Jennifer Deke und Urszula Zarzenska danken wir für ihre wissenschaftliche Unterstützung. Diese Arbeit wurde von einem Career Integration Grant (CIG, PCIG14-GA-2013-63 0734) von der Europäischen Kommission im Rahmen des 7. Rahmenprogramms, Grant LFF-GK06 'DELIGRAH' (Landesforschungsförderung Hamburg) und das DFG-Stipendium (DFG-KE 856_6-1) finanziell unterstützt. verliehen an JK.

1. Probenahme und Vorbereitung der Phloem-Saft von B. Napus Pflanzen 4,8,20
<ol><li>Phloem SAP Probenahme, verwenden gut bewässerten 8 Wochen alten B. Napus Pflanzen dieser Show nur erste Blüte um Pollen Kontaminationen zu verhindern.</li>
	<li>Verwenden eine Injektionsnadel (Ø 0,8 mm) und punctata der Blütenstand ergeben sich mehrere Male. Wiederholen Sie bei mehreren anderen Blütenstand Stengel und an anderen Pflanzen genug Phloem Sap (Abbildung 2a) zu erhalten. Hinweis: Für die komplexe Analyse empfiehlt es mit mindestens 600 µL Phloem Sap zu starten. 4 bis 5 Pflanzen werden zwischen 200 und 700 µL Phloem Sap ergeben.</li>
	<li>Wischen Sie den ersten Tropfen von den verletzten Seiten mit Filterpapier. Diese Tropfen vor allem stark belasteten Material aus den umliegenden verletzte Gewebe enthalten und müssen verworfen werden.</li>
	<li>Sammeln Sie die folgenden Tropfen durch pipettieren und speichern Sie die gesammelten Exsudat in einem vorgekühlt konische 1,5 mL Reaktionsgefäß bei-20 ° C mit einem eisfreien Kühlsystem.</li>
	<li>Weiter sammeln, bis keine weitere Tropfenbildung zu beobachten, aber nicht länger als 1 h ist. Dieses Verfahren kann nach zwei Tagen ohne erheblichen Verlust der gesammelten Phloem Sap wiederholt werden. Hinweis: Der gesammelten Phloem-Saft sofort genutzt oder gespeichert werden kann bei-80 ° C zur späteren Analyse. Für die-80 ° C Lagerung Schock-Freeze das Reaktionsgefäß in flüssigem Stickstoff.</li>
	<li>Die Phloem Probe zu ca. 1/6th das Ausgangsvolumen mit zentrifugalen Konzentratoren mit einem Molekulargewicht abgeschnitten (MWCO) von 10.000 Dalton (Da) zu konzentrieren. Zentrifugieren Sie die konzentrierte Probe bei 4 ° C und 20.000 x g für mindestens 15 min. um Staubpartikel zu entfernen. Hinweis: Phloem SAP-Konzentration führt nicht zu einem erheblichen Verlust von Proteinen.</li>
	<li>Fahren Sie für nachfolgende Funktionentheorie mit Schritt 3.1.</li>
</ol>(2) Phloem SAP-Reinheitskontrolle mit Reverse Transkriptase PCR (RT-PCR) 4,8,20
<ol><li>Gesamt-RNS aus Phloem-Saft mit einer standard RNA Extraktionsmethode für flüssiges Material zu isolieren (z.B. TRIzol oder Phenol-Chloroform-Extraktion gefolgt von Isopropanol Niederschlag aus der wässrigen Phase und Ethanol Waschschritten gemäß der des Herstellers Protokoll). Achtung: Phenol-Chloroform ist giftig. Arbeiten Sie unter einer Haube mit geeigneter persönlicher Schutzausrüstung. Bis zu sechs Monaten kann die extrahierte RNA in Ethanol bei-80 ° C aufbewahrt werden.</li>
	<li>Entfernen Sie Verunreinigungen der DNA durch Verdauung mit DNase I (1 u/µg) für 45 min bei 37 ° C und inaktivieren das Enzym durch Zugabe von EDTA, eine Endkonzentration von 5 mM und die Probe bei 75 ° C für 10 min inkubieren.</li>
	<li>Um reine RNA, zu reinigen und die Probe zu konzentrieren, indem eine weitere Reinigungsstufe (z. B. mit RNA-Cleanup-Kits, gemäß den Anweisungen des Herstellers).</li>
	<li>Führen Sie eine Reverse Transkriptase PCR (RT-PCR) für die Synthese der cDNA mit einer cDNA Synthese Kit mit 150 ng reine RNA wie vom Hersteller beschrieben ist das Protokoll. Hinweis: Die cDNA kann bei-20 ° C bis zur weiteren Verwendung gespeichert werden.</li>
	<li>Verwenden Sie 5 µL cDNA als Vorlage für eine standard-PCR-Reaktion wie vom Hersteller angegeben, Fach-spezifische Protokolle zu verstärken und durch Agarose-Gelelektrophorese überprüfen. Bestätigen Sie die Reinheit der Phloem Proben z.B. mit Primer für Rubisco kleine Untereinheit, Thioredoxin-h und die Pollen-Hüllprotein (Abbildung 1 b, Tabelle 1).</li>
</ol>3. blaue native Seite 4,25,26,31
<ol><li>Verwenden Sie entweder selbst gegossenen native gradient Gele wie beschrieben an anderer Stelle27 oder kommerziellen Bis-Tris gradient Gele.</li>
	<li>Laden Sie mindestens 20 bis 30 µg der konzentrierten Proteins Probe pro Bohrloch auf das Gel in triplicates.</li>
	<li>Führen Sie das Gel bei 4 ° C und 150 V mit dunkel blauen Kathode Puffer B und Anode Puffer (Tabelle 2), bis die Probe 1/3rd des Gels (ca. 20 bis 30 min, Bild 3a) übergeben. Hinweis: Für Nordbeflecken, reicht eine einzige Gel-Gasse, während für die Analyse der Proteinzusammensetzung von 3D PAGE und Massenspektrometrie ist es empfehlenswert, die gleiche Band aus bis zu zehn Gel Bahnen sich weniger reichlich Proteine kombinieren.</li>
	<li>Unterbrechen den Lauf und Austausch dunkel blaue Kathode Puffer B mit leichten blauen Kathode Puffer B/10 (Tabelle 2) und der Flucht. Beenden Sie das Gel ausgeführt werden, wenn die blaue Front beginnt zu eluieren aus Gel (ca. 120 bis 180 min, Bild 3a). Hinweis: Das fertige blau native Gel kann bei 4 ° C für mindestens eine Woche gespeichert werden. Längerer Lagerung kann um zu diffundieren Bänder führen und sollte vermieden werden. Dunkel blau Puffer B kann wiederverwendet werden.</li>
</ol>4. OPTIONAL: Nachweis von RNA mit blauen native northern Blot 4
<ol><li>Unterschiedliche Banden geschnitten Sie aus oder verwenden Sie die ganze Gel-Spur aus dem blauen native Gel und übertragen Sie sie auf eine Nylon-Membran von semi Dry blotting bei 3,5 mA/cm2 für 60 min und markieren Sie die obere und untere Gel-Grenze mit einem Bleistift auf der Membran (Abbildung 4a).</li>
	<li>Beflecken, waschen Sie die Membran mit DEPC-behandeltem Wasser und trocknen Sie zwischen zwei Filterpapiere.</li>
	<li>Führen Sie UV-Vernetzung der gepunkteten Membran mit 120.000 µJ/cm2 (85 s wenn der Vernetzer in Tabelle Materialienverwenden).</li>
	<li>Pre-hybridisieren Sie die Membran mit 6 mL Hybridisierung Puffer (kommerzielle oder selbst gemacht) für 60 min bei 68 ° C im Backofen Hybridisierung (Abb. 4a).</li>
	<li>Fügen Sie eine zusätzliche 1 mL der Hybridisierung Puffer mit 4 µL 3' biotinylierte Sonden (100 nM).</li>
	<li>Inkubieren Sie Membran mit der Sonde über Nacht, beim Abkühlen des Backofen von 68 ° C auf 37 ° c</li>
	<li>Waschen Sie die Membran mit Puffer mit 2 X SSC und 0,1 % SDS für 5 min bei Raumtemperatur, Sonden gebunden unspezifisch zu entfernen. Achtung: SDS kann Reizungen verursachen. Tragen Sie Handschuhe und Kittel bei der Arbeit mit SDS und SDS mit Lösungen.</li>
	<li>Führen Sie die Erkennung der 3'-biotinylierte Sonden auf der Membran z.B. mit Streptavidin-HRP-Konjugat und Luminol als Meerrettich Peroxidase (HRP) Substrat, wodurch eine sensible Chemilumineszenz-Reaktion (Abb. 4a).</li>
</ol>5. zweite dimension: Tris-Tricine-Harnstoff Seite 4,28
<ol><li>Verbrauchssteuern Sie einzelne Bands aus dem blauen native Gel. Kombinieren Sie Bands aus Proben laufen in parallelen Bahnen, eine weitere Konzentration von komplexen Proteinen (Abbildung 5) zu erreichen. Hinweis: Ausgeschnittenen Bänder können in einzelnen Reaktionsgefäßen bis zur weiteren Verwendung bei 4 ° c gespeichert werden</li>
	<li>Gießen Sie eine 12 %-Tris-Tricine-Harnstoff-Gel (Dicke von 1 mm, 6,8 x 8,6 cm (Breite x Länge)). Das trennende Gel (Tabelle 2), 10 mL Gel Lösung A vorbereiten Gießen zwischen zwei Glasplatten und Overlay mit Isopropanol. Entfernen Sie das Isopropanol, nachdem die Polymerisation beendet ist und übertragen Sie 4 mL Gel Lösung B (Tabelle 2) für das Stapeln Gel auf das Gel und legen Sie eine 10 gut kämmen zu. Achtung: Unpolymerisierten Acrylamid kann neurotoxische und TEMED ist gesundheitsschädlich beim Einatmen. Immer persönliche Schutzausrüstung tragen und arbeiten unter einer Haube.</li>
	<li>Übertragen Sie die ausgeschnittenen Gel-Bands in einem 1,5 mL Reaktionsgefäß und 1 mL 2 x SDS-Probenpuffer für Gleichgewichtherstellung der Gel-Stücke (Abbildung 5, Tabelle 2).<ol>
<li>Brüten Sie die Proben 10 min bei Raumtemperatur, vor dem Kochen in einem Heizblock (95 ° C) oder in der Mikrowelle und inkubieren Sie die Proben wieder auf weitere 15 min bei Raumtemperatur.</li>
		<li>Stapeln Sie mehrere äquilibriert Gel Stücke vertreten die gleichen Komplex in einem einzigen Gel Tasche.</li>
		<li>Führen Sie die Elektrophorese mit Anode und Kathode mit 150 V für 45 bis 60 min Puffer und Verbrauchsteuern Sie die ganze Gel-Spur.</li>
	</ol>
</li>
	<li>Brüten die geschnittenen Fahrspur für 20 min in sauren Puffer (100 mM Tris, 100 mM Essigsäure) und equilibrate in 125 mM Tris-HCl, pH 6,8 für weitere 20 min (Abbildung 5).</li>
</ol>(6) dritte Dimension: SDS-PAGE 4,32
<ol><li>Gießen Sie einen 15 % SDS Trennung Gel nach Laemmli32 (Dicke: 1,5 mm, 6,8 x 8,6 cm (Breite x Länge)) (Tabelle 2) und fügen Sie eine dünne Schicht von 4 % Gel oben stapeln. Achtung: SDS, Acrylamid und TEMED sind giftig und schädlich. Arbeiten unter einer Haube und persönliche Schutzausrüstung tragen.</li>
	<li>Übertragen der äquilibriert Gel-Spur auf das SDS-Gel und decken das Gel mit 0,5 % (w/w) Agarose in 1 X SDS laufen Puffer ergänzt mit einer Spur von Bromophenol blue (Abbildung 5).</li>
	<li>Kochen Sie die SDS mit Puffer Agarose in der Mikrowelle vor Verladung auf das Gel.</li>
	<li>Legen Sie für den Betrieb eines Protein-Markers zur Abschätzung der Molekulargewichte der Einzelkomponenten ein Stück Filterpapier an einem Ende des Gels, bis die Agarose erstarrt oder verwenden Sie einen speziellen Kamm in der Regel für IPG Gele verwendet.</li>
	<li>Führen Sie das Gel 150 V für 60 min und Fleck Färbung das Gel mit kolloidalem Coomassie, silbernen Fleck oder eine andere Methode geeignet für anschließende massenspektrometrische Analyse.</li>
	<li>Analysieren Sie die sichtbaren Proteinspots mit massenspektrometrischer Methoden wie Matrix-unterstützte Laser Desorption/Ionisation Time-of-Flight (MALDI-TOF) oder LC-MS/MS Massenspektrometrie. Hinweis: Wir empfehlen, um die kolloidalen Coomassie-Färbung wie bereits beschrieben33zu verwenden. In unseren Händen sogar weniger reichlich Proteine kann ausreichend gebeizt und ermöglicht eine massenspektrometrische Analyse mit angemessenen Datenqualität.</li>
</ol>

<ol><li>Kempers, R., van Bel, A. J. E. <a target="_blank" href="https://link.springer.com/article/10.1007/BF01007704">Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa.</a> Planta. 201 (2), 195-201 (1997).</li>
<li>Stadler, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Expression+of+GFP-fusions+in+Arabidopsis+companion+cells+reveals+non-specific+protein+trafficking+into+sieve+elements+and+identifies+a+novel+post-phloem+domain+in+roots%5BTitle%5D)+AND+%22Plant+J%22%5BJournal%5D)">Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots.</a> Plant J. 41 (2), 319-331 (2005).</li>
<li>Imlau, A., Truernit, E., Sauer, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell-to-cell+and+long-distance+trafficking+of+the+green+fluorescent+protein+in+the+phloem+and+symplastic+unloading+of+the+protein+into+sink+tissues%5BTitle%5D)+AND+%22Plant+Cell%22%5BJournal%5D)">Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues.</a> Plant Cell. 11 (3), 309-322 (1999).</li>
<li>Ostendorp, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Functional+analysis+of+Brassica+napus+phloem+protein+and+ribonucleoprotein+complexes%5BTitle%5D)+AND+%22New+Phytol%22%5BJournal%5D)">Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes.</a> New Phytol. 214 (3), 1188-1197 (2017).</li>
<li>Paultre, D. S. G., Gustin, M. -P., Molnar, A., Oparka, K. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Lost+in+Transit%3A+Long-Distance+Trafficking+and+Phloem+Unloading+of+Protein+Signals+in+Arabidopsis+Homografts%5BTitle%5D)+AND+%22Plant+Cell%22%5BJournal%5D)">Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts.</a> Plant Cell. 28 (9), 2016-2025 (2016).</li>
<li>Sali, A., Glaeser, R., Earnest, T., Baumeister, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((From+words+to+literature+in+structural+proteomics%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">From words to literature in structural proteomics.</a> Nature. 422 (6928), 216-225 (2003).</li>
<li>Lin, M. -K., Lee, Y. -J., Lough, T. J., Phinney, B. S., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Analysis+of+the+Pumpkin+Phloem+Proteome+Provides+Insights+into+Angiosperm+Sieve+Tube+Function%5BTitle%5D)+AND+%22Mol.+Cell.+Proteomics%22%5BJournal%5D)">Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function.</a> Mol. Cell. Proteomics. 8 (2), 343-356 (2008).</li>
<li>Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Towards+the+proteome+of+Brassica+napus+phloem+sap%5BTitle%5D)+AND+%22Proteomics%22%5BJournal%5D)">Towards the proteome of Brassica napus phloem sap.</a> Proteomics. 6 (3), 896-909 (2006).</li>
<li>Lucas, W. J., Yoo, B. C., Kragler, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNA+as+a+long-distance+information+macromolecule+in+plants%5BTitle%5D)+AND+%22Nat.+Rev.+Mol.+Cell.+Bio%22%5BJournal%5D)">RNA as a long-distance information macromolecule in plants.</a> Nat. Rev. Mol. Cell. Bio. 2 (11), 849-857 (2001).</li>
<li>Dinant, S., Kehr, J. Sampling and Analysis of Phloem Sap. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aDinant%2C+S+%22Plant+Mineral+Nutrients%22">Plant Mineral Nutrients</a>. 953, 185-194 (2013).</li>
<li>Kennedy, J. S., Mittler, T. E. <a target="_blank" href="http://www.nature.com/nature/journal/v171/n4351/abs/171528a0.html">A Method of obtaining Phloem Sap via the Mouth-parts of Aphids.</a> Nature. 171 (4351), 528(1953).</li>
<li>King, R. W., Zeevaart, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enhancement+of+Phloem+exudation+from+cut+petioles+by+chelating+agents%5BTitle%5D)+AND+%22Plant+Physiol%22%5BJournal%5D)">Enhancement of Phloem exudation from cut petioles by chelating agents.</a> Plant Physiol. 53 (1), 96-103 (1974).</li>
<li>Alosi, M. C., Melroy, D. L., Park, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+regulation+of+gelation+of+Phloem+exudate+from+cucurbita+fruit+by+dilution%2C+glutathione%2C+and+glutathione+reductase%5BTitle%5D)+AND+%22Plant+Physiol%22%5BJournal%5D)">The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase.</a> Plant Physiol. 86 (4), 1089-1094 (1988).</li>
<li>Dinant, S., Bonnemain, J. -L., Girousse, C., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Phloem+sap+intricacy+and+interplay+with+aphid+feeding%5BTitle%5D)+AND+%22Comptes+rendus+biologies%22%5BJournal%5D)">Phloem sap intricacy and interplay with aphid feeding.</a> Comptes rendus biologies. 333 (6-7), 504-515 (2010).</li>
<li>Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Collection+and+analysis+of+Arabidopsis+phloem+exudates+using+the+EDTA-facilitated+Method%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method.</a> J Vis Exp. (80), e51111(2013).</li>
<li>Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Application+of+a+modified+EDTA-mediated+exudation+technique+and+guttation+fluid+analysis+for+Potato+spindle+tuber+viroid+RNA+detection+in+tomato+plants+%28Solanum+lycopersicum%29%5BTitle%5D)+AND+%22J.+Virol.+Methods%22%5BJournal%5D)">Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum).</a> J. Virol. Methods. 198, 75-81 (2014).</li>
<li>Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Macromolecular+composition+of+phloem+exudate+from+white+lupin+%28Lupinus+albus+L%29%5BTitle%5D)+AND+%22BMC+Plant+Biol%22%5BJournal%5D)">Macromolecular composition of phloem exudate from white lupin (Lupinus albus L).</a> BMC Plant Biol. 11 (1), 36(2011).</li>
<li>Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cytokinins+in+the+Phloem+Sap+of+White+Lupin+%28Lupinus+albus+L.%29%5BTitle%5D)+AND+%22Plant+Physiol%22%5BJournal%5D)">Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.).</a> Plant Physiol. 94 (4), 1714-1720 (1990).</li>
<li>Yoo, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Systemic+Small+RNA+Signaling+System+in+Plants%5BTitle%5D)+AND+%22Plant+Cell%22%5BJournal%5D)">A Systemic Small RNA Signaling System in Plants.</a> Plant Cell. 16 (8), 1979-2000 (2004).</li>
<li>Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+and+characterization+of+small+RNAs+from+the+phloem+of+Brassica+napus%5BTitle%5D)+AND+%22Plant+J%22%5BJournal%5D)">Identification and characterization of small RNAs from the phloem of Brassica napus.</a> Plant J. 53 (5), 739-749 (2008).</li>
<li>Chalhoub, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Plant+genetics.+Early+allopolyploid+evolution+in+the+post-Neolithic+Brassica+napus+oilseed+genome%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome.</a> Science. 345 (6199), 950-953 (2014).</li>
<li>Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Detection+of+several+mRNA+species+in+rice+phloem+sap%5BTitle%5D)+AND+%22Plant+Cell+Phys%22%5BJournal%5D)">Detection of several mRNA species in rice phloem sap.</a> Plant Cell Phys. 39 (8), 895-897 (1998).</li>
<li>Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Use+of+aphid+stylectomy+and+RT-PCR+for+the+detection+of+transporter+mRNAs+in+sieve+elements%5BTitle%5D)+AND+%22J+Exp.+Bot%22%5BJournal%5D)">Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements.</a> J Exp. Bot. 53 (369), 631-637 (2002).</li>
<li>Ruiz-Medrano, R., Xoconostle-Cázares, B., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Phloem+long-distance+transport+of+CmNACP+mRNA%3A+implications+for+supracellular+regulation+in+plants%5BTitle%5D)+AND+%22Dev%22%5BJournal%5D)">Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants.</a> Dev. 126 (20), 4405-4419 (1999).</li>
<li>Schägger, H., Cramer, W. A., von Jagow, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Analysis+of+molecular+masses+and+oligomeric+states+of+protein+complexes+by+blue+native+electrophoresis+and+isolation+of+membrane+protein+complexes+by+two-dimensional+native+electrophoresis%5BTitle%5D)+AND+%22Anal.+Biochem%22%5BJournal%5D)">Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis.</a> Anal. Biochem. 217 (2), 220-230 (1994).</li>
<li>Schägger, H., von Jagow, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Blue+native+electrophoresis+for+isolation+of+membrane+protein+complexes+in+enzymatically+active+form%5BTitle%5D)+AND+%22Anal.+Biochem%22%5BJournal%5D)">Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form.</a> Anal. Biochem. 199 (2), 223-231 (1991).</li>
<li>Fiala, G. J., Schamel, W. W. A., Blumenthal, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Blue+native+polyacrylamide+gel+electrophoresis+%28BN-PAGE%29+for+analysis+of+multiprotein+complexes+from+cellular+lysates%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates.</a> J Vis Exp. (48), e2164(2011).</li>
<li>Rais, I., Karas, M., Schägger, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Two-dimensional+electrophoresis+for+the+isolation+of+integral+membrane+proteins+and+mass+spectrometric+identification%5BTitle%5D)+AND+%22Proteomics%22%5BJournal%5D)">Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification.</a> Proteomics. 4 (9), 2567-2571 (2004).</li>
<li>Schägger, H. <a target="_blank" href="https://www.nature.com/nprot/journal/v1/n1/full/nprot.2006.4.html">Tricine-SDS-PAGE.</a> Nature protocols. 1 (1), 16-22 (2006).</li>
<li>Wittig, I., Braun, H. -P., Schägger, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Blue+native+PAGE%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Blue native PAGE.</a> Nat Protoc. 1 (1), 418-428 (2006).</li>
<li>Eubel, H., Braun, H. -P., Millar, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Blue-native+PAGE+in+plants%3A+a+tool+in+analysis+of+protein-protein+interactions%5BTitle%5D)+AND+%22Plant+Methods%22%5BJournal%5D)">Blue-native PAGE in plants: a tool in analysis of protein-protein interactions.</a> Plant Methods. 1 (1), 11(2005).</li>
<li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li>
<li>Dyballa, N., Metzger, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fast+and+sensitive+colloidal+coomassie+G-250+staining+for+proteins+in+polyacrylamide+gels%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels.</a> J Vis Exp. (30), (2009).</li>
<li>Turnbull, C. G. N., Lopez-Cobollo, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Heavy+traffic+in+the+fast+lane%3A+long-distance+signalling+by+macromolecules%5BTitle%5D)+AND+%22New+Phytol%22%5BJournal%5D)">Heavy traffic in the fast lane: long-distance signalling by macromolecules.</a> New Phytol. 198 (1), 33-51 (2013).</li>
<li>Hall, S. M., Baker, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+chemical+composition+of+Ricinus+phloem+exudate%5BTitle%5D)+AND+%22Planta%22%5BJournal%5D)">The chemical composition of Ricinus phloem exudate.</a> Planta. 106 (2), 131-140 (1972).</li>
<li>Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Determining+protein+identity+from+sieve+element+sap+in+Ricinus+communis+L.+by+quadrupole+time+of+flight+%28Q-TOF%29+mass+spectrometry%5BTitle%5D)+AND+%22J.+Exp.+Bot%22%5BJournal%5D)">Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry.</a> J. Exp. Bot. 55 (402), 1473-1481 (2004).</li>
<li>Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Proteomics+of+curcurbit+phloem+exudate+reveals+a+network+of+defence+proteins%5BTitle%5D)+AND+%22Phytochemistry%22%5BJournal%5D)">Proteomics of curcurbit phloem exudate reveals a network of defence proteins.</a> Phytochemistry. 65 (12), 1795-1804 (2004).</li>
<li>Walz, C., Juenger, M., Schad, M., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evidence+for+the+presence+and+activity+of+a+complete+antioxidant+defence+system+in+mature+sieve+tubes%5BTitle%5D)+AND+%22Plant+J%22%5BJournal%5D)">Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes.</a> Plant J. 31 (2), 189-197 (2002).</li>
<li>Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Phloem+sap+proteins%3A+their+identities+and+potential+roles+in+the+interaction+between+plants+and+phloem-feeding+insects%5BTitle%5D)+AND+%22J+Exp.+Bot%22%5BJournal%5D)">Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects.</a> J Exp. Bot. 57 (4), 767-774 (2006).</li>
<li>Ham, B. -K., Brandom, J. L., Xoconostle-Cázares, B., Ringgold, V., Lough, T. J., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+polypyrimidine+tract+binding+protein%2C+pumpkin+RBP50%2C+forms+the+basis+of+a+phloem-mobile+ribonucleoprotein+complex%5BTitle%5D)+AND+%22Plant+Cell%22%5BJournal%5D)">A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex.</a> Plant Cell. 21 (1), 197-215 (2009).</li>
<li>Schamel, W. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Biotinylation+of+protein+complexes+may+lead+to+aggregation+as+well+as+to+loss+of+subunits+as+revealed+by+Blue+Native+PAGE%5BTitle%5D)+AND+%22J.+Immunol.+Methods%22%5BJournal%5D)">Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE.</a> J. Immunol. Methods. 252 (1-2), 171-174 (2001).</li>
<li>Zhang, S., Sun, L., Kragler, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+phloem-delivered+RNA+pool+contains+small+noncoding+RNAs+and+interferes+with+translation%5BTitle%5D)+AND+%22Plant+Physiol%22%5BJournal%5D)">The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation.</a> Plant Physiol. 150 (1), 378-387 (2009).</li>
</ol>

Die Autoren haben nichts preisgeben.

Das Phloem ist ein Fach von großem Interesse, da es den wichtigsten Transportweg für Photoassimilates bildet, und auch ist für Langstrecken Signalisierung zwischen verschiedenen pflanzlichen Teile9,20,34, 35. Neben kleinen Molekülen haben Makromoleküle wie Proteine und RNA mit Phloem Wartung und Signalisierung4,7,8verwickelt. Die Analyse der Zusammensetzung der Phloem ist durch die eingeschränkte Erreichbarkeit auf Phloem Proben in den meisten Pflanzenarten beschränkt. Die Insekten Mandrin Technik ist vielseitig einsetzbar, sondern experimentell anspruchsvoll und resultiert in sehr geringen Mengen von Phloem Proben11. Eine einfache Technik zum Phloem Probenahme ist EDTA erleichtert Exsudation12. EDTA bilden zweiwertige Ionen wie Calcium und verhindert somit Schließung der Sieb Platten von P-Proteine und Zellstress. Es ist einfach zu bedienen, aber ist anfällig für Verunreinigungen durch beschädigte Zellen und Proben verdünnt. Abbauende zweiwertige Ionen durch EDTA könnte auch zu einem Zusammenbruch der bestehenden Anlagen führen. Allerdings ermöglicht es Probenahme aus einer Vielzahl von Arten, einschließlich der Modellpflanze A. Thaliana15. Spontane Exsudation von Phloem Sap tritt nur in einer kleinen Anzahl von Pflanzenarten. Es ist eine invasive Methode, die erheblichen Verletzungen der Pflanze Gewebe10beinhaltet. Vor kurzem haben wir als eine Art Modell für das Studium Fernverkehr4,8,20 B. Napus etabliert. Hier können Sie Phloem Sap von kleinen Einschnitten, probieren die Verwundung Effekte und Kontaminationsquellen reduziert.
Verwenden verschiedene Stichprobenverfahren, das Proteom von Phloem Proben aus verschiedenen Pflanzenarten wurde untersucht in den letzten Jahren7,8,17,36,37, 38,39. Für diese Studien Proteom Proteine wurden extrahiert und unter denaturierenden Bedingungen ausgefällt und erlauben daher keinerlei Rückschlüsse auf Protein: Protein und Protein: Nukleinsäure-Interaktionen unter heimischen Bedingungen zu präsentieren. Co-Immunopräzipitation (CoIP) und Overlay-Assays zeigten, dass eine große Ribonucleoprotein komplexe könnte im Phloem-Saft von Kürbis40vorhanden, aber es nicht nachgewiesen wurde, dass makromolekulare komplexe unter heimischen Bedingungen innerhalb existieren der Phloem-System.
Blaue native Seite, eingeführt durch Schägger Et al. 26, in Kombination mit weiteren hochauflösenden Gel-Elektrophorese Schritte ermöglichen die Trennung der einzelnen Komponenten der große Proteinkomplexe. Mit 3D-Seite Analysen der native B. Napus Phloem Exsudat, konnten wir kürzlich zeigen, dass mehrere im Phloem Proben existieren hohen Molekulargewicht Protein: Protein und RNP-komplexe enzymatisch aktive4 sind. Alternative Methoden um Proteinkomplexe sowie RNPs zu isolieren, wie Größe Ausgrenzung Chromatographie existieren könnte, aber nicht in Bezug auf Auflösung im Vergleich zu BN-Seite. Darüber hinaus für eine angemessene Qualität der komplexen Trennung müssen Größe Ausgrenzung Spalte Matrizen die insgesamt komplexer Molekulargewichte untersucht angepasst werden. Analysieren komplexe unterschiedlicher Größe werden daher fordern verschiedene Typen von Spalten ist kostenintensiv und lässt sich nicht als hohe Fokussierung macht als BN-Seite.
Wichtige Schritte um komplexe aus B. Napus zu analysieren sind den Gesamtbetrag der Phloem Sap als Ausgangsmaterial verwendet. Mindestens 600 µL Phloem Probe sind notwendig und können aus fünf gut-gewässerten Pflanzen gewonnen werden. Für 3D-Seite und BN Nordbeflecken ist es notwendig, das erste BN-Gel mit einer ausreichenden Menge von Phloem Proben beginnen. Um dies zu erreichen, sind Phloem Proben konzentriert, bis gut und mindestens 20 bis 30 µg Protein in jeder geladen werden kann, dass Triplicates der gleichen Probe parallel ausgeführt werden. Zu niedrige oder zu hohe Konzentrationen reduzieren die Erkennung von komplexen (Abbildung 3). Phloem Proben müssen in Reaktionsgefäßen auf Eis gesammelt und eingefroren für die spätere Verwendung zur Vermeidung von Proteinabbau und Umsatz gespeichert werden soll. Protease-Inhibitoren sind in allen Phloem Proteome analysiert gefunden worden, aber auch ein vollaktives Proteasom in das Phloem von B. Napus4beschrieben wurde. Darüber hinaus abhängig von Volumen und Zusammensetzung Phloem Proben die Sampling-Zeit-Punkt und Umweltbedingungen10. Daher muss darauf geachtet werden, zur gleichen Zeit des Tages unter ähnlichen Bedingungen zu sammeln. Stress-Behandlungen (z.B. Trockenheit) reduzieren die Menge der Bast, die gesammelt werden können. Um einzelne Proteine durch Massenspektrometrie zu identifizieren, ist es zwingend erforderlich, um mögliche Keratin Verunreinigungen durch tragen von Handschuhen die Zeit zu begrenzen. Keratin führt zu zusätzlichen Signale während der Masse Spec Analyse und Proteinidentifikation behindert. Ausführen der BN-Seite an eine höhere Spannung oder bei Raumtemperatur führen zur Erwärmung des Gels, die Demontage der fragilen komplexe führen können.
Die hier vorgestellten Protokoll eignet sich für die Analyse von Protein: Protein-komplexe. Wir zeigen auch, dass es verwendet werden kann, um bestimmte RNAs enthalten in den komplexen parallel zu erkennen. Um dies zu erreichen, haben wir vor kurzem ein Protokoll für northern Blot-4BN eingeführt. RNAs sind anfällig für Abbau durch RNAse Verunreinigungen. Um diesen Abbau zu begrenzen sollte DEPC-behandelte Wasser verwendet werden.
Wichtigste Einschränkungen der vorgestellten Methode gehören die Schätzung des Molekulargewichtes von Proteinkomplexen getrennt von BN-Seite, da Migrationsverhalten auf Größe, Form und auch posttranslationale Modifikationen der komplexe31abhängt, 41. Abschätzung der Größe der RNP-komplexe ist noch komplizierter durch den Einfluss von Nukleinsäuren auf das Migrationsverhalten. Es kann auch nicht verhindert werden, dass komplexe gleicher Größe in einem einzigen Band Co migrieren. Dies führt zu der falschen Vorhersage von komplexen Kompositionen. Überprüfen daher die beobachteten Interaktionen mit komplementären Techniken, kann z. B. durch funktionelle Assays4, erforderlich sein. Auch verloren nur schwach oder vorübergehend zu einem makromolekulare Komplex verbundenen Proteine in der BN-Puffer verwendet. Um dies zu vermeiden, könnte Proben vernetzt, was auch zu Artefakten führen können oder nicht Proteinidentifikation, oder der Pufferbedingungen optimiert werden.
Im Gegensatz zu klassischen 2D-Seite, die Kombination von Harnstoff und SDS-PAGE ermöglicht die Trennung nach Hydrophobie und Molekulargewicht statt isoelektrischen Punkt (pI) und Molekulargewicht 28, und schränkt nicht die Trennung an Proteine von einem spezifische pI reichen. Ähnlich wie bei klassischen 2D-Seite, getrennten Proteine sind als einzelne Flecken sichtbar, aber auf einer diagonalen Linie 4,28 (Abbildung 5, Abbildung 6). Weitere hydrophobe Proteine erscheinen in Flecken über diese Diagonal, während mehr hydrophile Proteine sich unterhalb der Linie28 befinden. In diesem Protokoll verwendeten Polyacrylamid-Konzentrationen werden Proteine zwischen 25 bis 80 kDa gut zu trennen. Ermöglicht einer Trennung von kleineren oder größeren Proteinen die Polyacrylamid Konzentration variiert werden oder Farbverlauf Gele eingesetzt werden, in der dritten Dimension. Die Komponenten des komplexen IV (Abbildung 3) getrennt durch 3D-Seite (Abbildung 6) wurden ausgeschnitten, Trypsin verdaut und durch Massenspektrometrie analysiert. Dies führte bei der Identifizierung von mehreren tRNA Ligases. Die Komponenten der anderen Anlagen wurden vor kurzem veröffentlicht 4. Unsere 3D-Seite aktiviert die Trennung der verschiedenen Ligases, nämlich Aspartat-, Asparagin, Threonin, Lysin und Glycin Ligases mit ähnlichen Molekulargewichten (Tabelle 3). Mit einer Methionin-tRNA-spezifische-Sonde, wir konnten potenziell gebundene tRNA innerhalb komplexer IV erkennen, aber wenn in voller Länge tRNA oder tRNA Fragmente in der Anlage sind kann nicht mit den Sonden verwendet diskriminiert werden. Um zu überprüfen, wenn die Nukleinsäuren wirklich gefesselt innerhalb des Komplexes und Co nicht migrieren sind, Protease Phloem Sap verdaut können Proben als geeignete Migration Kontrollen dienen.
Es wurde bereits spekuliert, dass Protein Übersetzung im Phloem Sieb Röhren, auftreten kann, da fast die meisten Komponenten der gesamten Ribosom sowie Dehnung Faktoren im Phloem Proben4,7gefunden worden sind. Unsere Feststellung der tRNA und tRNA Ligases scheint diese Idee zu unterstützen. Allerdings tRNA Fragmente vorhanden im Phloem Proben aus Kürbis haben gezeigt, dass potente Inhibitoren der Übersetzung42 werden und funktionelle Ribosomen scheinen zu fehlen4, was darauf hindeutet, dass die Übersetzung nicht stattfinden kann.
Zusammengenommen kann das Protokoll hier präsentierten die Trennung von nativen Protein: Protein und sogar RNP komplexe aus Bast Proben und die Trennung und Identifizierung ihrer einzelnen Komponenten mit hoher Auflösung. Die Anwendung dieser Methode ermöglicht die Entdeckung neuartiger Protein und RNP-komplexe im Phloem Proben und kann daher neue Funktionen in diesem hoch spezialisierten Werk Fach aufzuklären.

Die Langstrecken das Phloem-Conduits sind essentiell für die Verteilung von Nährstoffen in höheren Pflanzen, sondern sind auch beteiligt bei der Regulierung der vielen verschiedener Prozessen wichtig für Wachstum und Entwicklung, Erreger Verteidigung und die Anpassung an den negativen Umweltbedingungen. Neben kleinen Effektoren wie Ionen, Phytohormonen oder Metaboliten selbst sind Makromoleküle wie Proteine und RNA als potentielle Signale vor kurzem entstanden.
Studien haben gezeigt, dass Phloem Laden von Proteinen Größe abhängig und kontrollierten durch Ausgrenzung Größenbeschränkung (SEL) der Pore-plasmodesmal Einheiten verbinden Begleiter Zellen (CC) und sieben Elemente (SE), die typischerweise im Bereich von 10 bis > 67 kDa1 , 2 , 3. jedoch trotz dieser Größe Beschränkungen größere Proteine und Protein komplexe innerhalb des Systems der Phloem herausfordernde Idee der Größe Ausgrenzung4gefunden wurden, und auch unspezifische Verlust von Proteinen aus CC SE wurde vorgeschlagen5 .
Multi sowie große Ribonucleoprotein komplexe spielen entscheidende Rolle bei der Biosynthese und Aufrechterhaltung der strukturellen Integritätdes der Zelle6. Es gibt Hinweise darauf, dass Protein-Protein und Ribonucleoprotein komplexe Phloem-Mobile gibt es4,7, aber bisher ist wenig über ihre Funktion bekannt. Im Phloem Siebelemente Protein: Protein und RNP-komplexe mit Fernverkehr und / oder Signalisierung8,9verwickelt. Um die Funktionen der translozierten komplexe, studieren ihre Zusammensetzung unter verschiedenen ökologischen zu entwirren oder stress Bedingungen ist erforderlich. Um dies zu erreichen, haben einheimische komplexe isoliert werden und ihre Komponenten mit ausreichender Auflösung getrennt werden.
Um hohen Molekulargewicht komplexe aus dem Phloem zu isolieren, ist es zunächst notwendig zu SAP-Proben in ausreichender Qualität und Menge zu erhalten. Die Technik, die für Phloem Probenahme verwendet werden kann hängt von der Pflanzenart von Interesse. Drei Hauptmethoden, Phloem Sap zu erhalten gibt es 10: Insekt Stylectomy11, EDTA erleichtert Exsudation12und spontane Exsudation13.
Phloem Proben von Arabidopsis Thaliana (A. Thaliana), der wichtigsten Modellpflanze in Laboren weltweit, erhalten Sie nur durch EDTA erleichtert Exsudation oder Blattlaus Stylectomy14,15. Beide Methoden führen zu stark verdünnte Phloem Sap oder sehr niedrigen Probe Beträge. EDTA-erleichtert Exsudation ist auch anfällig für Verschmutzung und kann nicht die reale Phloem Zusammensetzung16darstellen. Spontane Phloem Exsudation beschränkt sich auf Pflanzenarten wie Kürbisgewächse, Lupine oder Yucca, wohin führt Pflanzenteile abschneiden, eine spontane Emission von Phloem Sap, die leicht erhobenen13,17,18werden können, 19. Wir vor kurzem errichtet Raps (Brassica Napus) als Modellsystem für Phloem Analyse geeignet, denn es ist ein naher Verwandter von A. Thaliana und mehrere Mikroliter der Phloem Sap kann erfragt werden kleine Einschnitte, die gezeigt wurden sein hoher Reinheit4,8,20. Darüber hinaus wurde die Genomsequenz B. Napus 201421veröffentlicht.
Mit Ausnahme der Blattlaus Stylectomy alle Phloem Erhebungsmethoden beschrieben gehören Beschädigung des umgebenden Gewebes am Ort der Probenahme und die Zusammensetzung der Phloem Sap variieren in Reaktion auf eine Verletzung. Daher ist es unerlässlich, um die Qualität von Phloem Proben, unabhängig von der Sampling-Methode angewendet. Es gibt verschiedene Methoden zur Qualitätskontrolle von gesammelten Phloem Sap, z.B. durch Bestimmung der RNase Aktivität22,23, RT-PCR mit Primer gegen Rubisco8,24, oder die Analyse des Zuckers Zusammensetzung-8.
Verschiedene Methoden zu isolieren und zu trennen Proteinkomplexe aufgebracht werden können, einschließlich Größe Ausgrenzung Chromatographie, Saccharose Dichte Ultrazentrifugation oder Probenfiltration durch Membranen mit unterschiedlichen Molekulargewicht Cut Offs. Allerdings erlauben diese Ansätze keine hohen Auflösung. Die Technik namens blau native Seite (BN-Seite), erstmals von Schägger Et al.beschrieben. 25, ist überlegen in Bezug auf Auflösung. Es wurde erfolgreich verwendet, um festzustellen, die Molmassen von großen systemeigene Proteinkomplexen aus verschiedenen Organellen oder zellulären Lysates und ihre relativen Häufigkeiten26,27.
Um die komplexe Zusammensetzung von Proteinkomplexen weiter zu erhellen, ist es notwendig, die einzelnen Komponenten unter denaturierenden Bedingungen führt zu komplette Demontage komplexer Bauteile zu trennen. Dies kann durch eine zweite Dimension der SDS-PAGE 28,29 oder höheren Auflösung, durch eine zweite Dimension der isoelektrischen Fokussierung (IEF) gefolgt von einer Third dimension von SDS-PAGE30 und spätere Identifikation der zu erreichen die Proteine mittels Massenspektrometrie.
In diesem Protokoll beschreiben wir Probenahme von reinen Phloem-Saft von B. Napus Pflanzen und die Analyse von Proteinkomplexen aus solchen Phloem Proben mit einem 3D elektrophoretischen Ansatz BN-Seite mit Tris-Tricine-Harnstoff-PAGE und SDS-PAGE zu verbinden. Die getrennten Protein komplexen Bauteile werden anschließend durch Massenspektrometrie identifiziert. Darüber hinaus führen wir als eine Methode, die Erkennung von RNAs in großen RNP-komplexe4blau native Nordbeflecken erweitert die Anwendbarkeit des Ansatzes.

<table><tbody><tr><td>1.5 mL reaction tubes</td><td>Eppendorf</td><td>30120086</td><td></td></tr><tr><td>10 well comb for SDS PAGE, thickness 1 mm</td><td>BioRad</td><td>1653359</td><td></td></tr><tr><td>2-Propanol</td><td>AppliChem</td><td>131090</td><td></td></tr><tr><td>30 % Acrylamide-bisacrylamide solution (29:1) solution</td><td>BioRad</td><td>1610156</td><td></td></tr><tr><td>30 % Acrylamide-bisacrylamide solution (37.5:1) solution</td><td>BioRad</td><td>1610158</td><td></td></tr><tr><td>96 % Ethanol</td><td>Carl Roth</td><td>P075</td><td></td></tr><tr><td>Acetic acid</td><td>Carl Roth</td><td>6755</td><td></td></tr><tr><td>Agarose</td><td>Lonza</td><td>50004</td><td></td></tr><tr><td>Aluminum sulfate-(14-18)-hydrate</td><td>AppliChem</td><td>141101</td><td></td></tr><tr><td>Ammonium peroxodisulfate (APS)</td><td>Carl Roth</td><td>9592.3</td><td></td></tr><tr><td>Bis-Tris</td><td>AppliChem</td><td>A3992</td><td></td></tr><tr><td>Boric acid</td><td>AppliChem</td><td>A2940</td><td></td></tr><tr><td>Bromophenol blue</td><td>AppliChem</td><td>A2331</td><td></td></tr><tr><td>Centrifugal concentrators &lt;em&gt;e.g.&lt;/em&gt; Vivaspin 500 (Mwco 10 kDa)</td><td>Sartorius</td><td>VS0102</td><td></td></tr><tr><td>Chemiluminescent Nucleic Acid Detection Module Kit</td><td>Thermo Fisher Scientific</td><td>89880</td><td></td></tr><tr><td>Chromatography papers &lt;em&gt;e.g.&lt;/em&gt; 3 mm CHR</td><td>Whatman</td><td>3030-153</td><td></td></tr><tr><td>CoolBox M30 System</td><td>Biocision</td><td>BCS-133</td><td></td></tr><tr><td>Coomassie brilliant Blue G-250</td><td>AppliChem</td><td>A3480</td><td></td></tr><tr><td>Diethyl pyrocarbonate (DEPC)</td><td>AppliChem</td><td>A0881</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>AppliChem</td><td>A1101</td><td></td></tr><tr><td>DNase I</td><td>AppliChem</td><td>A3778</td><td></td></tr><tr><td>Ethanol abs.</td><td>AppliChem</td><td>A3693</td><td></td></tr><tr><td>Ethylenediaminetetraacetic acid (EDTA)</td><td>AppliChem</td><td>A1103</td><td></td></tr><tr><td>Gel Imaging system &lt;em&gt;e.g.&lt;/em&gt; Chemidoc Touch</td><td>BioRad</td><td>1708370</td><td></td></tr><tr><td>GeneRuler 1kb plus</td><td>Thermo Fisher Scientific</td><td>SM1331</td><td></td></tr><tr><td>Glycerol</td><td>AppliChem</td><td>141339</td><td></td></tr><tr><td>Glycine</td><td>AppliChem</td><td>131340</td><td></td></tr><tr><td>Heating block TS1</td><td>Biometra</td><td>846-051-500</td><td></td></tr><tr><td>Hybridization oven &lt;em&gt;e.g.&lt;/em&gt; GFL Hybridization Incubator 7601</td><td>GFL</td><td>7601</td><td></td></tr><tr><td>Hypodermic needle (0.8 mm)</td><td>B Braun</td><td>4658309</td><td></td></tr><tr><td>IPG gel comb, thickness 1 mm</td><td>BioRad</td><td>1653367</td><td></td></tr><tr><td>Labeling of RNA &lt;em&gt;e.g.&lt;/em&gt;Biotin 3&#039;end DNA Labeling Kit</td><td>Thermo Fisher Scientific</td><td>89818</td><td></td></tr><tr><td>Native gradient gel &lt;em&gt;e.g.&lt;/em&gt; Novex NativePAGE 4&amp;ndash;16% Bis-Tris protein gel</td><td>Invitrogen</td><td>BN1002BOX</td><td></td></tr><tr><td>Nylon membrane &lt;em&gt;e.g.&lt;/em&gt; Hybond-N+</td><td>Amersham Pharmacia</td><td>RPN203B</td><td></td></tr><tr><td>Ortho-phosphoric acid</td><td>Carl Roth</td><td>6366.1</td><td></td></tr><tr><td>PageRuler prestained protein ladder</td><td>Thermo Fisher Scientific</td><td>26616</td><td></td></tr><tr><td>Power supply for Gel electrophoresis EPS</td><td>Amersham Pharmacia</td><td>18-1130-01</td><td>available from GE Healthcare</td></tr><tr><td>RNA Cleanup Kit</td><td>Qiagen</td><td>74204</td><td></td></tr><tr><td>Semi dry blot &lt;em&gt;e.g&lt;/em&gt;. Fastblot 43B semi dry Blot</td><td>Biometra</td><td>846-015-100</td><td></td></tr><tr><td>Sodium chloride (NaCl)</td><td>AppliChem</td><td>A1149</td><td></td></tr><tr><td>Sodium dodecyl sulfate (SDS)</td><td>AppliChem</td><td>142363</td><td></td></tr><tr><td>Synthesis of cDNA &lt;em&gt;e.g.&lt;/em&gt; RevertAid First Strand cDNA Synthesis Kit</td><td>Thermo Fisher Scientific</td><td>K1621</td><td></td></tr><tr><td>Tetramethylethylenediamine (TEMED)</td><td>AppliChem</td><td>A1148</td><td></td></tr><tr><td>Tricine</td><td>AppliChem</td><td>A3954</td><td></td></tr><tr><td>Tris</td><td>AppliChem</td><td>A1086</td><td></td></tr><tr><td>Tri-sodium citrate dihydrate</td><td>AppliChem</td><td>A3901</td><td></td></tr><tr><td>TRIzol Reagent</td><td>Thermo Fisher Scientific</td><td>15596026</td><td></td></tr><tr><td>ULTRAhyb Ultrasensitive Hybridization Buffer</td><td>Thermo Fisher Scientific</td><td>AM8670</td><td></td></tr><tr><td>Urea</td><td>AppliChem</td><td>A1360</td><td></td></tr><tr><td>UV Crosslinker &lt;em&gt;e.g.&lt;/em&gt; Stratalinker 2400</td><td>Agilent</td><td>NC0477671</td><td>from Fisher Scientific</td></tr><tr><td>Vertical electrophoresis apparatus &lt;em&gt;e.g.&lt;/em&gt;The XCell SureLock Mini-Cell or Mini-Protean III System</td><td>Thermo Fisher Scientific or BioRad</td><td>EI0001 or 1658004</td><td></td></tr><tr><td>Wipers &lt;em&gt;e.g.&lt;/em&gt; KIMWIPES Delicate Task Wipers</td><td>Kimberly-Clark</td><td>34120</td><td></td></tr></tbody></table>

phloem sap sampling from brassica napus for 3d-page of protein and ribonucleoprotein complexes

Probenahme das Phloem der höheren Pflanzen ist oft mühsam und wesentlich abhängig von der Pflanzenart. Proteom-Studien unter denaturierenden Bedingungen konnte jedoch in verschiedenen Pflanzenarten erreicht werden. Nativen Protein: Protein und Eiweiß: Nukleinsäure-komplexe aus Bast Proben noch kaum analysiert wurden, obwohl sie eine wichtige Rolle in der Wartung von diesem spezialisierten Fach oder im Fernverkehr Signalisierung spielen könnte. Große molekularen Baugruppen können isoliert mit einer blauen gebürtige Gelelektrophorese (BN-Seite) werden. Ihre Proteinkomponenten können durch eine anschließende Natriumsulfat der Dodecyl Seite (SDS-PAGE) getrennt werden. Allerdings migrieren Co Proteine mit ähnlichen Molekulargewichten, was kann Proteinidentifikation durch Massenspektrometrie behindern. Kombination von BN-Seite mit zwei verschiedenen Geruchsstoffen Gel-Elektrophorese Schritten, nämlich Tris-Tricine-Harnstoff und SDS-PAGE, ermöglicht die weitere Trennung der Proteine nach ihrer Hydrophilie/Hydrophobie und erhöht somit Auflösung und den Erfolg der Proteinidentifizierung. Es erlaubt sogar die Proteine, die unterscheiden sich nur in ihrer posttranslationale Modifikationen zu unterscheiden. Darüber hinaus kann blau native Nordbeflecken angewendet werden, um die RNA-Komponenten in makromolekulare komplexe zu identifizieren. Wir zeigen, dass unser Protokoll geeignet, das Protein und die RNA-Komponenten von nativen Protein: Protein und Ribonucleoprotein (RNP) komplexe im Phloem Proben zu entwirren. Kombination von einem blauen native Seite mit zwei verschiedenen Geruchsstoffen Seite Schritte kann dazu beitragen, um verschiedene Arten von großer Proteinkomplexe zu trennen und ermöglicht auch eine höhere Erkennungsrate von deren Komponenten durch Massenspektrometrie. Darüber hinaus ist das Protokoll robust genug, um gleichzeitig potenziell gebundenen Nukleinsäuren in einzelne Protein-komplexe erkennen.

Hier präsentieren wir ein Protokoll, das die Analyse von Protein: Protein erlaubt sowie Protein: RNA-komplexe im Phloem Proben aus Brassica Napus. Der Workflow ist in Abbildung 1dargestellt. Ein großer Vorteil von B. Napus über andere Modellorganismen ist die Möglichkeit, relativ einfach Phloem Musterkollektion von kleine Einstiche im Blütenstand Stiel. Dies ermöglicht, um reine Phloem Proben in vergleichsweise großen Mengen zu erhalten. Bei der Probenahme Phloem, ist es immer ratsam, für Verunreinigungen, zum Beispiel durch RT-PCR8zu überprüfen. Ein repräsentatives Ergebnis erhalten von einer reinen Phloem-Probe ist in Abbildung 2dargestellt. Non-kontaminierten Phloem Proben sollte eine sichtbare Band für Thioredoxin h zeigen, während kein Signal für Rubisco und Pollen-Hüllprotein angezeigt werden soll. Die kleine Untereinheit der Rubisco dienen als Steuerelement in Proben aus den Blättern, Blütenstand Stengel oder Pollen. Thioredoxin h sollte in allen Proben nachweisbar sein, da die mRNA gefunden wurde in das Phloem von verschiedenen Arten, während die Pollen Mantel Protein Abschrift nur in Blütenknospe Proben sichtbar sein soll. Verunreinigungen können auftreten, wenn Phloem Probenahme durchgeführt wird, voll blühender Pflanzen (Pollen Hüllprotein) oder wenn die ersten Tröpfchen aus dem Phloem Probenahme Punktionen nicht ordnungsgemäß verworfen werden (Rubisco).
Vor BN-Seite ist es zwingend erforderlich, um dem Phloem-Saft zu konzentrieren. Mit 20 bis 30 µg Protein pro Bohrloch, mindestens vier große Protein Komplex Bänder sichtbar nach BN-Seite von B. Napus Phloem Sap, zu niedrig oder zu hohe Konzentration nicht erlauben eine klare Trennung der komplexe (Abbildung 3). Es empfiehlt sich, mehrere Gel-Bands vertreten die gleichen Komplex in einer einzigen Tasche des zweiten Dimension Gels die Proteine aus jeder einzelnen Anlage für downstream-Processing und spätere massenspektrometrische Identifizierung sich laden.
Um die einzelnen Komponenten der Phloem makromolekulare komplexe zu identifizieren, wir BN-Startseite in Kombination mit einer zweiten Dimension Tris-Tricine-Harnstoff und eine dritte dimension SDS-PAGE um eine Trennung der einzelnen Proteine zu erreichen. Eine Trennung mit hoher Auflösung kann hier, aufgrund der verschiedenen Protein Migration Verhalten in Harnstoff und SDS-PAGE Gelen beobachtet werden. In der Regel sind Proteine, die Zugehörigkeit zu einem einzigen Komplex als eine diagonale Linie über das Gel sichtbar. Proteine oberhalb dieser Linie haben eine erhöhte Hydrophobie, während Proteine unter dem Strich mehr hydrophilen diejenigen28 (Abbildung 5, Abbildung 6) darstellen.
Für die Charakterisierung von RNP-komplexe haben wir einen Teil einer BN-PAGE-Gel BN Nordbeflecken durchführen. Nach beflecken eine ganze Spur auf einen Nylon-Membran und Vernetzung durch UV-Strahlung, kann die RNA mit RNA-spezifischen Sonden, wie in Abbildung 4dargestellt visualisiert werden. Hier wird gezeigt, dass eine spezifische tRNA nur in einer bestimmten Anlage vorhanden ist. Die Proteinkomponenten dieser tRNA-Binding-Komplex können mit dem oben beschriebenen 3D Gel-Ansatz weiter untersucht werden. Massenspektrometrische Analysen ergaben, dass diese Anlage vor allem tRNA-Ligases was bestätigt die tRNA verbindliche Aktivität enthält von BN Nordbeflecken gefunden.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57097/57097fig1.jpg"> Abb. 1: Ablauf der Analyse von komplexen Ribonucleoprotein in dem Phloem-Saft des Raps arbeiten. Nach der Probenahme und Vorbereitung der Proben Phloem wird BN-Seite durchgeführt, um native komplexe zu trennen. Solche Gele BN-Seite ermöglichen die parallele Analyse von Nukleinsäuren von BN Nordbeflecken und die Identifizierung von den Eiweißbausteinen der komplexe durch Massenspektrometrie. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57097/57097fig2.jpg"> Abbildung 2: Probenahme und Reinheit Kontrolle über Phloem-Saft des B. Napus. Nach der Punktion des Blütenstand Stammes von ca. 8-10 Wochen alten Rapspflanzen mit einer sterilen Injektionsnadel, Exsudat mit einer Pipette gesammelt und übertragen eine eiskalte Reaktionsgefäß (a), die Reinheit der Phloem Proben bestätigen, die RT-PCR durchgeführt wird, verstärken die Transkripte von Thioredoxin h, Rubisco kleine Untereinheit und Pollen Hüllprotein in gewebespezifischen Proben (b) RT-PCR ohne Reverse Transkriptase wurde als Kontrolle (-) durchgeführt. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57097/57097fig3.jpg"> Abbildung 3: BN-Seite. Schematische Darstellung des blauen native Seite mit konzentrierter Phloem Proben von B. Napus. (a) nach dem Laden der gradient Protein Gel mit 15-20 µL konzentrierte Phloem Sap, ist BN-Seite mit 1 X dunkle blaue Kathode Puffer B 150 V für 20-30 min in einem kalten Raum durchgeführt. Dann Puffer gegen 1 X leichte blaue Kathode Puffer B/10 ausgetauscht und die Seite ist fertig bei 150 V für 120-180 min bis dunkelblau läuft vorne läuft aus dem Gel. Die BN-Seite Gele zeigen vier verschiedene Bands aus vier verschiedenen hohen Molekulargewicht-komplexen. (b) laden (c) zu wenig oder zuviel (d) Phloem Proteine reduziert die Sichtbarkeit der einzelnen komplexe. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57097/57097fig4.jpg"> Abbildung 4: BN Nordbeflecken. Schematische Darstellung der BN northern Blot-Methode. (a) eine Spur der BN-Seite wird auf eine Nylon-Membran durch semi-dry blotting übertragen. Nach UV-Vernetzung und Pre-Hybridisierung wird die Membran mit RNA spezifische Sonden (hier eine Methionin-tRNA-spezifische Sonde), die biotinylierte am 3'-Ende in einer Hybridisierung Ofen über Nacht inkubiert. Kostenlose Sonden werden durch Waschschritte entfernt und die Erkennung der RNA erfolgt durch einen Streptavidin-HRP-Konjugat und Luminol. Mit diesem Ansatz, wir beobachteten, dass komplexe IV von der BN-Seite Methionin enthält tRNA. (b) die Coomassie gefärbt-Gel und der tRNA-Blot ähneln zwei verschiedene Gel Bahnen laufen parallel zur Migration Unterschiede zu vermeiden. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57097/57097fig5.jpg"> Abbildung 5: 3D-Seite. Schematische Darstellung des 3D-Seite-Ansatzes. Mehrere Bands aus der gleichen Komplex werden herausgeschnitten aus einer BN-PAGE-Gel, in Ladepuffer inkubiert und in einem Brunnen der zweiten Dimension Tris-Tricine-Harnstoff-Seite übertragen. Nach Elektrophorese sind ganze Gel Bahnen ausgeschnitten, in sauren Säure-Puffer gewaschen, equilibriert, und auf eine 15 % SDS-PAGE Gel gelegt. Nach der dritten Dimension Seite sind die getrennten Proteine Coomassie gefärbt und durch Massenspektrometrie analysiert. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig5large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57097/57097fig6.jpg"> Abbildung 6: Vertreter führt nach 3D-Seite. Im Rahmen der ersten Dimension BN-Seite erschienen mehrere komplexe. Ihre Proteinkomponenten konnte durch zwei denaturierenden Folgeseiten, wodurch ein Muster mit diagonalen Streifen vor Ort weiter getrennt werden. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig6large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Sonde</td>
			<td>Sequenz</td>
		</tr>
<tr>
<td>Thioredoxin h</td>
			<td>
 weiter: CTCAAGGCAGCCAAAGAATC Rückseite: ATGGCCTGAACATCGAACTC</td>
		</tr>
<tr>
<td>RuBisCo kleine Kette</td>
			<td>
 weiter: TTCACCGGCTTGAAGTCATC Rückseite: CCGGGTACTCCTTCTTGCAT</td>
		</tr>
<tr>
<td>Pollen-Hüllprotein BRU77666</td>
			<td>
 weiter: TCAGAACTGGAGCTTCAACG Rückseite: TTCCTTAATGGCCTCAGTGG</td>
		</tr>
</tbody></table>Tabelle 1: Primer verwendet für Phloem Probe Reinheitskontrolle. Bestätigen Phloem Probe Reinheit Primer spezifisch für Rubisco kleine Kette, Thioredoxin h und Pollen Hüllprotein cDNA Amplification einsetzbar.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Puffer und Lösungen</td>
			<td colspan="2">Inhalt</td>
			<td>Kommentar</td>
		</tr>
<tr>
<td>dunkel blaue Kathode Puffer B</td>
			<td colspan="2">15 mM Bis-Tris pH 7,0 50 mM Tricine 0,02 % (w/V) Coomassie blue G250</td>
			<td>Rezept ist von Fiala Et Al. 17 angepasst. 7.0 sollte der pH-Wert eingestellt werden Puffer kann als ein 10 X Lager gebildet werden</td>
		</tr>
<tr>
<td>leichte blaue Kathode Puffer B/10</td>
			<td colspan="2">15 mM Bis-Tris pH 7,0 50 mM Tricine 0,002 % (w/V) Coomassie blue G250</td>
			<td>Puffer kann durch Verdünnung Kathode Puffer B mit Kathode Puffer ohne Coomassie hergestellt werden</td>
		</tr>
<tr>
<td>Anode Puffer</td>
			<td colspan="2">
 50 mM Bis-Tris pH 7,0</td>
			<td>Puffer kann als ein 10 x Stammlösung hergestellt werden</td>
		</tr>
<tr>
<td>2 x SDS-Probenpuffer</td>
			<td colspan="2">
 125 mM Tris-HCl pH 6,8 4 % SDS 20 % Glycerin 0,2 M DVB-T 0,02 % (w/V) Bromophenol blue</td>
			<td></td>
		</tr>
<tr>
<td>Puffer 1 X TBE Puffer übertragen</td>
			<td colspan="2">
 89 mM Tris pH 7.6 89 mM Borsäure 2 mM EDTA</td>
			<td>TBE-Puffer kann gemacht und als Vorräte an 5 X oder 10 X gespeichert werden. Es ist wichtig, mit RNase-freie deionisiertes Wasser.</td>
		</tr>
<tr>
<td>2 x SSC-Puffer</td>
			<td colspan="2">
 300 mM NaCl 30 mM Na3Citrat pH 7,0</td>
			<td></td>
		</tr>
<tr>
<td>3 x Gel-Puffer</td>
			<td colspan="2">
 3 M Tris 1 M HCl 0,3 % SDS pH 8.45</td>
			<td>Rezept von Schägger 19 angepasst
</td>
		</tr>
<tr>
<td>Tris-Tricine Gel Lösung A</td>
			<td colspan="2">
 Für 10 mL: 30 % Acrylamid-Bisacrylamide (29,1) 3,34 mL 6 M Harnstoff 3 X Gel 3,34 mL Puffer 70 % Glycerin 1,4 mL 10 mL DdH2O hinzufügen 10 % APS 40 ΜL TEMED 4 ΜL</td>
			<td>Gewicht 6 M Harnstoff und 3 x Gel-Puffer, der Acrylamid-Bisacrylamide Lösung und 70 % Gycerol hinzufügen. Erhitzen Sie auf 60 ° C in einem Wasserbad auf den Harnstoff zu solubilisieren. Fügen Sie DdH2O bis 10 mL, 10 % APS und TEMED für die Polymerisation.</td>
		</tr>
<tr>
<td>Tris-Tricine Gel Lösung B</td>
			<td colspan="2">
 Für 6 mL: 30 % Acrylamid-Bisacrylamide (29,1) 0,8 mL 6 M Harnstoff 3 X Gel Puffer 1,5 mL 6 mL DdH2O hinzufügen 10 % APS 45 ΜL TEMED 4,5 ΜL</td>
			<td>Gewicht 6 M Harnstoff und 3 x Gel Puffer und Acrylamid-Bisacrylamide Lösung hinzufügen. Erhitzen Sie auf 60 ° C in einem Wasserbad auf den Harnstoff zu solubilisieren. Fügen Sie DdH2O bis 10 mL, 10 % APS und TEMED für die Polymerisation.</td>
		</tr>
<tr>
<td>1 x Tris-Tricine laufenden Puffer (Anode)</td>
			<td colspan="2">
 100 mM Tris 22,5 mM HCl pH 8,9</td>
			<td>Rezept von Schägger 19 angepasst
</td>
		</tr>
<tr>
<td>1 x Tris-Tricine laufenden Puffer (Kathode)</td>
			<td colspan="2">
 100 mM Tris 100 mM Tricine 1 % SDS pH 8,25</td>
			<td>Rezept von Schägger 19 angepasst
</td>
		</tr>
<tr>
<td>Sauren Puffer</td>
			<td colspan="2">
 100 mM Tris 100 mM Essigsäure</td>
			<td></td>
		</tr>
<tr>
<td>4 % SDS Stapeln gel</td>
			<td colspan="2">
 Für 2 mL: DdH2O 1,4 mL 30 % Acrylamid-Bisacrylamide (37.5:1) 0,33 mL 1 M Tris pH 6,8 0,25 mL 10 % SDS 20 ΜL 10 % APS 20 ΜL ΜL TEMED 2</td>
			<td></td>
		</tr>
<tr>
<td>15 % SDS Trennung gel</td>
			<td colspan="2">
 Für 10 mL: DdH2O 2,3 mL 30 % Acrylamid-Bisacrylamide (37.5:1) 5 mL 1.5 M Tris pH 8,8 2,5 mL 10 % SDS 100 ΜL 10 % APS 100 ΜL TEMED 4 ΜL</td>
			<td></td>
		</tr>
<tr>
<td>1 x SDS laufenden Puffer</td>
			<td colspan="2">
 25 mM Tris 192 mM Glycin 0,1 % SDS</td>
			<td></td>
		</tr>
<tr>
<td>Coomassie Färbelösung</td>
			<td colspan="2">
 5 % (w/V) Aluminiumsulfat-(14-18)-Hydrat 10 % (V/V) Ethanol (96 %) 2 % (V/V) Orthophosphorsäure Säure (85 %) 0,02 % (w/V) Coomassie Brilliant Blue G-250 
			 </td>
			<td></td>
		</tr>
<tr>
<td>ULTRAhyb Gromer Hybridisierung Puffer</td>
			<td colspan="2"></td>
			<td>AMBION, Life Technologies</td>
		</tr>
</tbody></table>Tabelle 2: Lösungen und Puffer Rezepte. Liste aller Puffer und Lösungen für 3D-PAGE-Analyse erforderlich.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Nein zu erkennen.</td>
			<td>MW OBS [kDa].</td>
			<td colspan="2">Identifikation</td>
			<td>Organismus</td>
			<td>Den Beitritt nein.</td>
			<td>MW [kDa]</td>
			<td>Maskottchen-Partitur</td>
		</tr>
<tr>
<td>CIV_1</td>
			<td>130</td>
			<td colspan="2">Vermeintliche Krankheit Widerstand Protein At4g19050</td>
			<td>B. napus</td>
			<td>CDX78917</td>
			<td>131.1</td>
			<td>110</td>
		</tr>
<tr>
<td>CIV_2</td>
			<td>130</td>
			<td colspan="2">Vermeintliche Krankheit Widerstand Protein At4g19050</td>
			<td>B. napus</td>
			<td>CDX78917</td>
			<td>131.1</td>
			<td>89</td>
		</tr>
<tr>
<td>CIV_3</td>
			<td>100</td>
			<td colspan="2">Heat shock 70 kDa-Protein 14-wie</td>
			<td>B. napus</td>
			<td>XP_013748865</td>
			<td>89,9</td>
			<td>113</td>
		</tr>
<tr>
<td>CIV_4</td>
			<td>90</td>
			<td colspan="2">Eukaryotische Dehnung Faktor 2 Zellteilung Steuern Protein 48 Homolog A</td>
			<td>B. napus B. napus</td>
			<td>CDX90241 CDY41316.1</td>
			<td>89,5 89,5</td>
			<td>111 197</td>
		</tr>
<tr>
<td>CIV_5</td>
			<td>85</td>
			<td colspan="2">Heat shock Protein 90-2-like</td>
			<td>B. rapa</td>
			<td>XP_009132342</td>
			<td>79,8</td>
			<td>172</td>
		</tr>
<tr>
<td>CIV_6</td>
			<td>80</td>
			<td colspan="2">Threonin--tRNA-ligase Glycin - tRNA-ligase</td>
			<td>B. oleracea B. napus</td>
			<td>XP_013599115 CDY43195</td>
			<td>81,5 80,8</td>
			<td>110 88</td>
		</tr>
<tr>
<td>CIV_7</td>
			<td>70</td>
			<td colspan="2">Heat Shock Protein 70 kDa Lysin - tRNA Ligase-wie</td>
			<td>B. oleracea B. napus</td>
			<td>XP_013685267 XP_013747530</td>
			<td>67,8 69,9</td>
			<td>230 150</td>
		</tr>
<tr>
<td>CIV_8</td>
			<td>65</td>
			<td colspan="2">Myrosinase Aspartate--tRNA-Ligase 2 Asparagin - tRNA Ligase 1</td>
			<td>B. napus B. napus B. napus</td>
			<td>ABQ42337 XP_013670803 XP_013729126</td>
			<td>60,6 61,6 63,5</td>
			<td>183 141 153</td>
		</tr>
<tr>
<td>CIV_9</td>
			<td>60</td>
			<td colspan="2">Myrosinase</td>
			<td>B. napus</td>
			<td>ABQ42337</td>
			<td>60,6</td>
			<td>164</td>
		</tr>
<tr>
<td>CIV_10</td>
			<td>55</td>
			<td colspan="2">Adenosylhomocysteinase 2-wie</td>
			<td>B. rapa</td>
			<td>XP_009135865</td>
			<td>53.1</td>
			<td>139</td>
		</tr>
<tr>
<td>CIV_11</td>
			<td>55</td>
			<td colspan="2">Dehnung Faktor 1-Alpha 1-wie</td>
			<td>B. oleracea</td>
			<td>XP_013586115</td>
			<td>51,9</td>
			<td>161</td>
		</tr>
<tr>
<td>CIV_12</td>
			<td>50</td>
			<td colspan="2">Cystin-Lyase CORI3-wie</td>
			<td>B. napus</td>
			<td>XP_013653143</td>
			<td>48,1</td>
			<td>237</td>
		</tr>
<tr>
<td>CIV_13</td>
			<td>44</td>
			<td colspan="2">Cystin-Lyase CORI3-wie</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48,3</td>
			<td>213</td>
		</tr>
<tr>
<td>CIV_14</td>
			<td>38</td>
			<td colspan="2">Fruktose-Bisphosphate aldolase</td>
			<td>B. rapa</td>
			<td>XP_009115993</td>
			<td>38,4</td>
			<td>226</td>
		</tr>
<tr>
<td>CIV_15</td>
			<td>45</td>
			<td colspan="2">Cystin-Lyase CORI3-wie</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48,3</td>
			<td>219</td>
		</tr>
<tr>
<td>CIV_16</td>
			<td>45</td>
			<td colspan="2">Cystin Lyase CORI3</td>
			<td>B. rapa</td>
			<td>CDY69765</td>
			<td>46,9</td>
			<td>209</td>
		</tr>
<tr>
<td>CIV_17</td>
			<td>38</td>
			<td colspan="2">Fruktose-Bisphosphate aldolase</td>
			<td>B. rapa</td>
			<td>XP_009115993</td>
			<td>38,4</td>
			<td>124</td>
		</tr>
<tr>
<td>CIV_18</td>
			<td>18</td>
			<td colspan="2">Peptidyl-Prolyl-Cis-Trans-Isomerase CYP18-3-like</td>
			<td>B. napus</td>
			<td>XP_009101932</td>
			<td>18.3</td>
			<td>128</td>
		</tr>
<tr>
<td>CIV_19</td>
			<td>45</td>
			<td colspan="2">Cystin-Lyase CORI3-wie</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48,3</td>
			<td>177</td>
		</tr>
</tbody></table>Tabelle 3: identifiziert Proteinkomponenten aus Komplex IV. Mehrere tRNA Ligases und weitere Proteine der tRNA verbindliche Anlage gefunden wurden mittels MALDI-TOF Masse spektrometrische Analyse nach 3D-Seite.

Watch this Scientific Journal Video about Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes at JoVE.com

Phloemsaftprobenahme aus Brassica napus für die 3D-PAGE von Protein- und Ribonukleoproteinkomplexen | Biologie | Video

Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

Phloem Sap Probenahme aus Brassica Napus für 3D-Seite von Protein und Ribonucleoprotein komplexe

Hier präsentieren wir ein Protokoll, um die Proteinzusammensetzung von großen native Protein: Protein und Protein zu analysieren: Nukleinsäure-komplexe aus Raps (B. Napus) Phloem Exsudat mit einem 3D Polyacrylamid-Gel-Elektrophorese (PAGE) Ansatz kombiniert blau Native (BN) mit zwei denaturierenden Seiten gefolgt von massenspektrometrische Identifizierung.

Sampling the phloem of higher plants is often laborious and significantly dependent on the plant species. However, proteome studies under denaturing ...

phloem-sap-sampling-from-brassica-napus-for-3d-page-protein

Research

Education

JoVE Journal

JoVE Core

Biology

Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

Fundamentals

Macromolecules

SCIENTISTS IN ACTION

13.8K Aufrufe.  Universität Hamburg. Hier präsentieren wir ein Protokoll, um die Proteinzusammensetzung von großen native Protein: Protein und Protein zu analysieren: Nukleinsäure-komplexe aus Raps (B. Napus) Phloem Exsudat mit einem 3D Polyacrylamid-Gel-Elektrophorese (PAGE) Ansatz kombiniert blau Native (BN) mit zwei denaturierenden Seiten gefolgt von massenspektrometrische Identifizierung.

Serie: Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

Transcript and Metabolite Profiling for the Evaluation of Tobacco Tree and Poplar as Feedstock for the Bio-based Industry

The global demand for food, feed, energy, and water poses extraordinary challenges for future generations. It is evident that robust platforms for the exploration of renewable resources are necessary to overcome these challenges. Within the multinational framework MultiBioPro we are developing biorefinery pipelines to maximize the use of plant biomass. More specifically, we use poplar and tobacco tree (Nicotiana glauca) as target crop species for improving saccharification, isoprenoid, long chain hydrocarbon contents, fiber quality, and suberin and lignin contents. The methods used to obtain these outputs include GC-MS, LC-MS and RNA sequencing platforms. The metabolite pipelines are well established tools to generate these types of data, but also have the limitations in that only well characterized metabolites can be used. The deep sequencing will allow us to include all transcripts present during the developmental stages of the tobacco tree leaf, but has to be mapped back to the sequence of Nicotiana tabacum. With these set-ups, we aim at a basic understanding for underlying processes and at establishing an industrial framework to exploit the outcomes. In a more long term perspective, we believe that data generated here will provide means for a sustainable biorefinery process using poplar and tobacco tree as raw material. To date the basal level of metabolites in the samples have been analyzed and the protocols utilized are provided in this article.

Plant biomass offers a renewable resource for multiple products, including fuel, feed, food, and a variety of materials. In this paper we investigate the properties of tobacco tree (Nicotiana glauca) and poplar as suitable sources for a biorefinery pipeline.

Transcript und Metabolite Profiling für die Beurteilung von Tabakbaum und Pappel als Rohstoff für die Bio-basierte Industrie

The global demand for food, feed, energy, and water poses extraordinary challenges for future generations. It is evident that robust platforms for the ...

Forschung

Umwelt

An Efficient Method for the Isolation of Highly Purified RNA from Seeds for Use in Quantitative Transcriptome Analysis

Plant seeds accumulate large amounts of storage reserves comprising biodegradable organic matter. Humans rely on seed storage reserves for food and as industrial materials. Gene expression profiles are powerful tools for investigating metabolic regulation in plant cells. Therefore, detailed, accurate gene expression profiles during seed development are required for crop breeding. Acquiring highly purified RNA is essential for producing these profiles. Efficient methods are needed to isolate highly purified RNA from seeds. Here, we describe a method for isolating RNA from seeds containing large amounts of oils, proteins, and polyphenols, which have inhibitory effects on high-purity RNA isolation. Our method enables highly purified RNA to be obtained from seeds without the use of phenol, chloroform, or additional processes for RNA purification. This method is applicable to Arabidopsis, rapeseed, and soybean seeds. Our method will be useful for monitoring the expression patterns of low level transcripts in developing and mature seeds.

We have succeeded in establishing a method for RNA isolation from plant seeds containing large amounts of oils, proteins, and polyphenols, which have inhibitory effects on high-purity RNA isolation. Our method is suitable for monitoring the expression of genes with low level transcripts in seeds.

Eine effiziente Methode zur Isolierung von Highly Purified RNA aus Samen für die Verwendung in Quantitative Transkriptomanalyse

Plant seeds accumulate large amounts of storage reserves comprising biodegradable organic matter. Humans rely on seed storage reserves for food and as ...

Biochemie

mRNA Interactome Capture from Plant Protoplasts

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional gene regulation (PTGR) of messenger RNAs (mRNAs). In the past few years, a number of mRNA-bound proteomes from yeast and mammalian cell lines have been successfully isolated through the use of a novel method called &#34;mRNA interactome capture,&#34; which allows for the identification of mRNA-binding proteins (mRBPs) directly from a physiological environment. The method is composed of in vivo ultraviolet (UV) crosslinking, pull-down and purification of messenger ribonucleoprotein complexes (mRNPs) by oligo(dT) beads, and the subsequent identification of the crosslinked proteins by mass spectrometry (MS). Very recently, by applying the same method, several plant mRNA-bound proteomes have been reported simultaneously from different Arabidopsis tissue sources: etiolated seedlings, leaf tissue, leaf mesophyll protoplasts, and cultured root cells. Here, we present the optimized mRNA interactome capture method for Arabidopsis thaliana leaf mesophyll protoplasts, a cell type that serves as a versatile tool for experiments that include various cellular assays. The conditions for optimal protein yield include the amount of starting tissue and the duration of UV irradiation. In the mRNA-bound proteome obtained from a medium-scale experiment (107 cells), RBPs noted to have RNA-binding capacity were found to be overrepresented, and many novel RBPs were identified. The experiment can be scaled up (109 cells), and the optimized method can be applied to other plant cell types and species to broadly isolate, catalog, and compare mRNA-bound proteomes in plants.

Here, we present an interactome capture protocol applied to Arabidopsis thaliana leaf mesophyll protoplasts. This method critically relies on in vivo UV crosslinking and allows for the isolation and identification of plant mRNA-binding proteins from a physiological environment.

MRNA Interactome Capture aus Pflanzenprotoplasten

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the disordered and protease labile C-terminus of the protein. This manuscript describes the methods to purify recombinant Nsa1 from S. cerevisiae for structural analysis by both X-ray crystallography and SAXS. X-ray crystallography was utilized to solve the structure of the well-ordered N-terminal WD40 domain of Nsa1, and then SAXS was used to resolve the structure of the C-terminus of Nsa1 in solution. Solution scattering data was collected from full-length Nsa1 in solution. The theoretical scattering amplitudes were calculated from the high-resolution crystal structure of the WD40 domain, and then a combination of rigid body and ab initio modeling revealed the C-terminus of Nsa1. Through this hybrid approach the quaternary structure of the entire protein was reconstructed. The methods presented here should be generally applicable for the hybrid structural determination of other proteins composed of a mix of structured and unstructured domains.

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

This method describes the cloning, expression, and purification of recombinant Nsa1 for structural determination by X-ray crystallography and small-angle X-ray scattering (SAXS), and is applicable for the hybrid structural analysis of other proteins containing both ordered and disordered domains.

Kombination von Röntgen-Kristallographie mit kleinen Winkel Röntgenstreuung, unstrukturierte Regionen der Nsa1 aus S. Cerevisiae zu modellieren

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the ...

Analysis of N-glycans from Raphanus sativus Cultivars Using PNGase H+

In recent years, the carbohydrate moieties of plants have received considerable attention, as they are a potential source of cross-reactive, allergy-provoking immune responses. In addition, carbohydrate structures also play a critical role in plant metabolism. Here, we present a simple and rapid method for preparing and analyzing N-glycans from different cultivars of radish (Raphanus sativus) using an N-glycanase specific for the release of plant-derived carbohydrate structures. To achieve this, crude trichloroacetic acid precipitates of radish homogenates were treated with PNGase H+, and labeled using 2-aminobenzamide as a fluorescent tag. The labeled N-glycan samples were subsequently analyzed by ultra performance liquid chromatography (UPLC) separation and matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry for a detailed structural evaluation and to quantify relative abundancies of the radish-derived N-glycan structures. This protocol can also be used for the analysis of N-glycans from various other plant species, and may be useful for further investigation of the function and effects of N-glycans on human health.

Analysis of N-glycans from Raphanus sativus Cultivars Using PNGase H+

We describe a simple and rapid method for the preparation and analysis of N-glycans from different cultivars of radish (Raphanus sativus).

Analyse der N- Glykane von Raphanus Sativus Sorten verwenden PNGase H+

In recent years, the carbohydrate moieties of plants have received considerable attention, as they are a potential source of cross-reactive, ...

Preparation of Fungal and Plant Materials for Structural Elucidation Using Dynamic Nuclear Polarization Solid-State NMR

This protocol shows how uniformly 13C, 15N-labeled fungal materials can be produced and how these soft materials should be proceeded for solid-state NMR and sensitivity-enhanced DNP experiments. The sample processing procedure of plant biomass is also detailed. This method allows the measurement of a series of 1D and 2D 13C-13C/15N correlations spectra, which enables high-resolution structural elucidation of complex biomaterials in their native state, with minimal perturbation. The isotope-labeling can be examined by quantifying the intensity in 1D spectra and the polarization transfer efficiency in 2D correlation spectra. The success of dynamic nuclear polarization (DNP) sample preparation can be evaluated by the sensitivity enhancement factor. Further experiments examining the structural aspects of the polysaccharides and proteins will lead to a model of the three-dimensional architecture. These methods can be modified and adapted to investigate a wide range of carbohydrate-rich materials, including the natural cell walls of plants, fungi, algae and bacteria, as well as synthesized or designed carbohydrate polymers and their complex with other molecules.

A protocol for preparing 13C,15N-labeled fungal and plant samples for multidimensional solid-state NMR spectroscopy and dynamic nuclear polarization (DNP) investigations is presented.

Vorbereitung von Pilz und Pflanze-Materialien für strukturelle Aufklärung mittels dynamischen atomare Polarisation Festkörper-NMR

This protocol shows how uniformly 13C, 15N-labeled fungal materials can be produced and how these soft materials should be proceeded for solid-state NMR ...

Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species

The high-throughput expression analysis technologies available today give scientists an overflow of expression profiles but their resolution in terms of tissue specific expression is limited because of problems in dissecting individual tissues. Expression data needs to be confirmed and complemented with expression patterns using e.g. in situ hybridization, a technique used to localize cell specific mRNA expression. The in situ hybridization method is laborious, time-consuming and often requires extensive optimization depending on species and tissue. In situ experiments are relatively more difficult to perform in woody species such as the conifer Norway spruce (Picea abies). Here we present a modified DIG in situ hybridization protocol, which is fast and applicable on a wide range of plant species including P. abies. With just a few adjustments, including altered RNase treatment and proteinase K concentration, we could use the protocol to study tissue specific expression of homologous genes in male reproductive organs of one gymnosperm and two angiosperm species; P. abies, Arabidopsis thaliana and Brassica napus. The protocol worked equally well for the species and genes studied. AtAP3 and BnAP3 were observed in second and third whorl floral organs in A. thaliana and B. napus and DAL13 in microsporophylls of male cones from P. abies. For P. abies the proteinase K concentration, used to permeablize the tissues, had to be increased to 3 g/ml instead of 1 g/ml, possibly due to more compact tissues and higher levels of phenolics and polysaccharides. For all species the RNase treatment was removed due to reduced signal strength without a corresponding increase in specificity. By comparing tissue specific expression patterns of homologous genes from both flowering plants and a coniferous tree we demonstrate that the DIG in situ protocol presented here, with only minute adjustments, can be applied to a wide range of plant species. Hence, the protocol avoids both extensive species specific optimization and the laborious use of radioactively labeled probes in favor of DIG labeled probes. We have chosen to illustrate the technically demanding steps of the protocol in our film.
Anna Karlgren and Jenny Carlsson contributed equally to this study.
Corresponding authors: Anna Karlgren at Anna.Karlgren@ebc.uu.se and Jens F. Sundstr&#246;m at Jens.Sundstrom@vbsg.slu.se

Non-radioactive in situ Hybridization Protocol Applicable for Norway Spruce and a Range of Plant Species

We describe a modified DIG in situ hybridization protocol, which is fast and applicable on a wide range of plant species including Norway spruce. With just a few adjustments, including altered RNase treatment and proteinase K concentration, the protocol may be used in studies of different tissues and species.

Nicht radioaktiv In situ Hybridisierung Protocol Einsetzbar für Fichte und einer Reihe von Pflanzenarten

The high-throughput expression analysis technologies available today give scientists an overflow of expression profiles but their resolution in terms of ...

Biologie

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based phosphoproteomics has transformed the way of studying plant signal transduction. However, requirement of lots of starting materials and prolonged MS measurement time to achieve the depth of coverage has been the limiting factor for the high throughput study of global phosphoproteomic changes in plants. To improve the sensitivity and throughput of plant phosphoproteomics, we have developed a stop and go extraction (stage) tip based phosphoproteomics approach coupled with Tandem Mass Tag (TMT) labeling for the rapid and comprehensive analysis of plant phosphorylation perturbation in response to osmotic stress. Leveraging the simplicity and high throughput of stage tip technique, the whole procedure takes approximately one hour using two tips to finish phosphopeptide enrichment, fractionation, and sample cleaning steps, suggesting an easy-to-use and high efficiency of the approach. This approach not only provides an in-depth plant phosphoproteomics analysis (&#62; 11,000 phosphopeptide identification) but also demonstrates the superior separation efficiency (&#60; 5% overlap) between adjacent fractions. Further, multiplexing has been achieved using TMT labeling to quantify the phosphoproteomic changes of wild-type and snrk2 decuple mutant plants. This approach has successfully been used to reveal the phosphorylation events of Raf-like kinases in response to osmotic stress, which sheds light on the understanding of early osmotic signaling in land plants.

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Presented here is a phosphoproteomic approach, namely stop and go extraction tip based phosphoproteomic, which provides high-throughput and deep coverage of Arabidopsis phosphoproteome. This approach delineates the overview of osmotic stress signaling in Arabidopsis.

Phosphoproteomic Strategie zur Profilierung osmotischer Stresssignalisierung bei Arabidopsis

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

Bezeichnung des Post-translationale Modifikationen von Pflanzenproteinkomplexe

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Collection and Analysis of Arabidopsis Phloem Exudates Using the EDTA-facilitated Method

The plant phloem is essential for the long-distance transport of (photo-) assimilates as well as of signals conveying biotic or abiotic stress. It contains sugars, amino acids, proteins, RNA, lipids and other metabolites. While there is a large interest in understanding the composition and function of the phloem, the role of many of these molecules and thus, their importance in plant development and stress response has yet to be determined. One barrier to phloem analysis lies in the fact that the phloem seals itself upon wounding. As a result, the number of plants from which phloem sap can be obtained is limited. One method that allows collection of phloem exudates from several plant species without added equipment is the EDTA-facilitated phloem exudate collection described here. While it is easy to use, it does lead to the wounding of cells and care has to be taken to remove contents of damaged cells. In addition, several controls to prove purity of the exudate are necessary. Because it is an exudation rather than a direct collection of the phloem sap (not possible in many species) only relative quantification of its contents can occur. The advantage of this method over others is that it can be used in many herbaceous or woody plant species (Perilla, Arabidopsis, poplar, etc.) and requires minimal equipment and training. It leads to reasonably large amounts of exudates that can be used for subsequent analysis of proteins, sugars, lipids, RNA, viruses and metabolites. It is simple enough that it can be used in both a research as well as in a teaching laboratory.

Collection and Analysis of Arabidopsis Phloem Exudates Using the EDTA-facilitated Method

Knowledge of the composition of the phloem sap as well as the mechanism of its loading and long-distance transport is essential for the understanding of long-distance signaling in plant development and stress/pathogen response and of assimilate transport. This manuscript describes the collection of phloem exudates using the EDTA-facilitated method.

Phloem Sap Probenahme aus Brassica Napus für 3D-Seite von Protein und Ribonucleoprotein komplexe

Zusammenfassung

Weitere Videos entdecken