Name: a fluorescence-based exonuclease assay to characterize dmwrnexo, orthologue of human progeroid wrn exonuclease, and its application to other nucleases
Uploaded: 2013-12-23T13:00:00
Description: Watch this Scientific Journal Video about A Fluorescence-based Exonuclease Assay to Characterize DmWRNexo, Orthologue of Human Progeroid WRN Exonuclease, and Its Application to Other Nucleases at JoVE

We thank the cross-council New Dynamics of Ageing Programme for funding this work [ES/G037086/1] and Prof Dave Sherratt (Department of Biochemistry, University of Oxford) for access to the Fuji FLA-3000.

1. Preparation of Substrate Oligonucleotides
<ol>
	<li>Synthesize custom oligonucleotides.
	<ol>
		<li>Design one single-stranded oligonucleotide with a 5&#39;-conjugated fluorescein molecule; this will be the backbone for every substrate. (Note that this is for a 3&#39;-5&#39; exonuclease; for a 5&#39;-3&#39; polarity exonuclease use a 3&#39;-conjugated backbone strand). If polarity is not known, both 3&#39; and 5&#39; should be tested.</li>
		<li>Design complementary strands such that when annealed to the fluorescent...

<ol>
	<li>Mason, P. A., Cox, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+DNA+exonucleases+in+protecting+genome+stability+and+their+impact+on+ageing.">The role of DNA exonucleases in protecting genome stability and their impact on ageing.</a> Age (Dordr. 34, 1317-1340 (2012).</li><li>Payne, M., Hickson, I. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+instability+and+cancer:+lessons+from+analysis+of+Bloom's+syndrome).">Genomic instability and cancer: lessons from analysis of Bloom's syndrome).</a> Biochem. Soc. Trans. 37, 553-559 (2009).</li><li>Yu, C. E., Oshima, J., Fu, Y. H., Wijsman, E. M., Hisama, F., Alisch, R., Matthews, S., Nakura, J., Miki, T., Ouais, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positional+cloning+of+the+Werner's+syndrome+gene.">Positional cloning of the Werner's syndrome gene.</a> Science. 272, 258-262 (1996).</li><li>Huang, S., Li, B., Gray, M. D., Oshima, J., Mian, I. S., Campisi, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+premature+ageing+syndrome+protein,+WRN,+is+a+3'--&gt;5'+exonuclease.">The premature ageing syndrome protein, WRN, is a 3'--&gt;5' exonuclease.</a> Nat. Genet. 20, 114-116 (1998).</li><li>Goto, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Syndrome-causing+mutations+in+Werner+syndrome.">Syndrome-causing mutations in Werner syndrome.</a> Biosci. Trends. 2, 147-150 (2008).</li><li>Perry, J. J., Yannone, S. M., Holden, L. G., Hitomi, C., Asaithamby, A., Han, S., Cooper, P. K., Chen, D. J., Tainer, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=WRN+exonuclease+structure+and+molecular+mechanism+imply+an+editing+role+in+DNA+end+processing.">WRN exonuclease structure and molecular mechanism imply an editing role in DNA end processing.</a> Nat. Struct. Mol. Biol. 13, 414-422 (2006).</li><li>Opresko, P. L., Laine, J. P., Brosh, R. M., Seidman, M. M., Bohr, V. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinate+action+of+the+helicase+and+3'+to+5'+exonuclease+of+Werner+syndrome+protein.">Coordinate action of the helicase and 3' to 5' exonuclease of Werner syndrome protein.</a> J. Biol. Chem. 276, 44677-44687 (2001).</li><li>Plchova, H., Hartung, F., Puchta, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+characterization+of+an+exonuclease+from+Arabidopsis+thaliana+reveals+similarities+to+the+DNA+exonuclease+of+the+human+Werner+syndrome+protein.">Biochemical characterization of an exonuclease from Arabidopsis thaliana reveals similarities to the DNA exonuclease of the human Werner syndrome protein.</a> J. Biol. Chem. 278, 44128-44138 (2003).</li><li>Hartung, F., Plchova, H., Puchta, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterisation+of+RecQ+homologues+in+Arabidopsis+thaliana.">Molecular characterisation of RecQ homologues in Arabidopsis thaliana.</a> Nucleic Acids Res. 28, 4275-4282 (2000).</li><li>Saunders, R. D., Boubriak, I., Clancy, D. J., Cox, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+a+Drosophila+ortholog+of+WRN+exonuclease+that+is+required+to+maintain+genome+integrity.">Identification and characterization of a Drosophila ortholog of WRN exonuclease that is required to maintain genome integrity.</a> Aging Cell. 7, 418-425 (2008).</li><li>Cox, L. S., Boubriak, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Instability+in+Premature+Aging,+in+DNA+Damage+Repair,+Repair+Mechanisms+and+Aging.">DNA Instability in Premature Aging, in DNA Damage Repair, Repair Mechanisms and Aging.</a> Thomas, A.E., Eds. Nova Science Publishers. , 1-34 (2010).</li><li>Cox, L. S., Clancy, D. J., Boubriak, I., Saunders, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+Werner+Syndrome+in+Drosophila+melanogaster:+hyper-recombination+in+flies+lacking+WRN-like+exonuclease.">Modeling Werner Syndrome in Drosophila melanogaster: hyper-recombination in flies lacking WRN-like exonuclease.</a> Ann. N.Y. Acad. Sci. 1119, 274-288 (2007).</li><li>Boubriak, I., Mason, P. A., Clancy, D. J., Dockray, J., Saunders, R. D., Cox, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DmWRNexo+is+a+3'-5'+exonuclease:+phenotypic+and+biochemical+characterization+of+mutants+of+the+Drosophila+orthologue+of+human+WRN+exonuclease.">DmWRNexo is a 3'-5' exonuclease: phenotypic and biochemical characterization of mutants of the Drosophila orthologue of human WRN exonuclease.</a> Biogerontology. 10, 267-277 (2009).</li><li>Mason, P. A., Boubriak, I., Robbins, T., Lasala, R., Saunders, R., Cox, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Drosophila+orthologue+of+progeroid+human+WRN+exonuclease,+DmWRNexo,+cleaves+replication+substrates+but+is+inhibited+by+uracil+or+abasic+sites+:+Analysis+of+DmWRNexo+activity+in+vitro.">The Drosophila orthologue of progeroid human WRN exonuclease, DmWRNexo, cleaves replication substrates but is inhibited by uracil or abasic sites : Analysis of DmWRNexo activity in vitro.</a> Age (Dordr). , (2012).</li><li>Machwe, A., Xiao, L., Orren, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Length-dependent+degradation+of+single-stranded+3'+ends+by+the+Werner+syndrome+protein+(WRN):+implications+for+spatial+orientation+and+coordinated+3'+to+5'+movement+of+its+ATPase/helicase+and+exonuclease+domains.">Length-dependent degradation of single-stranded 3' ends by the Werner syndrome protein (WRN): implications for spatial orientation and coordinated 3' to 5' movement of its ATPase/helicase and exonuclease domains.</a> BMC Mol. Biol. 7, 6 (2006).</li><li>Mangerich, A., Veith, S., Popp, O., Fahrer, J., Martello, R., Bohr, V. A., Burkle, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+WRN+exonuclease+activity+by+isotope+dilution+mass+spectrometry.">Quantitative analysis of WRN exonuclease activity by isotope dilution mass spectrometry.</a> Mech. Ageing Dev. 133, 575-579 (2012).</li><li>Xue, Y., Ratcliff, G. C., Wang, H., Davis-Searles, P. R., Gray, M. D., Erie, D. A., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+minimal+exonuclease+domain+of+WRN+forms+a+hexamer+on+DNA+and+possesses+both+3'-+5'+exonuclease+and+5'-protruding+strand+endonuclease+activities.">A minimal exonuclease domain of WRN forms a hexamer on DNA and possesses both 3'- 5' exonuclease and 5'-protruding strand endonuclease activities.</a> Biochemistry. 41, 2901-2912 (2002).</li><li>Machwe, A., Ganunis, R., Bohr, V. A., Orren, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+blockage+of+the+3'--&gt;5'+exonuclease+activity+of+WRN+protein+by+certain+oxidative+modifications+and+bulky+lesions+in+DNA.">Selective blockage of the 3'--&gt;5' exonuclease activity of WRN protein by certain oxidative modifications and bulky lesions in DNA.</a> Nucleic Acids Res. 28, 2762-2770 (2000).</li></ol>

Determination of exonuclease activity of purified proteins requires the analysis of DNA cleavage products. Sequential cleavage of DNA by exonucleases can be visualized by separation of labeled cleavage products on acrylamide gels. Historically this involved end-labeling of the DNA substrate with a radiolabel (e.g. 32P or 35S), but with the disadvantages inherent in use of radiolabel (cost, safety issues, and instability over time). To overcome these problems, we have developed an exonucleas...

Nucleases serve a vital role in cells in removing damaged DNA, resolving nonduplex structures such as Holliday junctions and providing proof-reading capacity during DNA replication, both intrinsic within DNA polymerases and extrinsic to them1. Nucleases can act either by sequentially degrading DNA from free ends (exonucleases) or by cleaving internal phosphodiester bonds within a longer DNA molecule (endonucleases). Loss of nuclease activity can result in highly specific genome instability phenotypes. While mutation of the RecQ helicase family member BLM result in excessively high rates of sister chromatid exchange and globally elevated cancer rates (reviewed byPayne and Hickson2), mutation of the highly related WRN protein leads to premature aging3; the major significant difference between these two family members is the presence of a 3&#39;-5&#39; exonuclease domain with in WRN4. Evidence of a critical role of the WRN exonuclease in maintaining genome stability has accumulated from analysis of genotypes in WS patients5, together with point mutation and deletion studies in human cells, backed by crystallographic studies of the isolated exonuclease domain6. However, cooperation and cross talk between WRN&#39;s exonuclease activity and its central helicase activity7 makes it difficult to tease apart the functionality of each and their relative contributions to genome stability. In plants and lower metazoan animals, WRN exonuclease activity is present on a single polypeptide lacking helicase activity8-10 (reviewed in&#160;Cox and Boubriak11); it has been demonstrated biochemically in Arabidopsis that this exonuclease acts coordinately with the cognate WRN helicase, effectively reconstituting the combined enzyme activities observed in vertebrate WRN9. We have studied WRN exonuclease in Drosophila since the excellent genetic tools allow analysis of the impact of exonuclease mutation (without impacting on the presumptive cognate helicase) at the whole organism level and through development10,12. Moreover, we have cloned, expressed, and purified recombinant Drosophila WRN exonuclease (DmWRNexo) allowing full biochemical analysis of its enzyme properties13,14.
Nuclease analysis in vitro has traditionally been conducted using radiolabeled oligonucleotides, assessing degradation by looking for laddering of products on acrylamide gels4,8,15. While sensitive, such assays are not quantitatively reproducible day-to-day because of radioactive decay of the labeled substrates. Additionally, handling and disposal of radioactive reagents pose significant environmental and health issues; sourcing of radiolabel is also becoming increasingly problematic. An alternative recent method assesses the amount of the final degradation product by mass spectrometry16. However, it is time consuming (taking several days), requires specialized equipment, and the readout is the amount of end product (single nucleotide) so is not suitable for sensitive measurement of aspects such as enzyme processivity or for determining whether some nucleotides, sequences, or modifications lead to nuclease pausing or halt. To overcome these problems, we have adapted the traditional gel-based assays for use with fluorescent oligonucleotide substrates, generating stably labeled substrates that can be used reproducibly over long time periods and thus allow direct comparison of nuclease activities under different conditions.

<table border="1">
	<tbody>
		<tr>
			<td></td>
			<td></td>
			<td width="10%"></td>
			<td>Reagent/Material</td>
		</tr>
		<tr>
			<td>Custom oligonucleotides</td>
			<td>Eurogentec</td>
			<td></td>
			<td>It is necessary to obtain these at high purity e.g. with PAGE purification.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>5&#39;FLO</td>
			<td>fluoresescein-5&#39; GAACTATGGCTCTC 
			GAGTGCTAGGACATGTCTGA 
			CTACGTACAAGTCACC - 3&#39;</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>bubble</td>
			<td>5&#39;- GGTGACTTGTACGT 
			AGTCAGACATGTCCTAGCAC 
			TCGAGAGCCATAGTTC-3&#39;</td>
		</tr>
		<tr>
			<td>40% 19:1 Acrylamide solution</td>
			<td>Severn Biotech</td>
			<td>20-2400-05</td>
			<td>CAUTION: potent neurotoxin so gloves should be worn at all times</td>
		</tr>
		<tr>
			<td>His-Trap columns (1 ml)</td>
			<td>GE Healthcare</td>
			<td>17-5247-01</td>
			<td></td>
		</tr>
		<tr>
			<td>All other reagents</td>
			<td>any reputable supplier</td>
			<td></td>
			<td>Molecular biology grade is necessary (DNase-free); microfuge tubes similarly should be DNase- and RNase-free</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td>Equipment</td>
		</tr>
		<tr>
			<td>Hoefer SE400 gel apparatus</td>
			<td>Hoefer</td>
			<td>SE400-15-1.5</td>
			<td></td>
		</tr>
		<tr>
			<td>FLA-3000 (phosphor and fluorescence imager)</td>
			<td>Fuji</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Image Reader V2.02</td>
			<td>FujiFilm</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Image Gauge V3.3</td>
			<td>FujiFilm</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a fluorescence-based exonuclease assay to characterize dmwrnexo, orthologue of human progeroid wrn exonuclease, and its application to other nucleases

WRN exonuclease is involved in resolving DNA damage that occurs either during DNA replication or following exposure to endogenous or exogenous genotoxins. It is likely to play a role in preventing accumulation of recombinogenic intermediates that would otherwise accumulate at transiently stalled replication forks, consistent with a hyper-recombinant phenotype of cells lacking WRN. In humans, the exonuclease domain comprises an N-terminal portion of a much larger protein that also possesses helicase activity, together with additional sites important for DNA and protein interaction. By contrast, in Drosophila, the exonuclease activity of WRN (DmWRNexo) is encoded by a distinct genetic locus from the presumptive helicase, allowing biochemical (and genetic) dissection of the role of the exonuclease activity in genome stability mechanisms. Here, we demonstrate a fluorescent method to determine WRN exonuclease activity using purified recombinant DmWRNexo and end-labeled fluorescent oligonucleotides. This system allows greater reproducibility than radioactive assays as the substrate oligonucleotides remain stable for months, and provides a safer and relatively rapid method for detailed analysis of nuclease activity, permitting determination of nuclease polarity, processivity, and substrate preferences.

Performing in vitro analysis of exonuclease activity requires a number of preparatory steps in addition to the actual analysis. An overview of the procedures is shown in Figure 1. 
Prior to conducting fluorescence-based exonuclease assays, it is critical to optimize detection of the fluorescently labeled oligonucleotide substrate following separation on urea-acrylamide gels using a suitable fluorescence imaging system. Filter choice is extremely important as this can ...

Watch this Scientific Journal Video about A Fluorescence-based Exonuclease Assay to Characterize DmWRNexo, Orthologue of Human Progeroid WRN Exonuclease, and Its Application to Other Nucleases at JoVE

A Fluorescence-based Exonuclease Assay to Characterize DmWRNexo, Orthologue of Human Progeroid WRN Exonuclease, and Its Application to Other Nucleases

Exonucleases play critical roles in ensuring genome stability. Loss of WRN exonuclease function results in premature aging. Studying substrates and other requirements of the nuclease in vitro can help elucidate its role in vivo. Here we demonstrate a rapid and reproducible fluorescence-based assay to measure its nuclease activity.

WRN exonuclease is involved in resolving DNA damage that occurs either during DNA replication or following exposure to endogenous or exogenous genotoxins. ...

a-fluorescence-based-exonuclease-assay-to-characterize-dmwrnexo

Research

JoVE Journal

Biology

The Ladder Rung Walking Task: A Scoring System and its Practical Application.

Progress in the development of animal models for/stroke, spinal cord injury, and other neurodegenerative disease requires tests of high sensitivity to elaborate distinct aspects of motor function and to determine even subtle loss of movement capacity. To enhance efficacy and resolution of testing, tests should permit qualitative and quantitative measures of motor function and be sensitive to changes in performance during recovery periods. The present study describes a new task to assess skilled walking in the rat to measure both forelimb and hindlimb function at the same time. Animals are required to walk along a horizontal ladder on which the spacing of the rungs is variable and is periodically changed. Changes in rung spacing prevent animals from learning the absolute and relative location of the rungs and so minimize the ability of the animals to compensate for impairments through learning. In addition, changing the spacing between the rungs allows the test to be used repeatedly in long-term studies. Methods are described for both quantitative and qualitative description of both fore- and hindlimb performance, including limb placing, stepping, co-ordination. Furthermore, use of compensatory strategies is indicated by missteps or compensatory steps in response to another limb&#x2019;s misplacement. 

The ladder rung walking task is a new test to assess skilled walking and measure both forelimb and hindlimb placing, stepping, and inter-limb co-ordination.

Progress in the development of animal models for/stroke, spinal cord injury, and other neurodegenerative disease requires tests of high sensitivity to ...

Chromatin Immunoprecipitation (ChIP) to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

In response to a variety of extracellular ligands, the STAT (signal transducer and activator of transcription) transcription factors are rapidly recruited from their latent state in the cytoplasm to cell surface receptors where they are activated by phosphorylation at a single tyrosine residue1. They then dimerize and translocate to the nucleus to drive the transcription of target genes, affecting growth, differentiation, homeostasis and the immune response. Not surprisingly, given their widespread involvement in normal cell processes, dysregulation of STAT function contributes to human disease, particularly to cancers2 and autoimmune diseases3. It is well established that transcription is regulated by alterations to the chromatin template4,5. These alterations include the activities of ATP-dependent complexes, as well as covalent histone modifications and DNA methylation6. Because STAT activation of gene expression is both rapid and transient, it requires specific mechanisms for modulating the chromatin template at STAT-dependent gene loci. To define these mechanisms, we characterize the histone modifications and the enzymatic activities that generate them at gene loci that respond to STAT signaling. This protocol describes chromatin immunoprecipitation, a method that is valuable for the study of STAT signaling to chromatin in activated gene expression.

Chromatin Immunoprecipitation ChIP to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

This protocol describes how chromatin immunoprecipitation (ChIP) is used to study the dynamic alterations to the chromatin template that regulate transcription induced by a signal transduction pathway.

In response to a variety of extracellular ligands, the STAT (signal transducer and activator of transcription) transcription factors are rapidly recruited ...

An Allele-specific Gene Expression Assay to Test the Functional Basis of Genetic Associations

The number of significant genetic associations with common complex traits is constantly increasing. However, most of these associations have not been understood at molecular level. One of the mechanisms mediating the effect of DNA variants on phenotypes is gene expression, which has been shown to be particularly relevant for complex traits1.
This method tests in a cellular context the effect of specific DNA sequences on gene expression. The principle is to measure the relative abundance of transcripts arising from the two alleles of a gene, analysing cells which carry one copy of the DNA sequences associated with disease (the risk variants)2,3. Therefore, the cells used for this method should meet two fundamental genotypic requirements: they have to be heterozygous both for DNA risk variants and for DNA markers, typically coding polymorphisms, which can distinguish transcripts based on their chromosomal origin (Figure 1). DNA risk variants and DNA markers do not need to have the same allele frequency but the phase (haplotypic) relationship of the genetic markers needs to be understood. It is also important to choose cell types which express the gene of interest. This protocol refers specifically to the procedure adopted to extract nucleic acids from fibroblasts but the method is equally applicable to other cells types including primary cells.
DNA and RNA are extracted from the selected cell lines and cDNA is generated. DNA and cDNA are analysed with a primer extension assay, designed to target the coding DNA markers4. The primer extension assay is carried out using the MassARRAY (Sequenom)5 platform according to the manufacturer's specifications. Primer extension products are then analysed by matrix-assisted laser desorption/ionization time of-flight mass spectrometry (MALDI-TOF/MS). Because the selected markers are heterozygous they will generate two peaks on the MS profiles. The area of each peak is proportional to the transcript abundance and can be measured with a function of the MassARRAY Typer software to generate an allelic ratio (allele 1: allele 2) calculation. The allelic ratio obtained for cDNA is normalized using that measured from genomic DNA, where the allelic ratio is expected to be 1:1 to correct for technical artifacts. Markers with a normalised allelic ratio significantly different to 1 indicate that the amount of transcript generated from the two chromosomes in the same cell is different, suggesting that the DNA variants associated with the phenotype have an effect on gene expression. Experimental controls should be used to confirm the results.

Genetic associations often remain unexplained at a functional level. This method aims to assess the effect of phenotype-associated genetic markers on gene expression by analyzing cells heterozygous for transcribed SNPs. The technology allows accurate measurement by MALDI-TOF mass spectrometry to quantify allele-specific primer extension products.

The number of significant genetic associations with common complex traits is constantly increasing. However, most of these associations have not been ...

Reconstruction of 3-Dimensional Histology Volume and its Application to Study Mouse Mammary Glands

Histology volume reconstruction facilitates the study of 3D shape and volume change of an organ at the level of macrostructures made up of cells. It can also be used to investigate and validate novel techniques and algorithms in volumetric medical imaging and therapies. Creating 3D high-resolution atlases of different organs1,2,3 is another application of histology volume reconstruction. This provides a resource for investigating tissue structures and the spatial relationship between various cellular features. We present an image registration approach for histology volume reconstruction, which uses a set of optical blockface images. The reconstructed histology volume represents a reliable shape of the processed specimen with no propagated post-processing registration error. The Hematoxylin and Eosin (H&#38;E) stained sections of two mouse mammary glands were registered to their corresponding blockface images using boundary points extracted from the edges of the specimen in histology and blockface images. The accuracy of the registration was visually evaluated. The alignment of the macrostructures of the mammary glands was also visually assessed at high resolution.
This study delineates the different steps of this image registration pipeline, ranging from excision of the mammary gland through to 3D histology volume reconstruction. While 2D histology images reveal the structural differences between pairs of sections, 3D histology volume provides the ability to visualize the differences in shape and volume of the mammary glands.

We present an image registration approach for 3-dimensional (3D) histology volume reconstruction, which facilitates the study of the changes of an organ at the level of macrostructures made up of cells . Using this approach, we studied the 3D changes between wild-type and Igfbp7-null mammary glands.

Histology volume reconstruction facilitates the study of 3D shape and volume change of an organ at the level of macrostructures made up of cells. It can ...

Characterization of G Protein-coupled Receptors by a Fluorescence-based Calcium Mobilization Assay

For more than 20 years, reverse pharmacology has been the preeminent strategy to discover the activating ligands of orphan G protein-coupled receptors (GPCRs). The onset of a reverse pharmacology assay is the cloning and subsequent transfection of a GPCR of interest in a cellular expression system. The heterologous expressed receptor is then challenged with a compound library of candidate ligands to identify the receptor-activating ligand(s). Receptor activation can be assessed by measuring changes in concentration of second messenger reporter molecules, like calcium or cAMP. The fluorescence-based calcium mobilization assay described here is a frequently used medium-throughput reverse pharmacology assay. The orphan GPCR is transiently expressed in human embryonic kidney 293T (HEK293T) cells and a promiscuous G&#945;16 construct is co-transfected. Following ligand binding, activation of the G&#945;16 subunit induces the release of calcium from the endoplasmic reticulum. Prior to ligand screening, the receptor-expressing cells are loaded with a fluorescent calcium indicator, Fluo-4 acetoxymethyl. The fluorescent signal of Fluo-4 is negligible in cells under resting conditions, but can be amplified more than a 100-fold upon the interaction with calcium ions that are released after receptor activation. The described technique does not require the time-consuming establishment of stably transfected cell lines in which the transfected genetic material is integrated into the host cell genome. Instead, a transient transfection, generating temporary expression of the target gene, is sufficient to perform the screening assay. The setup allows medium-throughput screening of hundreds of compounds. Co-transfection of the promiscuous G&#945;16, which couples to most GPCRs, allows the intracellular signaling pathway to be redirected towards the release of calcium, regardless of the native signaling pathway in endogenous settings. The HEK293T cells are easy to handle and have proven their efficacy throughout the years in receptor deorphanization assays. However, optimization of the assay for specific receptors may remain necessary.

The here described fluorescence-based calcium mobilization assay is a medium-throughput reverse pharmacology screening system for the identification of functionally activating ligand(s) of orphan G protein-coupled receptors (GPCRs).

For more than 20 years, reverse pharmacology has been the preeminent strategy to discover the activating ligands of orphan G protein-coupled receptors ...

A Method for Selecting Structure-switching Aptamers Applied to a Colorimetric Gold Nanoparticle Assay

Small molecules provide rich targets for biosensing applications due to their physiological implications as biomarkers of various aspects of human health and performance. Nucleic acid aptamers have been increasingly applied as recognition elements on biosensor platforms, but selecting aptamers toward small molecule targets requires special design considerations. This work describes modification and critical steps of a method designed to select structure-switching aptamers to small molecule targets. Binding sequences from a DNA library hybridized to complementary DNA capture probes on magnetic beads are separated from nonbinders via a target-induced change in conformation. This method is advantageous because sequences binding the support matrix (beads) will not be further amplified, and it does not require immobilization of the target molecule. However, the melting temperature of the capture probe and library is kept at or slightly above RT, such that sequences that dehybridize based on thermodynamics will also be present in the supernatant solution. This effectively limits the partitioning efficiency (ability to separate target binding sequences from nonbinders), and therefore many selection rounds will be required to remove background sequences. The reported method differs from previous structure-switching aptamer selections due to implementation of negative selection steps, simplified enrichment monitoring, and extension of the length of the capture probe following selection enrichment to provide enhanced stringency. The selected structure-switching aptamers are advantageous in a gold nanoparticle assay platform that reports the presence of a target molecule by the conformational change of the aptamer. The gold nanoparticle assay was applied because it provides a simple, rapid colorimetric readout that is beneficial in a clinical or deployed environment. Design and optimization considerations are presented for the assay as proof-of-principle work in buffer to provide a foundation for further extension of the work toward small molecule biosensing in physiological fluids.

A protocol is provided to select structure-switching aptamers for small molecule targets based on a tunable stringency magnetic bead selection method. Aptamers selected with structure-switching properties are beneficial for assays that require a conformational change to signal the presence of a target, such as the described gold nanoparticle assay.

Small molecules provide rich targets for biosensing applications due to their physiological implications as biomarkers of various aspects of human health ...

Using Digital Image Correlation to Characterize Local Strains on Vascular Tissue Specimens

Characterization of the mechanical behavior of biological and engineered soft tissues is a central component of fundamental biomedical research and product development. Stress-strain relationships are typically obtained from mechanical testing data to enable comparative assessment among samples and in some cases identification of constitutive mechanical properties. However, errors may be introduced through the use of average strain measures, as significant heterogeneity in the strain field may result from geometrical non-uniformity of the sample and stress concentrations induced by mounting/gripping of soft tissues within the test system. When strain field heterogeneity is significant, accurate assessment of the sample mechanical response requires measurement of local strains. This study demonstrates a novel biomechanical testing protocol for calculating local surface strains using a mechanical testing device coupled with a high resolution camera and a digital image correlation technique. A series of sample surface images are acquired and then analyzed to quantify the local surface strain of a vascular tissue specimen subjected to ramped uniaxial loading. This approach can improve accuracy in experimental vascular biomechanics and has potential for broader use among other native soft tissues, engineered soft tissues, and soft hydrogel/polymeric materials. In the video, we demonstrate how to set up the system components and perform a complete experiment on native vascular tissue.

We describe the use of digital image correlation to characterize the local surface strain field on vascular tissue samples subjected to uniaxial tensile testing. These measurements facilitate precise quantification of the sample mechanical response and the generation of constitutive stress-strain relations.

Characterization of the mechanical behavior of biological and engineered soft tissues is a central component of fundamental biomedical research and ...

Targeted RNA Sequencing Assay to Characterize Gene Expression and Genomic Alterations

RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding RNAs. Standard RNAseq requires 30 - 100 million sequencing reads and can include multiple RNA products such as mRNA and noncoding RNAs. We demonstrate how targeted RNAseq (capture) permits a focused study on selected RNA products using a desktop sequencer. RNAseq capture can characterize unannotated, low, or transiently expressed transcripts that may otherwise be missed using traditional RNAseq methods. Here we describe the extraction of RNA from cell lines, ribosomal RNA depletion, cDNA synthesis, preparation of barcoded libraries, hybridization and capture of targeted transcripts and multiplex sequencing on a desktop sequencer. We also outline the computational analysis pipeline, which includes quality control assessment, alignment, fusion detection, gene expression quantification and identification of single nucleotide variants. This assay allows for targeted transcript sequencing to characterize gene expression, gene fusions, and mutations.

We describe a targeted RNA sequencing-based method that includes preparation of indexed cDNA libraries, hybridization and capture with custom probes and data analysis to interrogate selected transcripts for gene expression, mutations, and gene fusions. Targeted RNAseq permits cost-effective, rapid evaluation of selected transcripts on a desktop sequencer.

RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding ...

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain (RTA) Trafficking in Yeast

Bacterial and plant A/B toxins exploit the natural trafficking pathways in eukaryotic cells to reach their intracellular target(s) in the cytosol and to ultimately kill. Such A/B toxins generally consist of an enzymatically active Asubunit (e.g., ricin toxin A (RTA)) and one or more cell binding Bsubunit(s), which are responsible for toxin binding to specific cell surface receptors. Our current knowledge of how A/B toxins are capable of efficiently intoxicating cells helped scientists to understand fundamental cellular mechanisms, like endocytosis and intracellular protein sorting in higher eukaryotic cells. From a medical point of view, it is likewise important to identify the major toxin trafficking routes to find adequate treatment solutions for patients or to eventually develop therapeutic toxin-based applications for cancer therapy.
Since genome-wide analyses of A/B toxin trafficking in mammalian cells is complex, time-consuming, and expensive, several studies on A/B toxin transport have been performed in the yeast model organism Saccharomyces cerevisiae. Despite being less complex, fundamental cellular processes in yeast and higher eukaryotic cells are similar and very often results obtained in yeast can be transferred to the mammalian situation.
Here, we describe a fast and easy to use reporter assay to analyze the intracellular trafficking of RTA in yeast. An essential advantage of the new assay is the opportunity to investigate not only RTA retro-translocation from the endoplasmic reticulum (ER) into the cytosol, but rather endocytosis and retrograde toxin transport from the plasma membrane into the ER. The assay makes use of a reporter plasmid that allows indirect measurement of RTA toxicity through fluorescence emission of the green fluorescent protein (GFP) after in vivo translation. Since RTA efficiently prevents the initiation of protein biosynthesis by 28S rRNA depurination, this assay allows the identification of host cell proteins involved in intracellular RTA transport through the detection of changes in fluorescence emission.

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain RTA Trafficking in Yeast

In the manuscript, we describe the use of a yeast-based fluorescence reporter assay to identify cellular components involved in the trafficking and killing processes of the cytotoxic A subunit of the plant toxin ricin (RTA).

Bacterial and plant A/B toxins exploit the natural trafficking pathways in eukaryotic cells to reach their intracellular target(s) in the cytosol and to ...

Diagonal Method to Measure Synergy Among Any Number of Drugs

A synergistic drug combination has a higher efficacy compared to the effects of individual drugs. Checkerboard assays, where drugs are combined in many doses, allow sensitive measurement of drug interactions. However, these assays are costly and do not scale well for measuring interaction among many drugs. Several recent studies have reported drug interaction measurements using a diagonal sampling of the traditional checkerboard assay. This alternative methodology greatly decreases the cost of drug interaction experiments and allows interaction measurement for combinations with many drugs. Here, we describe a protocol to measure the three pairwise interactions and one three-way interaction among three antibiotics in duplicate, in five days, using only three 96-well microplates and standard laboratory equipment. We present representative results showing that the three-antibiotic combination of Levofloxacin + Nalidixic Acid + Penicillin G is synergistic. Our protocol scales up to measure interactions among many drugs and in other biological contexts, allowing for efficient screens for multi-drug synergies against pathogens and tumors.

In this protocol, we describe how to make Loewe additivity-based drug interaction measurements for pairwise and three-way drug combinations.

A synergistic drug combination has a higher efficacy compared to the effects of individual drugs. Checkerboard assays, where drugs are combined in many ...