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+global+map+of+human+brucellosis.">The new global map of human brucellosis.</a> Lancet Infect Dis. 6, 91-99 (2006).</li><li>Atluri, V. L., Xavier, M. N., de Jong, M. F., den Hartigh, A. B., Tsolis, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+of+the+human+pathogenic+Brucella+species+with+their+hosts.">Interactions of the human pathogenic Brucella species with their hosts.</a> Annu Rev Microbiol. 65, 523-541 (2011).</li><li>Guzman-Verri, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTPases+of+the+Rho+subfamily+are+required+for+Brucella+abortus+internalization+in+nonprofessional+phagocytes:+direct+activation+of+Cdc42.">GTPases of the Rho subfamily are required for Brucella abortus internalization in nonprofessional phagocytes: direct activation of Cdc42.</a> J Biol Chem. 276, 44435-44443 (2001).</li><li>Starr, T., Ng, T. W., Wehrly, T. D., Knodler, L. A., Celli, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+intracellular+replication+requires+trafficking+through+the+late+endosomal/lysosomal+compartment.">Brucella intracellular replication requires trafficking through the late endosomal/lysosomal compartment.</a> Traffic. 9, 678-694 (2008).</li><li>Boschiroli, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Brucella+suis+virB+operon+is+induced+intracellularly+in+macrophages.">The Brucella suis virB operon is induced intracellularly in macrophages.</a> Proc Natl Acad Sci U S A. 99, 1544-1549 (2002).</li><li>Celli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+evades+macrophage+killing+via+VirB-dependent+sustained+interactions+with+the+endoplasmic+reticulum.">Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum.</a> J Exp Med. 198, 545-556 (2003).</li><li>Porte, F., Liautard, J. P., Kohler, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acidification+of+phagosomes+containing+Brucella+suis+is+essential+for+intracellular+survival+in+murine+macrophages.">Early acidification of phagosomes containing Brucella suis is essential for intracellular survival in murine macrophages.</a> Infect Immun. 67, 4041-4047 (1999).</li><li>Anderson, T. D., Cheville, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+morphometric+analysis+of+Brucella+abortus-infected+trophoblasts+in+experimental+placentitis.+Bacterial+replication+occurs+in+rough+endoplasmic+reticulum.">Ultrastructural morphometric analysis of Brucella abortus-infected trophoblasts in experimental placentitis. Bacterial replication occurs in rough endoplasmic reticulum.</a> Am J Pathol. 124, 226-237 (1986).</li><li>Qin, Q. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+screen+of+endoplasmic+reticulum-associated+host+factors+reveals+a+role+for+IRE1alpha+in+supporting+Brucella+replication.">RNAi screen of endoplasmic reticulum-associated host factors reveals a role for IRE1alpha in supporting Brucella replication.</a> PLoS Pathog. 4, e1000110 (2008).</li><li>Ramo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+analysis+of+large-scale+RNAi+screens+for+pathogen+entry.">Simultaneous analysis of large-scale RNAi screens for pathogen entry.</a> BMC genomics. 15, 1162 (2014).</li><li>Kuhbacher, A., Gouin, E., Cossart, P., Pizarro-Cerda, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+InlC+secretion+to+investigate+cellular+infection+by+the+bacterial+pathogen+Listeria+monocytogenes.">Imaging InlC secretion to investigate cellular infection by the bacterial pathogen Listeria monocytogenes.</a> J Vis Exp. , e51043 (2013).</li><li>Kentner, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shigella+reroutes+host+cell+central+metabolism+to+obtain+high-flux+nutrient+supply+for+vigorous+intracellular+growth.">Shigella reroutes host cell central metabolism to obtain high-flux nutrient supply for vigorous intracellular growth.</a> Proc Natl Acad Sci U S A. 111, 9929-9934 (2014).</li><li>Celli, J., Salcedo, S. P., Gorvel, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+coopts+the+small+GTPase+Sar1+for+intracellular+replication.">Brucella coopts the small GTPase Sar1 for intracellular replication.</a> Proc Natl Acad Sci U S A. 102, 1673-1678 (2005).</li><li>von Bargen, K., Gorvel, J. P., Salcedo, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Internal+affairs:+investigating+the+Brucella+intracellular+lifestyle.">Internal affairs: investigating the Brucella intracellular lifestyle.</a> FEMS microbiology reviews. 36, 533-562 (2012).</li><li>Kamentsky, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+structure,+function+and+compatibility+for+CellProfiler:+modular+high-throughput+image+analysis+software.">Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software.</a> Bioinformatics. 27, 1179-1180 (2011).</li></ol>

Bacterial pathogens have evolved numerous strategies to manipulate eukaryotic host cells to their benefit. Pathogens causing acute infections often show rapid proliferation which is accompanied by significant alarming of the immune system and loss of viability of infected cells. In contrast, Brucella and other pathogens that cause chronic infections manage to establish long-lasting interactions within host cells. Therefore, bacteria need to fine tune host cell functions to their benefit without disrupting cellul...

Brucella species are gram-negative, facultative intracellular pathogens belonging to the class of &#945;-Proteobacteria. They cause abortions and infertility in their natural hosts such as cattle, goats, or sheep resulting in severe economic losses in endemic areas. Brucellosis is one of the most important zoonotic diseases worldwide causing over half a million new human infections annually1. Transmission to human is most commonly caused by direct contact with infected animals or by ingestion of contaminated food such as unpasteurized milk. Symptoms of the febrile disease are unspecific, which causes difficulties in the diagnosis of brucellosis. If untreated, patients can develop a chronic infection with more severe symptoms such as arthritis, endocarditis, and neuropathy2.
On the cellular level Brucella is able to invade phagocytic and non-phagocytic cells and replicates within an intracellular compartment known as the Brucella-containing vacuole (BCV). Internalization of bacteria requires actin cytoskeleton rearrangements by Rac, Rho, and direct activation of Cdc423. Inside the eukaryotic host cell, the BCV traffics along the endocytic pathway and despite the interaction with lysosomes, bacteria manage to avoid degradation4. Acidification of the BCV by the vesicular ATPase is required to induce the expression of the bacterial type IV secretion system (T4SS)5. It is believed that bacterial effectors secreted by the T4SS are essential for Brucella to establish its replicative niche, since deletion of the T4SS6 or inhibition of the vesicular ATPase lead to defects in the establishment of the intracellular niche7. Bacteria do not replicate during the phase of trafficking until they reach an ER-derived vacuolar compartment8. Once intracellular proliferation occurs, the BCV is found in close association with ER markers such as calnexin and glucose-6-phosphatase6.
The molecular mechanisms by which Brucella enters cells, avoids lysosomal degradation, and finally replicates in an ER-like compartment remain largely unknown. Host factors involved in different steps of infection have mainly been identified by targeted approaches or a small scale small interfering RNA (siRNA) screen performed in Drosophila cells9. These have shed light on the contribution of individual host factors during Brucella infection but we are still far from a comprehensive understanding of the entire process.
Here, protocols that allow the identification of human host factors using large-scale RNA interference (RNAi) screening in combination with automated wide-field fluorescence microscopy and automated image analysis are presented. Reverse siRNA transfection of HeLa cells is performed as described earlier10,11 with minor modifications. The endpoint assay covers a large part of the Brucella intracellular lifecycle except the egress and the infection of neighboring cells. To further characterize the hits identified in the endpoint assay, a modified protocol to identify factors involved in early steps of the infection is used.
A Brucella abortus strain that constitutively expresses GFP is used for the endpoint assay where bacteria are allowed to infect cells for two days. During this time, bacteria enter cells, traffic to the ER-derived replicative niche, and replicate in the peri-nuclear space. The high levels of GFP signal can then be used to reliably detect individual cells which contain replicating bacteria.
To study Brucella entry in a high-throughput assay, it is important to be able to distinguish between intracellular and extracellular bacteria. The method presented here circumvents differential antibody staining of intracellular and extracellular bacteria. It is based on a Brucella strain expressing a tetracycline-inducible GFP in combination with constitutive expression of dsRed. The presence of a constitutive dsRed marker allows identification of all bacteria that are present in the sample. GFP expression is induced by the addition of the non-toxic tetracycline analog anhydrotetracycline (aTc) simultaneously with inactivation of extracellular bacteria by gentamicin (Gm). While the cell-impermeable antibiotic Gm kills extracellular bacteria, aTc can enter the host cell and induce GFP expression selectively in intracellular bacteria. This dual reporter allows the robust separation of single intracellular bacteria (GFP and dsRed signal) from extracellular bacteria (only dsRed signal) using wide-field microscopy. In order to reach detectable GFP expression by intracellular Brucella we have found that 4 hr of induction by aTc results in a reliable signal. Similar induction schemes to selectively express GFP in intracellular bacteria has been used previously to study intracellular Shigella12.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tryptic Soy Agar (TSA)</td>
			<td style="width:71px;">BD</td>
			<td style="width:119px;">236950</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tryptic Soy Broth (TSB)</td>
			<td style="width:71px;">Fluka</td>
			<td style="width:119px;">22092</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kanamycin sulfate</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">60615</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Skim milk</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">250 ml screw cap bottle</td>
			<td style="width:71px;">Corning</td>
			<td style="width:119px;">8396</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DMEM</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D5796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Calf Serum (FCS)</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">10270</td>
			<td style="width:167px;">Heat-inactivated</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.5%)</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">15400-054</td>
			<td style="width:167px;">10x stock solution, dilute 1:10 in PBS</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Scepte 2.0 Cell Counter</td>
			<td style="width:71px;">Merck Milipore</td>
			<td style="width:119px;">PHCC20060</td>
			<td style="width:167px;">Alternative cell counting devices can be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Greiner CELLSTAR 384-well plate</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">M2062</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Peelable aluminum foil</td>
			<td style="width:71px;">Costar</td>
			<td style="width:119px;">6570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Reagent dispenser: &#34;Multidrop 384 Reagent Dispenser&#34;</td>
			<td style="width:71px;">Thermo Scientific</td>
			<td style="width:119px;">5840150</td>
			<td style="width:167px;">Alternative reagent dispenser can be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Transfection reagent: &#34;Lipofectamine RNAiMAX</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">13778-150</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="252">
			<td height="252" style="height:252px;width:216px;">Automated plate washer: &#34;Plate washer ELx50-16&#34;</td>
			<td style="width:71px;">BioTek</td>
			<td style="width:119px;">ELX5016</td>
			<td style="width:167px;">This plate washer contains a 16-channel manifold suitable for 384-well plates. It fits into a biosafety cabinet and has a lid covering the plate during washing which reduces the risk of aerosol production. Alternative plate washers with similar features could be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Gentamicin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">G1397</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Anhydrotetracycline hydrochloride</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">37919</td>
			<td style="width:167px;">100 ug/ml solution in 100% ethanol is kept at -20&#176;C protected from light in aluminum-foil</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">20012</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="168">
			<td height="168" style="height:168px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">P6148</td>
			<td style="width:167px;">Dissolve in 0.2 M HEPES buffer, pH 7.4. Store at -20&#176;C and thaw freshly the day before use. Caution, PFA is toxic by inhalation, in contact with skin and if swallowed.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">HEPES</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">H3375</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Triton X-100</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T9284</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DAPI</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">10236276001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Scrambled siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">D-001810-10</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kif11 siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">L-003317-00</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ARPC3 siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">L-005284-00</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Brucella abortus 2308</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:216px;">pJC43 (apHT::GFP)</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;">Celli et al.12</td>
		</tr>
		<tr height="277">
			<td height="277" style="height:277px;width:216px;">pAC042.08 (apht::dsRed, tetO::tetR-GFP)</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;">Construction: pJC44 4 was digested with EcoRI followed by generation of blunt ends with Klenov enzyme and subsequent digestion with SalI. TetR-GFP was amplified from pNF106 using primer prAC090 and prAC092. Following digestion with SalI, the TetR-GFP product was ligated to the digested pJC44 vector.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Primer prAC090</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">TTTTTGAATTCTGGCAATTCCGACGTCTAAGAAACC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Primer prAC092</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">TTTTTGTCGACTTTGTCCTACTCAGGAGAGCGTTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HeLa CCL-2</td>
			<td style="width:71px;">ATCC</td>
			<td style="width:119px;">CCL-2</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="231">
			<td height="231" style="height:231px;width:216px;">ImageXpress Micro</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">IXM IMAGING MSCOPE</td>
			<td style="width:167px;">Automated cellular imaging microscope equipped with a precision motorized Z-stage. Alternative systems for automated microscopy and alternative components for hard- and software specified below can be employed.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">High-Speed Laser Auto-Focus</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">1-2300-1037</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CFI Super Fluor 10x objective</td>
			<td style="width:71px;">Nikon&#160;</td>
			<td style="width:119px;">MRF00100</td>
			<td style="width:167px;">N.A 0.50, W.D 1.20mm, DIC Prism: 10x, Spring loaded</td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Photometrics CoolSNAP HQ Monochrome CCD Camera</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">1-2300-1060</td>
			<td style="width:167px;">1392 x 1040 imaging pixels, 6.45 x 6.45-&#181;m pixels, 12 bits digitization</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">MetaXpress software</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">9500-0100</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:216px;">LUI-Spectra-X-7</td>
			<td style="width:71px;">Lumencor</td>
			<td style="width:119px;">SPECTRA X V-XXX-YZ</td>
			<td style="width:167px;">Light engine. The following light sources are used: violet (DAPI), cyan (GFP), green/yellow (RFP)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-377/50-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF02-447/60-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF409-Di03-25x36</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF02-472/30-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-520/35-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF495-Di03-25x36</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-562/40-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-624/40-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF593-Di03-25x36</td>
			<td></td>
		</tr>
	</tbody>
</table>

microscopy-based assays for high-throughput screening of host factors involved in brucella infection of hela cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Figure 1A shows an example of image analysis used to automatically identify infected cells in the endpoint assay. Nuclei of HeLa cells stained with DAPI were identified, a peri-nucleus of 8 pixels width surrounding the nucleus, and a Voronoi cell body by extension of the nucleus by 25 pixels were calculated. Since bacteria mainly proliferate in the peri-nuclear space, the GFP intensity in this area of the cell is the most robust measurement to discriminate between infecte...

Watch this Scientific Journal Video about Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells at JoVE.com

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

The overall goal of this high-throughput microscopy-based assay is to identify host factors involved in Brucella infection of HeLa cells. This method can help answer key questions in the host pathogen interaction field, such as identifying host proteins that either promote or prevent colonization by the intracellular pathogen Brucella. Main advantage of this technique is that the semi-automated workflow from the vet lab to image analysis allows for robots and efficient high-throughputs creating experiments.So this method can provide insight into Brucella host interactions using siRNA screens. Most of the protocol can be applied to other screening strategies. For example, or siRNA libraries.After culturing HeLa cells and preparing screening plates with siRNAs according to the text protocol thaw a black 384 well plate by centrifugation at 300 times G and room temperature for 20 minutes. Prepare transfection medium by using room temperature dmem without FCS. To dilute the transfection reagent one to 200 and carefully mix before use.Using a reagent dispenser add 25 microliters of transfection medium to each well of the 384 well plate and mix the solutions by moving the plate back and forth. Incubate the plate at room temperature for one hour to allow siRNA transfection reagent complex formation. In the meantime prepare HeLa cells by aspirating the culture medium and adding 2.5 milliliters of 0.05%trypsin EDTA in PBS to wash the subconfluent cells of a 75 square centimeter flask once.Then add 1.5 milliliters of fresh trypsin and transfer the flask to 37 degrees Celsius for two to three minutes until the cells round up. Use 10 milliliters of prewarmed dmem 60%FCS to resuspend the cells. Then, use an automated cell counter to count the cells before preparing a cell suspension of 10, 000 cells per milliliter in dmem with 16%FCS.Add 50 microliters of cell suspension to each well of transfection reagent. Resulting in 500 cells per well. Move the plate back and forth to evenly distribute the cells.Then, leave the plate at room temperature for five to 10 minutes to allow the cells to settle down. Use parafilm to seal the plate. And incubate it in a humid incubator on a prewarmed aluminum plate at 37 degrees Celsius with 5%C02 for 72 hours.Working with the class three pathogen B.abortus is dangerous and local biosafety regulations need to be followed which includes wearing a protective overall suit, protective gloves, mask, and goggles. One day, prior to infection, inoculate the previously determined amount of B.abortus starter culture in 50 milliliters of TSB KM medium. In a 250 milliliter screwcap bottle.Use parafilm to seal the bottle and grow bacteria overnight at 37 degrees Celsius and 100 RPM on a shaker to optical density 600.8 to 1.1. Measure the optical density 600 of the bacterial culture. And prepare the infection medium by diluting the bacterial culture in dmem 10%FCS to achieve the desired multiplicity of infection.Or, MOI. Using an automated plate washer exchange the transfection medium with 50 microliters of infection medium. Inside the hood transfer the plate into the centrifuge cage and centrifuge the 384 well plate at 400 times G and four degrees Celsius for 20 minutes.Then, use parafilm to seal the plate and incubate it on a prewarmed aluminum plate at 37 degrees Celsius and 5%C02 for four hours. After the incubation with the automated plate washer use dmem with 10%FCS containing 100 micrograms per milliliter of dentrimysen or GM to wash the cells to inactivate extracellular bacteria. Then, use parafilm to seal the plate and place it back on the prewarmed aluminum plate in the incubator for another 40 hours for the end point assay.To fix the cells, first use PBS to wash the wells. Then, exchange the PBS with 50 microliters of 3.7%PFA. In 2 at pH 7.4.And incubate the cells at room temperature for 20 minutes. After the incubation use 50 microliters of PBS to exchange the fixation medium. To stain the samples with the automated plate washer begin by using 50 microliters of 1%Triton X-100 in PBS for 10 minutes to permeabilize the cells.After using PBS to wash the cells three times add 50 microliters of PBS with one microgram per milliliter of DAPI and incubate at room temperature for 30 minutes. Then, use PBS to wash the cells three times before protecting them from light. Transfer the plate to the automated microscope.Set up the microscope parameters. Select the 10-X subjective. Then select the plate format corresponding to the 384 well plate.Acquire nine sites per well. Select Enable laser-based focusing. And, focus on plate and well bottom.Then, set first well acquired as the initial well for finding the sample and all sites for site autofocus. Next, for the DAPI channel manually adjust the Z offset for the focus. Then, press Find Sample to set the focus on the well bottom.Using the AutoExposure function get a good estimate for the exposure time. Manually correct the exposure time for the DAPI channel to ensure a wide dynamic range with low overexposure. Use this exposure time to image several sites throughout the plate.And adjust the exposure time manually until the brightest pixels reach approximately 80%of the maximal brightness over the sites. Repeat the steps to set the focus and exposure time, accordingly for all other channels. Then, start acquisition of the full plate.For the end point assay use the DAPI and GFP channels to image the full plate. To run an image analysis on stained cells in the end point assay, after calculating a shading model, according to the text protocol under View output settings select the input folder with the images and an output folder with the results. Then, define the text that the images have in common, and load the shading models.Click Start test mode and make sure the pause and displays setting for all modules are disabled. Enable the pause and display setting for module nine ImageMath. The enabled pause symbol will appear in yellow.The enabled display function will appear as an open eye. Next, click Run to run the analysis up to module nine. In module nine adjust the parameter multiply the second image by to a value that will suppress the DAPI signal in Brucella without suppressing the nuclei.To test the values for the module press Step. Right click on the newly opened image and set image contrast to log normalized. Repeatedly, step back to module nine.Adjust the parameter multiply the second image by and step over the module again until the Brucella signal is fully suppressed while at the same time black areas that indicate oversubtraction are minimized. Finding good parameters for certain modules requires gradually optimizing the parameters. It is definitely important to repeatedly step over the modules, trying different values and observe the effect on the displayed result.Enable pause and display for module 10. Identify primary objects. Set the parameter lower bound on threshold, high enough so that nuclei are segmented and background is ignored.To identify a good value step over the module then right click the input image and display the histogram where the peak typically indicates background. Starting from background intensity increase the parameter until the good segmentation of nuclei is achieved as displayed in the output image. The goal of the image analysis pipeline is to identify cells which contain replicating bacteria.This is achieved by setting different thresholds for the pathogen signal in the nucleus, peri-nucleus, and Voronoi cell body. Enable pause and display for module 15. Filter objects, as shown before and press Run.Set the parameter minimum value sufficiently high so that only cells with clearly visible Brucella in the nucleus are kept, and all others are filtered away. To identify a good value step over the module and display the output image. Increase the value stepwise until only cells with clearly visible Brucella at the nucleus are kept.After filtering for cells with bacteria in the peri-nucleus and Voronoi cell body in modules 16 and 17 according to the text protocol, exit the test mode and uncheck all the eye symbols next to the modules to make sure that none of the modules show their display prior to running the full analysis. Finally, press Analyze Images to start the analysis. When the analysis has finished inspect the resulting PNG images as well as the CSV spreadsheet to ensure that the analysis worked reliably throughout the plate.Carry out the entry assay and infection scoring according to the text protocol. This figure shows an example of image analysis used to automatically identify infected cells in the end point assay. Nuclei HeLa cells stained with DAPI were identified.A peri-nucleus of eight pixels width surrounding the nucleus. And a Voronoi cell body by extension of the nucleus, by 25 pixels, were calculated. A cell was considered infected if the pathogen signal exceeded the corresponding threshold in at least one compartment.Brucella requires acting rearrangements for successful engagement of host cells. Thus, depletion of ARP23 is a suitable positive control for siRNA screening. Depletion of ARPC3 reduced the number of cells with proliferating bacteria two days after infection.Compared to scrambled treated controlled cells. Automated image analysis quantifiably observed to decrease in infection of ARPC3 depleted HeLa cells compared to controlled cells in this graph. Depletion of ARPC3 also showed a reduction in Brucella infection in the entry assay compared to controlled cells.As seen by the reduced number of intracellular Brucella depicted in yellow. Finally, quantification of the infection by automated image analysis confirmed that the number of infected cells as well as the number of intracellular bacteria in infected cells was reduced by depletion of ARPC3. Once mastered, this protocol can give image analysis results within one and a half weeks after starting the experiment.While attempting this procedure it's important to carefully review the image analysis results to ensure that the chosen parameters perform well throughout the full plate. Following this procedure other methods like life cell imaging can be performed in order to answer additional questions. Like when you are trafficking a certain host factor interacts with Brucella.Or how depletion of a gene affects intracellular dynamics of infection. After it's development, this technique paved the way for researchers in the field of infection biology to explore host factors required for Brucella infection in a HeLa cell assay. After watching this video you should have a good understanding of how to identify host factors which promote, or prevent, the successful colonization of HeLa cells by the intracellular pathogen Brucella abortus.Don't forget that working with Brucella abortus can be extremely hazardous and local biosafety regulations have to be strictly followed.

Research

JoVE Journal

Immunology and Infection

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

A Fluorescence-based Lymphocyte Assay Suitable for High-throughput Screening of Small Molecules

High-throughput screening (HTS) is currently the mainstay for the identification of chemical entities capable of modulating biochemical reactions or ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

High-throughput Measurement of Plasma Membrane Resealing Efficiency in Mammalian Cells

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In ...