Die Autoren danken Frau Béatrice Dimitriades für Hilfe bei der Zellkultur. Diese Arbeit wurde unterstützt vom Schweizerischen Nationalfonds zur Förderung Zuschüsse #31003A_170216 und 51NF40_141735 (NFS RNA &#38; Krankheit).

<ol>
	<li>Jan, C. H., Friedman, R. C., Ruby, J. G., Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation,+regulation+and+evolution+of+Caenorhabditis+elegans+3'UTRs.">Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs.</a> Nature. 469 (7328), 97-101 (2011).</li><li>Spies, N., Burge, C. B., Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3'+UTR-isoform+choice+has+limited+influence+on+the+stability+and+translational+efficiency+of+most+mRNAs+in+mouse+fibroblasts.">3' UTR-isoform choice has limited influence on the stability and translational efficiency of most mRNAs in mouse fibroblasts.</a> Genome Res. 23 (12), 2078-2090 (2013).</li><li>Hoque, M., Ji, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+alternative+cleavage+and+polyadenylation+by+3'+region+extraction+and+deep+sequencing.">Analysis of alternative cleavage and polyadenylation by 3' region extraction and deep sequencing.</a> Nat. methods. 10 (2), 133-139 (2013).</li><li>Martin, G., Gruber, A. R., Keller, W., Zavolan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+pre-mRNA+3’+end+processing+reveals+a+decisive+role+of+human+cleavage+factor+I+in+the+regulation+of+3'+UTR+length.">Genome-wide analysis of pre-mRNA 3’ end processing reveals a decisive role of human cleavage factor I in the regulation of 3' UTR length.</a> Cell Rep. 1 (6), 753-763 (2012).</li><li>Gruber, A. R., Martin, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+3'+UTR+shortening+has+a+limited+effect+on+protein+abundance+in+proliferating+T+cells.">Global 3' UTR shortening has a limited effect on protein abundance in proliferating T cells.</a> Nat. Commun. 5, 5465 (2014).</li><li>Kivioja, T., V&#228;h&#228;rautio, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Counting+absolute+numbers+of+molecules+using+unique+molecular+identifiers.">Counting absolute numbers of molecules using unique molecular identifiers.</a> Nat. methods. 9 (1), 72-74 (2011).</li><li>Gruber, A. J., Schmidt, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+analysis+of+3'+end+sequencing+data+sets+reveals+novel+polyadenylation+signals+and+the+repressive+role+of+heterogeneous+ribonucleoprotein+C+on+cleavage+and+polyadenylation.">A comprehensive analysis of 3' end sequencing data sets reveals novel polyadenylation signals and the repressive role of heterogeneous ribonucleoprotein C on cleavage and polyadenylation.</a> Genome Res. 26 (8), 1145-1159 (2016).</li><li>Lingner, J., Keller, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3'-end+labeling+of+RNA+with+recombinant+yeast+poly(A)+polymerase.">3'-end labeling of RNA with recombinant yeast poly(A) polymerase.</a> Nucleic Acids Res. 21 (12), 2917-2920 (1993).</li><li>Quail, M. A., Kozarewa, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+large+genome+center's+improvements+to+the+Illumina+sequencing+system.">A large genome center's improvements to the Illumina sequencing system.</a> Nat. methods. 5 (12), 1005-1010 (2008).</li><li>Rahmann, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Snakemake--a+scalable+bioinformatics+workflow+engine.">Snakemake--a scalable bioinformatics workflow engine.</a> Bioinformatics. 28 (19), 2520-2522 (2012).</li><li>. Anaconda Software Distribution Available from: <a target="_blank" href="https://continuum.io">https://continuum.io</a> (2016)</li><li>Dobin, A., Davis, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STAR:+ultrafast+universal+RNA-seq+aligner.">STAR: ultrafast universal RNA-seq aligner.</a> Bioinformatics. 29 (1), 15-21 (2013).</li><li>Martin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutadapt+removes+adapter+sequences+from+high-throughput+sequencing+reads.">Cutadapt removes adapter sequences from high-throughput sequencing reads.</a> EMBnet.journal. 17 (1), 10-12 (2011).</li><li>Li, H., Handsaker, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Robinson, J. T., Thorvaldsd&#243;ttir, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat. Biotechnol. 29 (1), 24-26 (2011).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Ozsolak, F., Platt, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+RNA+sequencing.">Direct RNA sequencing.</a> Nature. 461 (7265), 814-818 (2009).</li><li>Yao, C., Biesinger, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome-wide+analyses+of+CstF64-RNA+interactions+in+global+regulation+of+mRNA+alternative+polyadenylation.">Transcriptome-wide analyses of CstF64-RNA interactions in global regulation of mRNA alternative polyadenylation.</a> Proc. Natl. Acad. Sci. U. S. A. 109 (46), 18773-18778 (2012).</li><li>Lin, Y., Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+in-depth+map+of+polyadenylation+sites+in+cancer.">An in-depth map of polyadenylation sites in cancer.</a> Nucleic Acids Res. 40 (17), 8460-8471 (2012).</li><li>Shepard, P. J., Choi, E. -. A., Lu, J., Flanagan, L. A., Hertel, K. J., Shi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complex+and+dynamic+landscape+of+RNA+polyadenylation+revealed+by+PAS-Seq.">Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq.</a> RNA. 17 (4), 761-772 (2011).</li><li>Fu, Y., Sun, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+genome-wide+profiling+of+tandem+3'+UTRs+among+human+breast+cancer+and+normal+cells+by+high-throughput+sequencing.">Differential genome-wide profiling of tandem 3' UTRs among human breast cancer and normal cells by high-throughput sequencing.</a> Genome Res. 21 (5), 741-747 (2011).</li></ol>

Die Autoren haben nichts preisgeben.

Die Vielzahl von Kern und zusätzliche Faktoren, die in der Pre-mRNA 3' Ende Verarbeitung beteiligt sind spiegelt sich in einer entsprechend komplex Polyadenylation Landschaft. Darüber hinaus reagiert Polyadenylation auch zu Veränderungen in anderen Prozessen wie Transkription und Spleißen. 3' Ende Spaltstellen in Pre-mRNAs sind in der Regel identifiziert anhand der charakteristischen poly(A) Schwänzen, die 5'-Spaltprodukte hinzugefügt werden. Die meisten Methoden verwenden oligo(dT) Primer von variabler Länge, mit denen die spezifischen Umwandlung von Poly (A)-mit mRNAs zu cDNAs in einer reversen Transkription Reaktion. Ein häufiges Problem dieses Ansatzes ist interne Grundierung auf A-reiche Sequenzen Serums Spaltstellen führt. Zwei Methoden, die darauf abzielen, dieses Artefakt in der Phase der Vorbereitung der Probe zu umgehen sind vorgeschlagen worden. In den 3P-Seq Methode 1sind Adapter speziell an den Enden von poly(A) Tails mit Hilfe einer Schiene Oligo gefolgt von teilweise RNase T1 Verdauung und reversen Transkription mit TTP in der Reaktion als die einzige Deoxynucleotide ligiert. Die daraus resultierende poly(A)-poly(dT) Heteroduplexes werden dann mit RNase H verdaut und die restlichen RNA-Fragmente isoliert, Adapter ligiert und sequenziert. Ein einfacher und eleganter Methode, 2P-Seq, die verwendet eine benutzerdefinierte Sequenzierung Grundierung überspringen die restliche Strecke der oligo(dT) in der Sequenzierung Reaktion durch die gleichen Autoren 2berichtet wurde. In einer entsprechenden Methode 3' liest 3, eine ungewöhnlich lange Grundierung 5 uns und 45 Ts, auch mit Biotin ist geglüht, fragmentierte RNA, gefolgt von strengen Waschungen für RNA-Moleküle mit poly(A) Schwänzen von mehr als 50 Nukleotiden auswählen. Obwohl 3' liest drastisch die Häufigkeit von internen Priming reduziert, beseitigt es nicht völlig es 3. Protokolle für die direkte RNA Sequenzierung auch vorgeschlagen worden, aber die resultierende liest sind kurz und haben eine hohe Fehlerquote und dieser Ansatz wurde nicht weiter entwickelten 18,19,20. Der PolyA-Seq und kommerzialisierten Quant Seq-Protokolle kombinieren oligo(dT) basierte Grundierung mit einem zufälligen Priming Schritt für die cDNA zweiten Strang Synthese 20. Die Verwendung der Vorlage Schalter reversen Transkription Reaktion mit Moloney Murine Leukämie Virus (MMLV) Reverse Transkriptase führt zu der Generation von cDNAs mit linker in einem einzigen Schritt und damit können keine Adapter-Dimere in der PAS-Seq und SAPAS Methoden erscheinen 21 , 22.
Die A-seq2 Methode hier vorgestellten zeichnet sich in der Nutzung eines spaltbaren Nukleotids (dU) innerhalb einer biotinylierte oligo(dT) Grundierung. Diese Modifikation verbindet das Dienstprogramm oligo(dT) hybridisiert, Polyadenylated Ziele mit der Entfernung von die meisten der Oligo (dT)25 Sequenz aus der isolierte Fragmente bevor Bibliotheken bereit sind und die Erhaltung der drei Ts zu bereichern, zeigen Sie vorherige poly(A) Schwanz. Im Gegensatz dazu lassen Sie Methoden, die RNase H um poly(A) nach dem Zufallsprinzip aus der RNA-Moleküle zu entfernen verwenden mehrere wie. Da im A-seq2, Sequenzierung von 3' Ende der Anti-Sense-Stränge erfolgt, sind Spaltstellen vorhergesagt befindet sich nach dem NNNNTTT Motiv zu Beginn des rohen Sequenz liest. Die randomisierte Tetramers dienen nicht nur Basis, sondern auch bei der Beseitigung von PCR-Amplifikation Artefakte aufrufen lassen. Längere UMIs können auch untergebracht werden. Die Möglichkeit der internen Grundierung bleibt in A-seq2 und richtet sich rechnerisch, zuerst durch verwerfen 3' endet mit einer genomisch kodiert, A-reiche nachgelagerten Sequenz und dann verwerfen 3' Ende Cluster, die durch interne Priming bei erklärt werden könnte die A-reiche poly(A) Signal selbst. Eine aktuelle Analyse von poly(A) Websites abgeleitet eindeutig durch eine Vielzahl von Protokollen zeigt, dass die Websites, die für A-seq2 einzigartig sind die erwarteten Nukleotid Verteilung und Plazierung Gene, ähnlich wie bei anderen 3' Sequenzierung Protokolle zu beenden.
Ein entscheidender Schritt in A-seq2 ist die Auswahl von Polyadenylated RNA und Entfernung der ribosomalen RNAs und verschiedenen kleinen RNAs. Dies geschieht am einfachsten durch eine mRNA-Isolierung-Kit mit Oligo (dT)25 magnetischen Kügelchen. Im Prinzip gibt total RNA isoliert mit Phenol auch Lösungen mit hochwertigen RNA, die weitere Auswahl durch die mRNA-Isolierung Kit oder Oligo (dT) Agarose unterzogen werden kann. Ein Schritt, der in A-seq2 variiert werden kann, ist die Behandlung mit alkalischen Hydrolyse, verkürzt oder verlängert um RNA-Fragmente unterschiedlicher Größe zu erhalten. Kritisch ist auch, dass Zusatz von 3' dATP bis 3' Ende der RNA-Fragmente von poly(A) Polymerase effizient ist. In dem hier beschriebenen Protokoll wird diese Behandlung alle RNA-Fragmente, um Concatemerization während der Ligatur Reaktion zu vermeiden. Endlich, wir beachten Sie, dass obwohl RNA Ligase 1 normalerweise als eine RNA-Ligase verwendet wird, es auch effizient single stranded DNA ligates, wie wir hier getan haben, um einen Adapter, um die 5'-Ende der DNA Moleküle verbinden.
So ist A-seq2 eine effiziente und einfach zu Protokoll für die Identifizierung der Pre-mRNA 3' End-Verarbeitung Websites zu implementieren. Zukünftige Entwicklungen zählen weitere Reduzierung der Komplexität des Protokolls und die Menge des benötigten Materials. Der damit verbundenen Satz von computergestützte Datenanalyse-Tools weiter ermöglichen die homogene Verarbeitung von 3' Ende Sequenzierung liest mit einer Vielzahl von Protokollen erhalten.

Die Erfassung und die Abfolge der mRNA 3' Enden ermöglicht die Untersuchung von mRNA-Verarbeitung und die Quantifizierung der Genexpression. Durch ihren Schwänzen poly(A) können eukaryontischen mRNAs effizient gereinigt werden vom gesamten Zelle Lysates mit Wulst immobilisiert Oligo-Deoxythymidine (oligo(dT))-Moleküle, die auch cDNA Synthese prime kann. Dieser Ansatz hat jedoch zwei Nachteile. Erstens können Strecken von A, die intern für Abschriften sind auch cDNA-Synthese, wodurch falsche poly(A) Websites prime. Zweite, homogene poly(A) Strecken stellen besondere Herausforderungen für die Sequenzierung, abgesehen davon, dass nicht informativ für Abschrift Identifikation. Verschiedene Ansätze wurden vorgeschlagen, diese Einschränkungen, z. B. reverse Transkription durch poly(A) umgehen Schwänzen gefolgt von RNase H Verdauung (3P-Seq 1), verwenden Sie eine benutzerdefinierte Sequenzierung Grundierung endet in 20 Ts (2P-Seq 2), Vorauswahl der RNA-Fragmente mit poly(A) Schwänzen von mehr als 50 Nukleotiden Primer eine CU5T45 gefolgt von RNase H Verdauung (3' liest 3) und die Verwendung von Oligo-dT Grundierung, die den 3'-Adapter in einer Haarnadelkurve (A-Seq 4) enthält.
Die neu entwickelte A-seq2 Methode 5 umgehen Sequenzierung durch poly(A) und gleichzeitig den Anteil der Dimere zu minimieren, die durch selbständige Ligatur der Adapter, besonders auftreten erzeugt werden soll wenn die molare Konzentration der Adapter überwiegt die einfügen-Konzentration. Dieses Problem kann beseitigt werden, wenn beide Adapter auf die gleiche Art von Polynukleotid enden wie in A-seq2 ligiert sind wo die 3'-Adapter, 5'-Ende der RNA-Fragmente und die Adapter 5', 5' Ende der cDNAs nach reversen Transkription ligiert werden. Die Methode ist bequemer als unsere zuvor vorgeschlagene A-Seq - in der Sequenzierung in den 5'-bis-3 wurde ' Richtung damit erfordern präzise gesteuert RNA Fragmentierung-, unter Beibehaltung einer hohen Genauigkeit der Poly-Website-Identifikation. Rund 80 % der sequenzierten lautet in typische Proben des Genoms eindeutig zuordnen und zur Identifizierung von mehr als 20.000 poly(A) Website Clustern, mehr als 70 % der welche Überschneidungen mit kommentierten 3' wo führen.
In Kürze beginnt die A-seq2 Protokoll mit mRNA Fragmentierung und Ligatur der Reverse-Ergänzung 3' Adapter an den 5'-Enden der RNA-Fragmente. Poly (A)-enthaltenden RNAs sind dann umgekehrte transkribiert mit 25 Nukleotide (nt) lang oligo(dT) Grundierung, die einen Anker Nukleotid am 3'-Ende, ein dU an Position 4 und Biotin am 5'-Ende, enthält so dass Bindung der cDNA, magnetische Streptavidin Perlen. Die meisten des Primers, einschließlich Biotin, ist aus der cDNA durch Spaltung an dU durch den Benutzer-Enzym-Mix enthält Uracil DNA Glycosylase (UDG) und der DNA-Glycosylase-Lyase Endonuklease VIII entfernt. Diese Reaktion lässt intakt endet für die Unterbindung der 5'-Adapter und drei Ts links nach Spaltung bleiben um markieren den Standort der Poly-Schwanz. Da 5' und 3'-Adapter durch Unterbindung an Empfänger 5' Enden verbunden sind, sind keine Adapter-Dimere generiert. Vier Nukleotid zufällige-Mers eingeführt Anfang liest ermöglicht Cluster Auflösung auf State-of-the-Art-Sequenzierung Instrumenten und kann auch als einzigartige molekulare Bezeichner (UMI) für die Erkennung und Entfernung von PCR-Amplifikation Artefakten dienen. Die Größe der UMI kann weiter erhöht werden, wie in anderen Studien 6getan. Das Protokoll liest, die Komplementäre mRNA 3' enden, alles beginnt mit einer randomisierten Tetramer, gefolgt von 3 Ts. Verarbeitung der Lesevorgänge, die 3 diagnostische Ts an ihre 5' Ende beginnt mit der Korrektur der PCR-Amplifikation Artefakte durch umkehren werden generiert UMIs, Entfernung von 3' Adapter Sequenzen, Ausnutzung und reverse-Ergänzung. Lesevorgänge, die aus oligo(dT) Grundierung an interne A-reiche Standorten entstanden sein können sind auch rechnerisch ermittelt und verworfen. Die unechten Websites in der Regel fehlt eines der 18 gut charakterisierten und konservierten poly(A) Signale die sollte befindet sich ~ 21 Nukleotide stromaufwärts der scheinbare Spaltung Seite 7.
Das Protokoll erfordert ca. 8 h Handhabungszeit Zellkultur und die Übernachtung grundsätzlich nicht zu zählen. Die damit verbundene lesen Analyse-Software ermöglicht eine hochpräzise poly(A) Website Identifikation. Von der Poly-Website erstellt Cluster basierend auf 4 Proben weiter hervorgehoben, in diesem Manuskript (zwei biologische Wiederholungen der Kontrolle SiRNA und Si-HNRNPC-behandelten Zellen) 84 % Überlappung mit einem kommentierten gen und davon, 75 % Überlappung mit einem 3' UTR und 86 % entweder mit einem 3' UTR oder ein terminal Exon. Der Pearson-Korrelationskoeffizient des Ausdrucks von 3' enden in den Replicate Proben ist 0.92 und Werte von über 0,9 sind in der Regel mit der Methode erhalten. A-seq2 ist somit eine bequeme Methode, die sehr reproduzierbare Ergebnisse liefert.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Materials</td>
			<td ></td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Agarose, ultra pure</td>
			<td>Invitrogen</td>
			<td>16500-500</td>
			<td ></td>
		</tr>
		<tr >
			<td >2100 Bioanalyzer</td>
			<td>Agilent</td>
			<td>G2940CA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Cordycepin triphosphate (3&#8217; dATP)</td>
			<td>SIGMA</td>
			<td>C9137</td>
			<td ></td>
		</tr>
		<tr >
			<td >DNA low bind vials, 1.5 ml</td>
			<td>Eppendorf</td>
			<td>22431021</td>
			<td ></td>
		</tr>
		<tr >
			<td >Dulbecco&#8217;s Phosphate Buffered Saline</td>
			<td>SIGMA</td>
			<td>D8637</td>
			<td ></td>
		</tr>
		<tr >
			<td >Dynabeads mRNA-DIRECT Kit</td>
			<td>Ambion</td>
			<td>AM61012</td>
			<td ></td>
		</tr>
		<tr >
			<td >GR-Green dye</td>
			<td>Excellgen</td>
			<td>EG-1071</td>
			<td >use 1:10,000 dillution</td>
		</tr>
		<tr >
			<td >HiSeq 2500 or NextSeq 500 next generation sequencers</td>
			<td>Illumina</td>
			<td >inquire with supplier</td>
			<td ></td>
		</tr>
		<tr >
			<td >KAPA HiFi Hotstart DNA polymerase mix</td>
			<td>KAPA/Roche</td>
			<td>KK2602</td>
			<td ></td>
		</tr>
		<tr >
			<td >Nuclease free water</td>
			<td>Ambion</td>
			<td>AM9937</td>
			<td ></td>
		</tr>
		<tr >
			<td >Poly(A) polymerase, yeast</td>
			<td>Thermo Fisher Scientific</td>
			<td>74225Z25KU</td>
			<td ></td>
		</tr>
		<tr >
			<td >Poly(A) polymerase, E.coli</td>
			<td>New England Biolabs</td>
			<td>M0276L</td>
			<td ></td>
		</tr>
		<tr >
			<td >Polynucleotide kinase</td>
			<td>Thermo Fisher Scientific</td>
			<td>EK0032</td>
			<td ></td>
		</tr>
		<tr >
			<td >QIAEX II Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>20021</td>
			<td ></td>
		</tr>
		<tr >
			<td >QIAquick PCR Purification Kit</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td ></td>
		</tr>
		<tr >
			<td >QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNA ligase 1, high concentration</td>
			<td>New England Biolabs</td>
			<td>M0437M</td>
			<td >includes PEG-8000</td>
		</tr>
		<tr >
			<td >RNeasy MinElute RNA Cleanup kit</td>
			<td>Qiagen</td>
			<td>74204</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase H</td>
			<td>New England Biolabs</td>
			<td>M0279</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNasin Plus, ribonuclease inhibitor</td>
			<td>Promega</td>
			<td>N2618</td>
			<td ></td>
		</tr>
		<tr >
			<td >Superscript IV reverse transcriptase</td>
			<td>Thermo Fisher Scientiific</td>
			<td>18090050</td>
			<td ></td>
		</tr>
		<tr >
			<td >Turbo DNase</td>
			<td>Ambion</td>
			<td>AM2238</td>
			<td ></td>
		</tr>
		<tr >
			<td >USER enzyme mix</td>
			<td>New England Biolabs</td>
			<td>M5505</td>
			<td ></td>
		</tr>
		<tr >
			<td >Dyna-Mag-2 magnetic rack</td>
			<td>Thermo Fisher Scientific</td>
			<td>12321D</td>
			<td ></td>
		</tr>
		<tr >
			<td >Thermomixer C</td>
			<td>Eppendorf</td>
			<td>5382000015</td>
			<td >Heated mixer with heated lid</td>
		</tr>
		<tr >
			<td >MicroSpin columns</td>
			<td>GE-Healthcare</td>
			<td>27-5325-01</td>
			<td ></td>
		</tr>
		<tr >
			<td >Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td >Comments</td>
		</tr>
		<tr >
			<td >Buffers</td>
			<td></td>
			<td></td>
			<td ></td>
		</tr>
		<tr >
			<td >Alkaline hydrolysis buffer, 1.5 x</td>
			<td></td>
			<td></td>
			<td >Mix 1 part 0.1 M Na2CO3 and 9 parts 0.1 M NaHCO3. Add EDTA to 1 mM. Adjust pH to 9.2. Store aliquots at -20 &#176;C.</td>
		</tr>
		<tr >
			<td >5x poly(A) polymerase buffer</td>
			<td>Thermo Fisher Scientiific</td>
			<td></td>
			<td >100 mM Tris-HCl, pH 7.0, 3 mM MnCl2, 0.1 mM EDTA, 1 mM DTT, 0.5 mg/ml acetylated BSA, 50% glycerol</td>
		</tr>
		<tr >
			<td >Biotin binding buffer</td>
			<td></td>
			<td></td>
			<td >20 mM Tris&#173;Cl pH 7.5, 2 M NaCl, 0.1% NP&#173;40</td>
		</tr>
		<tr >
			<td >TEN buffer</td>
			<td></td>
			<td></td>
			<td >10 mM Tris&#173;Cl, pH 7.5, 1 mM EDTA, 0.02% NP&#173;40</td>
		</tr>
		<tr >
			<td >Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td >Sequence</td>
		</tr>
		<tr >
			<td >Oligonucleotides according to Illumina TruSeq Small RNA Sample Prep Kits, for GA-IIx and Hiseq2000/2500 sequencers</td>
			<td>Microsynth</td>
			<td></td>
			<td ></td>
		</tr>
		<tr >
			<td >revRA3 (RNA)</td>
			<td>Microsynth</td>
			<td></td>
			<td >5&#8217; amino&#173; CCUUGGCACCCGAGAAUUCCA&#173; 3&#8217;</td>
		</tr>
		<tr >
			<td >revDA5</td>
			<td>Microsynth</td>
			<td></td>
			<td >5&#8217; amino&#173; GTTCAGAGTTCTACAGTCCGAC GATCNNNN-3&#8217;</td>
		</tr>
		<tr >
			<td >Bio-dU-dT25, RT primer</td>
			<td>Microsynth</td>
			<td></td>
			<td >5&#39; Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3&#39; (V = G, A or C)</td>
		</tr>
		<tr >
			<td >PCR primer forward, RP1</td>
			<td>Microsynth</td>
			<td></td>
			<td >5&#39; AATGATACGGCGACCACCGAGA TCTACACGTTCAGAGTTCTACAGTC CGA 3&#39;</td>
		</tr>
		<tr >
			<td >PCR primer reverse, RPI1, barcode in bold</td>
			<td>Microsynth</td>
			<td></td>
			<td >5&#39; CAAGCAGAAGACGGCATACGAGA TCGTGATGTGACTGGAGTTCCTTG GCACCCGAGAATTCCA 3&#39;</td>
		</tr>
		<tr >
			<td >Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td >Comments</td>
		</tr>
		<tr >
			<td >Oligonucleotides according to Illumina TruSeq HT-Small RNA Sample Prep Kits, for HiSeq2000/2500 and NextSeq500 sequencers</td>
			<td></td>
			<td></td>
			<td ></td>
		</tr>
		<tr >
			<td >HT-rev3A (DNA/RNA)</td>
			<td>Microsynth</td>
			<td></td>
			<td >5&#39;-amino-GTGACTGGAGTTCAGACGTGTGCT CTTCCrGrAUrC-3&#39;</td>
		</tr>
		<tr >
			<td >HT-rev5A</td>
			<td>Microsynth</td>
			<td></td>
			<td >5&#39; amino-ACACTCTTTCCCTACACGACGCTCT TCCGATCTNNNN 3&#39;</td>
		</tr>
		<tr >
			<td >Bio-dU-dT25, RT primer</td>
			<td>Microsynth</td>
			<td></td>
			<td >5&#39; Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3&#39;</td>
		</tr>
		<tr >
			<td >PCR primers forward (D501-506)</td>
			<td>Microsynth or Illumina</td>
			<td></td>
			<td >5&#39;-AATGATACGGCGACCACCGAGAT CTACAC[i5]ACACTCTTTCCCTACAC GACGCTCTTCCGATCT -3&#39;</td>
		</tr>
		<tr >
			<td >PCR primers reverse (D701-D712)</td>
			<td>Microsynth or Illumina</td>
			<td></td>
			<td >5&#39;-CAAGCAGAAGACGGCATACGAG A[i7]GTGACTGGAGTTCAGACGTG TGCTCTTCCGATC-3&#39;</td>
		</tr>
		<tr >
			<td >Documentation for Illumina multiplexing:</td>
			<td>Illumina</td>
			<td></td>
			<td >https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences_1000000002694-01.pdf</td>
		</tr>
	</tbody>
</table>

3' end sequencing library preparation with a-seq2

Studien in den letzten zehn Jahren haben eine komplexe und dynamische Vielzahl von Pre-mRNA Spaltung und Polyadenylation Reaktionen gezeigt. mRNAs mit langen 3' unübersetzt Regionen (wo) sind in den differenzierten Zellen generiert, während proliferierende Zellen Protokolle mit kurzen 3' wo bevorzugt zum Ausdruck bringen. Wir beschreiben das A-Seq-Protokoll, jetzt in seiner zweiten Version, entwickelte Polyadenylation Websites genomweite abzubilden und die Regulierung der Pre-mRNA 3' End-Verarbeitung zu studieren. Auch nutzt das aktuelle Protokoll die Polyadenylate (poly(A)) Schwänzen, die während der Biogenese der meisten Säugetiere mRNAs für fully-processed mRNAs bereichern hinzugefügt werden. Ein DNA-Adapter mit Deoxyuracil an der vierten Position ermöglicht die präzise Bearbeitung von mRNA 3' Ende Fragmente für die Sequenzierung. Nicht einschließlich der Zellkultur und die Übernachtung grundsätzlich das Protokoll erfordert ca. 8 h Arbeitsaufwand beträgt. Zusammen mit ihm ist eine einfach zu bedienende Software-Paket für die Analyse der Sequenzierungsdaten abgeleiteten zur Verfügung gestellt. A-seq2 und der damit verbundenen Analyse-Software bieten eine effiziente und zuverlässige Lösung für die Zuordnung der Pre-mRNA 3' endet in einer Vielzahl von Bedingungen von 106 oder weniger Zellen.

Poly (A)-mit RNA wurde von kultivierten Zellen, fragmentiert durch alkalische Hydrolyse isoliert und cDNAs wurden durch reverse Transkription mit oligo(dT) Primer. Die daraus resultierende cDNA wurde auf Streptavidin Perlen immobilisiert, dU war gespalten in Uracil spezifische Exzision Reaktion, Adapter wurden ligiert, 5' und 3' Enden gespalten Fragment und die Einsätze wurden sequenziert. Abbildung 1 zeigt eine grafische Übersicht über das Experiment.
Für HeLa und HEK293 Zellen reichten 106 Zellen poly(A) Standorte für die überwiegende Mehrheit der Protein-kodierenden Gene am Ende des Verfahrens. Allerdings erhöht sich für andere Arten von Zellen oder Gewebe, die es möglicherweise erforderlich, die Sättigung als die Anzahl der Zellen in das Experiment in die Anzahl der identifizierten poly(A) Websites testen. Repräsentative Ergebnisse der pilot PCR Schritt und des DNA-Fragments Analyse der Probe vor der Sequenzierung in Abbildung 2dargestellt.
Abbildung 3 zeigt die Vorverarbeitung Schritte für die computergestützte Analyse ausgehend von der Fastq-Datei aus der Sequencer und endend mit der Qualität überprüft, Adapter-getrimmten liest, die bereit sind, das Genom zugeordnet werden. Abbildung 4 zeigt die Analyseschritte, die beginnen mit der Zuordnung der Lesevorgänge zu den entsprechenden Genom und das Ende mit dem Katalog von mRNA 3' End-Verarbeitung von Websites, die in einer bestimmten Probe identifiziert werden. Wenn mehrere Proben analysiert werden, sind zusätzliche Schritte entspricht dem 3' Ende Verarbeitung von Websites, die in einzelnen Proben gefunden wurden und melden ihre Fülle über Proben durchgeführt. Diese Schritte werden in Abbildung 5dargestellt.
So, nachdem Proben sequenziert haben, ist die Analyse der resultierenden Sequenzierung Dateien (im Fastq-Format) durch die verfügbaren Verarbeitungspipeline zu lesen einfach. Nach dem Hinzufügen der Informationen über die Proben in die Konfigurationsdatei, die Ausführung der Pipeline wird in zwei Haupttypen von Ausgabedateien führen: 1) Bett-Dateien mit allen 3' Ende Verarbeitung Standorte in einzelnen Proben (z. B. " sample1.3pSites.noIP.Bed.gz"), und 2) eine Bett-Datei mit allen poly(A) Website Clustern (clusters.merged.bed) über alle Proben der Studie. Die Ausgabe enthält auch die Genom-Koordinaten für alle Lesevorgänge aus jeder einzelnen Probe (z.B. "Beispiel1. STAR_out/aligned.sortedByCoord.out.BAM"), die später in einem Genom-Browser wie IGV16eingesehen werden können. Sichtprüfung der lesen Sie Firmenprofile bietet im Allgemeinen einen ersten Blick auf die Verteilung der Poly-Standorte in das Genom und die Veränderungen, die auf die spezifischen Störungen auftreten, die in der Studie durchgeführt wurden. Zum Beispiel ist in Abbildung 6 die Reaktion eines bestimmten Gens auf der Knock-down des HNRNPC Proteins dargestellt.
Zusammenfassungen dieser genomweiten Distributionen sind ebenfalls vorhanden (Tabelle 1). Im einzelnen enthalten Output-Dateien im Verzeichnis "zählt/Annotation_overlap" Bruchteile von Websites, die mit kommentierten Besonderheiten überlappen (aus der Gtf-Datei als Eingabe bereitgestellt; beschriftet sind: 3' UTR, terminal Exon Exon, Intron, intergenetischer). Zu guter Letzt werden Ergebnisse der einzelnen Bearbeitungsschritte für jede Probe auch (z. B. "sample1.summary.tsv") gespeichert. Hierunter fallen die Zahlen: roh liest in jeder Probe, liest, die die erwartete Struktur der 5'-Ende, mal gelesen, die nach einem Zusammenbruch vollständige PCR Duplikate bleiben, qualitativ hochwertige liest nach den Kriterien definiert bei Schritt 9.2, liest die Karte eindeutig auf das Genom (nach einem Zusammenbruch diejenigen, die durch Sequenzierung Fehler geführt, siehe Schritt 9,5), Multi-Mapping liest (nach einem Zusammenbruch diejenigen, die durch Sequenzierung Fehler geführt, siehe Schritt 9,5), roh (nicht geclusterten) 3' End-Verarbeitung Websites in jeder Probe, roh 3' End-Verarbeitung Websites ohne interne Priming Kandidaten enden einzigartige 3' Verarbeitung Websites aus allen Proben ohne interne Priming Kandidaten und abschließende Reihe von Poly-Website-Cluster.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56129/56129fig1v2.jpg"> 
Abbildung 1: Main Schritte des Protokolls A-seq2. Einzelnen Schritte sind auf der linken Seite der Abbildung angegeben. Insert-RNA-Fragmente sind als grüne Linien dargestellt, die nach der reversen Transkription für cDNA rot; Adapter sind in hellem Blau oder Orange gefärbt. <a href="//ecsource.jove.com/files/ftp_upload/56129/56129fig1v2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56129/56129fig2.jpg"> 
Abbildung 2: Pilot PCR und endgültige Produktprofil. (ein) Aliquote aus der PCR-Reaktion wurden bei verschiedenen Zyklen gesammelt und getrennt auf 2 % Agarose-Gele. Zahlen auf der linken Seite geben Größe in Nukleotide der jeweiligen Bands in der DNA-Leiter. In diesem Experiment wurden 12 Zyklen (*) für die groß angelegte PCR Reaktion ausgewählt. (b) Beispiel einer Stichprobe nach Größe Auswahl führen Sie auf einem Fragment Größe Analysator enthüllt eine durchschnittliche Größe von rund 280 Nukleotiden. Zahlen auf der linken Seite [FU] relative Signalintensität. <a href="//ecsource.jove.com/files/ftp_upload/56129/56129fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56129/56129fig3.jpg"> 
Abbildung 3: Übersicht über die Vorverarbeitung der Sequenzierung liest. Die Fastq-Dateien mit liest, die von der Sequenzierung Instrument-assoziierten Software generiert werden werden verarbeitet, um qualitativ hochwertige liest zu identifizieren, die das entsprechende Genom zugeordnet werden kann. Die Abbildung zeigt die input-/Output-Spezifikation der einzelnen Schritte in der Pipeline, mit Links zu den einzelnen Schritten des Protokolls beschrieben im Abschnitt "Datenverarbeitung". <a href="//ecsource.jove.com/files/ftp_upload/56129/56129fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56129/56129fig4.jpg"> 
Abbildung 4: Gliederung der Reihenfolge lesen Verarbeitung, aus dem Schritt des Mappings in das Genom der Generation der einzelnen 3' Ende Verarbeitung Websites. Die Abbildung zeigt die input-/Output-Spezifikation der einzelnen Schritte in der Pipeline, mit Links zu den igerne Schritte des Protokolls, die im Abschnitt "Datenverarbeitung" beschrieben. Die wichtigsten Ausgabedatei, die an den Benutzer übermittelt wird, ist fett markiert. <a href="//ecsource.jove.com/files/ftp_upload/56129/56129fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56129/56129fig5.jpg"> 
Abbildung 5: Übersicht über die Schritte, die ergriffen werden, um Gruppen von Co geregelten 3' Ende Sequenzierung Websites generieren. Die Abbildung zeigt die input-/Output-Spezifikation der einzelnen Schritte in der Pipeline, mit Links zu den einzelnen Schritten des Protokolls beschrieben im Abschnitt "Datenverarbeitung". Die wichtigsten Ausgabedatei ist fett markiert. <a href="//ecsource.jove.com/files/ftp_upload/56129/56129fig5large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56129/56129fig6.jpg"> 
Abbildung 6: Beispiel-Ergebnisse des Profils der 3' Ende Verarbeitung liest entlang der terminal Exon des Gens NUP214, gezeigt in der IGV 16 Genom Browser. A-seq2 liest wurden aus zwei Proben von HEK-293-Zellen, behandelt mit einer Kontrolle-SiRNA oder mit einem HNRNPC SiRNA vorbereitet. Die Lesevorgänge, die Poly-Websites dokumentiert, die von der Pipeline Analyse kommentiert wurden waren im BAM-Format gespeichert, die als Eingabe für den IGV-Genom-Browser verwendet wurde. Die 3' Enden der lesen Sie Gipfel zuordnen mRNA 3' enden, die in Ensembl versehen sind. Die Profile zeigen eine verstärkte Nutzung der langen 3' UTR Isoform auf HNRNPC zerlegbar. <a href="//ecsource.jove.com/files/ftp_upload/56129/56129fig6large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Si-Control replizieren 1</td>
			<td>Si-Control replizieren 2</td>
		</tr>
		<tr>
			<td></td>
			<td>ID: 29765</td>
			<td>ID: 32682</td>
		</tr>
		<tr>
			<td>Anzahl der Roh-Lesevorgänge</td>
			<td>44210258</td>
			<td>68570640</td>
		</tr>
		<tr>
			<td>Anzahl der gültigen liest nach dem Trimmen und Filterung</td>
			<td>14024538</td>
			<td>21211793</td>
		</tr>
		<tr>
			<td>Anzahl der eindeutigen Zuordnung mal gelesen</td>
			<td>6953674</td>
			<td>13946436</td>
		</tr>
		<tr>
			<td>Anzahl der Lesevorgänge, die Zuordnung zu mehreren loci</td>
			<td>2040646</td>
			<td>2925839</td>
		</tr>
		<tr>
			<td>Anzahl der einzelnen 3' End-Verarbeitung Websites</td>
			<td>1107493</td>
			<td>1710353</td>
		</tr>
	</tbody>
</table>
Tabelle 1: Beispielausgabe der Pipeline Analyse. Zusammenfassungen der Lesevorgänge, die einzelnen Schritte erzielt wurden.

Watch this Scientific Journal Video about 3' End Sequencing Library Preparation with A-seq2 at JoVE.com

3' End Sequencing Library Preparation with A-seq2

Dieses Protokoll beschreibt eine Methode für die Zuordnung Pre-mRNA 3' End-Verarbeitung Websites.

3' Ende Sequenzierung Bibliothek Vorbereitung mit A-seq2

Studies in the last decade have revealed a complex and dynamic variety of pre-mRNA cleavage and polyadenylation reactions. mRNAs with long 3&#39; ...

3-end-sequencing-library-preparation-with-a-seq2

Research

JoVE Journal

Biology

10.4K Aufrufe.  University of Basel. Dieses Protokoll beschreibt eine Methode für die Zuordnung Pre-mRNA 3' End-Verarbeitung Websites.

Serie: 3' End Sequencing Library Preparation with A-seq2

Cell Block Preparation from Cytology Specimen with Predominance of Individually Scattered Cells

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually scattered cells and small cell groups. This technique uses HistoGel (Thermo Scientific) with conventional laboratory equipment.
The use of cell block sections is a valuable ancillary tool for evaluation of non-gynecologic cytology. They enable the cytopathologist to study additional morphologic specimen detail including the architecture of the lesion. Most importantly, they allow for the evaluation of ancillary studies such as immunocytochemistry, in-situ hybridization tests (FISH/CISH) and in-situ polymerase chain reaction (PCR). Traditional cell block preparation techniques have mostly been applied to non-gynecologic cytology specimens, typically for body fluid effusions and fine needle aspiration biopsies.
Liquid based cervicovaginal specimens are relatively less cellular than their non-gynecologic counterparts with many individual scattered cells. Because of this, adequate cellularity within the cell block sections is difficult to achieve. In addition, the histotechnologist sectioning the block cannot visualize the level at which the cells are at the highest concentration. Therefore, it is difficult to monitor the appropriate level at which sections can be selected to be transferred to the glass slides for testing. As a result, the area of the cell block with the cells of interest may be missed, either by cutting past or not cutting deep enough. Current protocol for Shidham's method addresses these issues. Although this protocol is standardized and reported for gynecologic liquid based cytology specimens, it can also be applied to non-gynecologic specimens such as effusion fluids, FNA, brushings, cyst contents etc for improved quality of diagnostic material in cell block sections.

Shidham's method for preparation of cell blocks with AV-marker from cytology specimens containing individually scattered cells and small cell groups.

Cell Block Vorbereitung von Zytologie Probe mit Vorherrschaft von Individuell verstreuten Zellen

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually ...

Forschung

Biologie

Large Insert Environmental Genomic Library Production

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent environmental genomic (i.e. metagenomic) approaches have emerged, enabling researchers to bridge this cultivation gap by capturing the genetic content of indigenous microbial communities directly from the environment. To this end, genomic DNA libraries are constructed using standard albeit artful laboratory cloning techniques. Here we describe the construction of a large insert environmental genomic fosmid library with DNA derived from the vertical depth continuum of a seasonally hypoxic fjord. This protocol is directly linked to a series of connected protocols including coastal marine water sampling [1], large volume filtration of microbial biomass [2] and a DNA extraction and purification protocol [3]. At the outset, high quality genomic DNA is end-repaired with the creation of 5 -phosphorylated blunt ends. End-repaired DNA is subjected to pulsed-field gel electrophoresis (PFGE) for size selection and gel extraction is performed to recover DNA fragments between 30 and 60 thousand base pairs (Kb) in length. Size selected DNA is purified away from the PFGE gel matrix and ligated to the phosphatase-treated blunt-end fosmid CopyControl vector pCC1 (EPICENTRE <a href="http://www.epibio.com/item.asp?ID=385">http://www.epibio.com/item.asp?ID=385</a>). Linear concatemers of pCC1 and insert DNA are subsequently headfull packaged into phage particles by lambda terminase, with subsequent infection of phage-resistant E. coli cells. Successfully transduced clones are recovered on LB agar plates under antibiotic selection and archived in 384-well plate format using an automated colony picking robot (Qpix2, GENETIX). The current protocol draws from various sources including the CopyControl Fosmid Library Production Kit from EPICENTRE and the published works of multiple research groups [4-7]. Each step is presented with best practice in mind. Whenever possible we highlight subtleties in execution to improve overall quality and efficiency of library production. The whole process of fosmid library production and automated colony picking takes at least 7-10 days as there are many incubation steps included. However, there are several stopping points possible which are mentioned within the protocol.

Construction of a fosmid library with environmental genomic DNA isolated from the vertical depth continuum of a seasonally hypoxic fjord is described. The resulting clone library is picked into 384-well plates and archived for downstream sequencing and functional screening by the application of an automated colony picking system.

Large Insert Environmental Genomic Bibliothek Produktion

The vast majority of microbes in nature currently remain inaccessible to traditional cultivation methods. Over the past decade, culture-independent ...

Primer-Free Aptamer Selection Using A Random DNA Library

Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified through an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX) to recognize a wide variety of targets, from small molecules to proteins and other macromolecules 2-4. Aptamers have properties that are well suited for in vivo diagnostic and/or therapeutic applications: Besides good specificity and affinity, they are easily synthesized, survive more rigorous processing conditions, they are poorly immunogenic, and their relatively small size can result in facile penetration of tissues.
Aptamers that are identified through the standard SELEX process usually comprise ~80 nucleotides (nt), since they are typically selected from nucleic acid libraries with ~40 nt long randomized regions plus fixed primer sites of ~20 nt on each side. The fixed primer sequences thus can comprise nearly ~50% of the library sequences, and therefore may positively or negatively compromise identification of aptamers in the selection process 3, although bioinformatics approaches suggest that the fixed sequences do not contribute significantly to aptamer structure after selection 5. To address these potential problems, primer sequences have been blocked by complementary oligonucleotides or switched to different sequences midway during the rounds of SELEX 6, or they have been trimmed to 6-9 nt 7, 8. Wen and Gray 9 designed a primer-free genomic SELEX method, in which the primer sequences were completely removed from the library before selection and were then regenerated to allow amplification of the selected genomic fragments. However, to employ the technique, a unique genomic library has to be constructed, which possesses limited diversity, and regeneration after rounds of selection relies on a linear reamplification step. Alternatively, efforts to circumvent problems caused by fixed primer sequences using high efficiency partitioning are met with problems regarding PCR amplification 10.
We have developed a primer-free (PF) selection method that significantly simplifies SELEX procedures and effectively eliminates primer-interference problems 11, 12. The protocols work in a straightforward manner. The central random region of the library is purified without extraneous flanking sequences and is bound to a suitable target (for example to a purified protein or complex mixtures such as cell lines). Then the bound sequences are obtained, reunited with flanking sequences, and re-amplified to generate selected sub-libraries. As an example, here we selected aptamers to S100B, a protein marker for melanoma. Binding assays showed Kd s in the 10-7 - 10-8 M range after a few rounds of selection, and we demonstrate that the aptamers function effectively in a sandwich binding format.

SELEX protocols comprise multiple rounds of selection, each of which require regeneration of bound ligands, which in turn require fixed primer sequences flanking the random library regions. These fixed primer sequences can interfere with the selection process (false positives and negatives). Here we present a primer-free protocol.

Primer-Free Aptamer Selection mit einem zufälligen DNA-Bibliothek

Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified ...

MISSION LentiPlex Pooled shRNA Library Screening in Mammalian Cells

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies.
There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids 1. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library.
The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes 2. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 108 TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification.
Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line 3, 4. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we also detail a cost-effective polyclonal approach utilizing traditional sequencing.

Here we use a human LentiPlex pooled library and traditional sequencing methods to identify gene targets promoting cell survival. We demonstrate how to set up and deconvolute a LentiPlex screen and validate the results.

MISSION LentiPlex Pooled shRNA Bibliothek Screening in Säugerzellen

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. 
Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. 
We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video.

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) is a method for de novo detection of chromatin interactions, for better understanding of transcriptional control.

Chromatin Interaction Analysis gepaart mit End-Tag-Sequenzierung (Chia-PET) zur Abbildung von Chromatin-Wechselwirkungen zu verstehen und Transkriptionsregulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes precursor mRNA beyond the end of mature RNAs, and an active process of endonuclease activity is required at a specific site. Cleavage of the precursor RNA normally occurs 10-30 nt downstream from the consensus polyA site (AAUAAA) after the CA dinucleotides. Proteins from the cleavage complex, a multifactorial protein complex of approximately 800 kDa, accomplish this specific nuclease activity. Specific RNA sequences upstream and downstream of the polyA site control the recruitment of the cleavage complex. Immediately after cleavage, pre-mRNAs are polyadenylated by the polyA polymerase (PAP) to produce mature stable RNA messages.
Processing of the 3&#8217; end of an RNA transcript may be studied using cellular nuclear extracts with specific radiolabeled RNA substrates. In sum, a long 32P-labeled uncleaved precursor RNA is incubated with nuclear extracts in vitro, and cleavage is assessed by gel electrophoresis and autoradiography. When proper cleavage occurs, a shorter 5&#8217; cleaved product is detected and quantified. Here, we describe the cleavage assay in detail using, as an example, the 3&#8217; end processing of HIV-1 mRNAs.

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

RNA polymerase II synthesizes a precursor RNA that extends beyond the 3' end of the mature mRNA. The end of the mature RNA is generated cotranscriptionally, at a site dictated by RNA sequences, via the endonuclease activity of the cleavage complex. Here, we detail the method to study cleavage reactions in vitro.

Die Analyse der RNA-Prozessierung Reaktionen mit Handy Free Systems: 3 &#39;Ende Spaltung von prä-mRNA-Substrate<em&gt; In-vitro-</em

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes ...

Directed Evolution Method in Saccharomyces cerevisiae: Mutant Library Creation and Screening

Directed evolution in Saccharomyces cerevisiae offers many attractive advantages when designing enzymes for biotechnological applications, a process that involves the construction, cloning and expression of mutant libraries, coupled to high frequency homologous DNA recombination in vivo. Here, we present a protocol to create and screen mutant libraries in yeast based on the example of a fungal aryl-alcohol oxidase (AAO) to enhance its total activity. Two protein segments were subjected to focused-directed evolution by random mutagenesis and in vivo DNA recombination. Overhangs of ~50 bp flanking each segment allowed the correct reassembly of the AAO-fusion gene in a linearized vector giving rise to a full autonomously replicating plasmid. Mutant libraries enriched with functional AAO variants were screened in S. cerevisiae supernatants with a sensitive high-throughput assay based on the Fenton reaction. The general process of library construction in S. cerevisiae described here can be readily applied to evolve many other eukaryotic genes, avoiding extra PCR reactions, in vitro DNA recombination and ligation steps.

Directed Evolution Method in Saccharomyces cerevisiae: Mutant Library Creation and Screening

We present a detailed protocol to construct and screen mutant libraries for directed evolution campaigns in Saccharomyces cerevisiae.

Entwicklung Methode Regie in<em&gt; Saccharomyces cerevisiae</em&gt;: Mutant Bibliothek Schöpfung und Screening

Directed evolution in Saccharomyces cerevisiae offers many attractive advantages when designing enzymes for biotechnological applications, a process that ...

Interactome-Seq: A Protocol for Domainome Library Construction, Validation and Selection by Phage Display and Next Generation Sequencing

Folding reporters are proteins with easily identifiable phenotypes, such as antibiotic resistance, whose folding and function is compromised when fused to poorly folding proteins or random open reading frames. We have developed a strategy where, by using TEM-1 &#946;-lactamase (the enzyme conferring ampicillin resistance) on a genomic scale, we can select collections of correctly folded protein domains from the coding portion of the DNA of any intronless genome. The protein fragments obtained by this approach, the so called &#34;domainome&#34;, will be well expressed and soluble, making them suitable for structural/functional studies.
By cloning and displaying the &#34;domainome&#34; directly in a phage display system, we have showed that it is possible to select specific protein domains with the desired binding properties (e.g., to other proteins or to antibodies), thus providing essential experimental information for gene annotation or antigen identification.
The identification of the most enriched clones in a selected polyclonal population can be achieved by using novel next-generation sequencing technologies (NGS). For these reasons, we introduce deep sequencing analysis of the library itself and the selection outputs to provide complete information on diversity, abundance and precise mapping of each of the selected fragment. The protocols presented here show the key steps for library construction, characterization, and validation.

The protocols described allow the construction, characterization and selection (against the target of choice) of a &#34;domainome&#34; library made from any DNA source. This is achieved by a research pipeline that combines different technologies: phage display, a folding reporter and next generation sequencing with a web tool for data analysis.

Interaktom-Seq: Ein Protokoll zur Domainome Bibliotheksbau, Validierung und Auswahl von Phagen-Display und Next Generation Sequencing

Folding reporters are proteins with easily identifiable phenotypes, such as antibiotic resistance, whose folding and function is compromised when fused to ...

Assessment of Global DNA Double-Strand End Resection using BrdU-DNA Labeling coupled with Cell Cycle Discrimination Imaging

The study of the DNA damage response (DDR) is a complex and essential field, which has only become more important due to the use of DDR-targeting drugs for cancer treatment. These targets are poly(ADP-ribose) polymerases (PARPs), which initiate various forms of DNA repair. Inhibiting these enzymes using PARP inhibitors (PARPi) achieves synthetic lethality by conferring a therapeutic vulnerability in homologous recombination (HR)-deficient cells due to mutations in breast cancer type 1 (BRCA1), BRCA2, or partner and localizer of BRCA2 (PALB2). 
Cells treated with PARPi accumulate DNA double-strand breaks (DSBs). These breaks are processed by the DNA end resection machinery, leading to the formation of single-stranded (ss) DNA and subsequent DNA repair. In a BRCA1-deficient context, reinvigorating DNA resection through mutations in DNA resection inhibitors, such as 53BP1 and DYNLL1, causes PARPi resistance. Therefore, being able to monitor DNA resection in cellulo is critical for a clearer understanding of the DNA repair pathways and the development of new strategies to overcome PARPi resistance. Immunofluorescence (IF)-based techniques allow for monitoring of global DNA resection after DNA damage. This strategy requires long-pulse genomic DNA labeling with 5-bromo-2&#8242;-deoxyuridine (BrdU). Following DNA damage and DNA end resection, the resulting single-stranded DNA is specifically detected by an anti-BrdU antibody under native conditions. Moreover, DNA resection can also be studied using cell cycle markers to differentiate between various phases of the cell cycle. Cells in the S/G2 phase allow the study of end resection within HR, whereas G1 cells can be used to study non-homologous end joining (NHEJ). A detailed protocol for this IF method coupled to cell cycle discrimination is described in this paper.

In the present protocol, we demonstrate how to visualize DNA double-strand end resection during S/G2 phase of the cell cycle using an immunofluorescence-based method.

Bewertung der globalen DNA-Doppelstrang-Endsektion mittels BrdU-DNA-Markierung in Verbindung mit Cell Cycle Discrimination Imaging

The study of the DNA damage response (DDR) is a complex and essential field, which has only become more important due to the use of DDR-targeting drugs ...

Application of Passive Head Motion to Generate Defined Accelerations at the Heads of Rodents

Exercise is widely recognized as effective for various diseases and physical disorders, including those related to brain dysfunction. However, molecular mechanisms behind the beneficial effects of exercise are poorly understood. Many physical workouts, particularly those classified as aerobic exercises such as jogging and walking, produce impulsive forces at the time of foot contact with the ground. Therefore, it was speculated that mechanical impact might be implicated in how exercise contributes to organismal homeostasis. For testing this hypothesis on the brain, a custom-designed ''passive head motion'' (hereafter referred to as PHM) system was developed that can generate vertical accelerations with controlled and defined magnitudes and modes and reproduce mechanical stimulation that might be applied to the heads of rodents during treadmill running at moderate velocities, a typical intervention to test the effects of exercise in animals. By using this system, it was demonstrated that PHM recapitulates the serotonin (5-hydroxytryptamine, hereafter referred to as 5-HT) receptor subtype 2A (5-HT2A) signaling in the prefrontal cortex (PFC) neurons of mice. This work provides detailed protocols for applying PHM and measuring its resultant mechanical accelerations at rodents' heads.

The present protocol describes a custom-designed ''passive head motion'' system, which reproduces mechanical accelerations at rodents' heads generated during their treadmill running at moderate velocities. It allows dissecting mechanical factors/elements from the beneficial effects of physical exercise.

Anwendung der passiven Kopfbewegung zur Erzeugung definierter Beschleunigungen an den Köpfen von Nagetieren

Exercise is widely recognized as effective for various diseases and physical disorders, including those related to brain dysfunction. However, molecular ...