Nos gustaría dar las gracias a Monika Tarnowska, Cornelia Albrecht, y Ewa Skoczylas por su excelente asistencia técnica. Este estudio fue financiado por SNF Sinergia subvención CRSI33-125073 al PP.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

Los autores declaran no tener conflictos de intereses.

Genoma enfoques edición nucleasa impulsada diseño han ampliado considerablemente la gama de especies susceptibles de modificaciones específicas de sus respectivos genomas 10,12. En ratones, el gen de la orientación en células madre embrionarias ha sido una técnica estándar para más de dos décadas; sin embargo, ha demostrado ser difícil de adaptar a las células madre embrionarias de especies distintas de la del ratón, aunque ha habido algunos éxitos recientes en ratas células madre embrionarias. Incluso con la disponibilidad de &quot;off-the-shelf&quot; clones de células madre embrionarias de ratón con genes dirigidos proporcionadas por consorcios como EUCOMM, KOMP o NorCOMM 3 edición genoma por ZFN y TALEN proporciona mayor precisión y flexibilidad en cuanto al espectro de las modificaciones que pueden ser introducido en el genoma de ratón. Los animales fundadores que llevan mutaciones nucleasa mediada parecen ser altamente línea germinal competente 4-6,20,21, que no es siempre el caso para quimeras procedentes de inyecciones de blastocistos de células ES. Por lo tanto, en ciertos casos la microinyección de desnucleasas igner pueden dar lugar a significativamente más rápida generación de líneas novedosas de ratón con modificaciones del genoma específicas. La generación exitosa de ratones knockout por inyección de ZFN y TALEN depende en gran medida de la actividad de la nucleasa par inyectado. Talens han demostrado tener una alta tasa de éxito en la selección de una amplia gama de genes en un número de organismos; Sin embargo, estudios recientes sugieren que TALEN unión es sensible a la metilación de citosina 30,31. Por lo tanto, los pares de nucleasa recién generadas, por ejemplo Talens clonó en vectores de pCAG-T7, pueden ser transfectadas transitoriamente en una línea celular de ratón, tales como NIH-3T3 o Neuro -2a, que imitan el estado de la cromatina del embrión de ratón en cierta medida. Aquí, la actividad nucleasa puede estimarse utilizando el ensayo de T7 endonucleasa o un compendio de restricción de productos PCR como se describe en la sección 5 antes de la síntesis de ARNm y microinyección. Recomendamos secuenciación de la región genómica de interés en el respetoive línea celular y la cepa de ratón utilizada para experimentos de microinyección. En cigotos de ratón, diferentes pares TALEN o ZFN trabajarán de manera óptima a diferentes concentraciones de ARNm y por lo tanto la concentración de trabajo óptima del ARNm nucleasa microinyectados pueden tener que ser determinado experimentalmente. Dependiendo del par nucleasa, una concentración demasiado baja dará lugar a ninguna escisión, mientras que demasiado alto puede dar lugar a la letalidad embrionaria. Dependiendo del par nucleasa, hemos tenido éxito en el uso total de las concentraciones de ARNm tan bajas como 2 ng / l y tan alto como 200 mg / ul. Estos efectos son difíciles de predecir a partir de experimentos en cultivo de células y la concentración óptima de nucleasa tanto para la supervivencia del embrión y la velocidad de modificación del locus diana tiene que ser determinado empíricamente. ZFN de gran actividad o TALEN pueden escindir su secuencia objetivo más allá de la fase de una célula del embrión microinyectado y por lo tanto causar patrones complejos de una mutagénesisd mosaicismo en fundadores. Nosotros y otros 4 han observado tres o más alelos mutados distintos en un único fundador (Figura 5C). Por lo tanto, al establecer una nueva línea de ratón a partir de estos fundadores, la descendencia deben ser examinadas cuidadosamente mediante la secuenciación de la presencia de la mutación favorable ya que los ensayos de digestión proporcionan evidencia de que sólo una mutación sin definir está presente. Una de las críticas con frecuencia expresaron en contra de los sistemas de ZFN y TALEN es la posibilidad de que estas nucleasas también son capaces de escindir secuencias presentes en otro lugar en el genoma que son similares a los sitios diana. Tales fuera de objetivo efectos se han observado con reactivos de primera generación utilizando el dominio FokI homodimérica y construcciones heterodímero fueron diseñados para aliviar fuera de objetivo efectos 25. Sitios fuera de objetivo potencial se pueden predecir en cierta medida en silico 32,33 y se cribaron por PCR y secuenciación. Una ventaja obvia Of utilizando ZFNs y Talens para generar los ratones en lugar de líneas celulares es la posibilidad de eliminar de las mutaciones de destino no ligados a la modificación del genoma deseada mediante la realización de varios retrocruzamientos a una cepa de tipo salvaje de la elección. Para el análisis de un gran número de ratones fundadores, de próxima generación profunda secuenciación de los productos PCR generados a partir del locus nucleasa específica y en silico predichos desviado loci podría ofrecer una lectura cualitativa y cuantitativa alternativa a los ensayos de digestión de productos de PCR. Las técnicas de reproducción asistida que se describen en este protocolo se optimizan para las cepas de ratón estándar utilizados para experimentos de microinyección como C57Bl/6J o B6D2F1. Los ratones de diferentes orígenes, como las cepas no consanguínea, pueden, en principio, se utilizarán para las aproximaciones de edición del genoma y podrían proporcionar una base genética más adecuado para las preguntas de investigación específicas. El rendimiento de las técnicas de reproducción asistida como la superovulación puede ser predicadocted para un número de cepas de 34-36 pero podría requerir una mayor optimización para las cepas no estándar con el fin de obtener un número suficiente de embriones para microinyección nucleasa. Además ZFN y TALEN, nuevos nucleasas de diseñadores como el sistema CRISPR/Cas9 ARN guiada 9,37,38 ahora se han introducido para aplicaciones de edición de genoma. Todos los métodos para la microinyección y análisis de animales fundadores descritos aquí son también aplicables a CRISPR/Cas9 y futuras modos de edición genoma.

Los ratones son, con mucho, la plataforma más popular para la generación de modelos animales transgénicos. La caja de herramientas versátiles para la ingeniería genética del embrión de ratón 1-3 se ha extendido recientemente por los enfoques de edición del genoma basado en las nucleasas de diseñadores como nucleasas de dedos de zinc (ZFN) 4-6, nucleasas activador de transcripción efectoras (Talen) 7,8, y las repeticiones agrupadas interspaced regularmente cortas palindrómicas (CRISPR) / sistema CRISPR-asociado (CAS) 9 9. ZFN y función TALEN como pares de dos dominios de diseño personalizado a base de proteínas de unión al ADN (arrays de proteínas dedo de zinc y repetir variables di-residuos (RVDS), respectivamente) que están acoplados cada uno a la endonucleasa FokI 10-12. Por el contrario, la especificidad de la escisión de ADN mediada por Cas9 es proporcionado por transactivación de ARN de CRISPR (crRNA y tracrRNA, que también se pueden combinar en una sola molécula de ARN quimérico de ARN denominado guía) 11 que actúan en un complejo con laProteína CRISPR. Talens una secuencia definida de RVDS se puede construir rápidamente por experimentadores individuales con una multitud de estrategias de montaje para elegir 13-17. CRISPR/Cas9 promete aún menor generación de mano de obra de las nucleasas de diseño, sin embargo, la especificidad de la guía de ARN-ADN vinculante aún no se resuelve por completo 18,19. Generación de ZFNs personalizados hasta ahora se ha limitado a laboratorios académicos especializados y proveedores comerciales tales como Sangamo Biosciences y el servicio Sigma CompoZr. En general, el genoma edición con nucleasas de diseño tiene como objetivo la introducción de la línea se rompe dobles (OSD) en loci genómica definida, el cual posteriormente atraer fin homóloga (NHEJ) o recombinación homóloga (HR) los mecanismos de reparación del ADN 10,12. La reparación mediada por NHEJ de un OSD a menudo resulta en la introducción de inserciones y deleciones en estrecha proximidad al sitio de la reparación. Por lo tanto la reparación NHEJ cun ser explotados para la anulación de la función de un gen diana mediante la introducción de una mutación de cambio de marco en el genes de codificación de proteínas secuencia 4,7,9. Alternativamente, la adición o sustitución de la información genética definida se puede lograr proporcionando un donante de ADN junto con las nucleasas de diseño. Un donante de ADN comprende secuencias de ADN investigador-diseñado flanqueadas por regiones de homología con el locus diana, por lo que sirve como una plantilla para la reparación de DSB por HR. Ambos plásmidos 5,6,20 y oligonucleótidos monocatenarios 8,9,21 se han utilizado con éxito como donantes. Ni NHEJ-ni de edición genoma HR-mediada requieren la introducción de un marcador seleccionable en el genoma del embrión del ratón, lo que hace que estas estrategias particularmente bien adaptado para la creación de pequeñas alteraciones en la secuencia de nucleótidos sin afectar a la arquitectura genética general. En este protocolo se describen todos los procedimientos esenciales para su edición en el genomaembrión de ratón utilizando Talens. Estos incluyen: 1) la identificación de un sitio de destino TALEN 22, 2) la construcción de Talens por clonación golden gate 13, 3) la síntesis in vitro de mRNA TALEN, 4) la microinyección de ARNm TALEN en oocitos fertilizados de ratón, 5) los procedimientos quirúrgicos para la transferencia de embriones , y 6) análisis de mutagénesis inducida por TALEN en animales fundadores. Nos centramos en TALEN mRNA microinyección y la detección de los fundadores de inducidos NHEJ inserciones / supresiones. Con este fin hemos generado construcciones bifuncionales TALEN que permiten tanto la expresión en células de mamífero cuando se transfecta como plásmidos y en la síntesis in vitro de ARNm TALEN para la microinyección en embriones de ratón. Estos constructos comprenden una cadena principal CUENTO truncada 23 fusionado a heterodimérica FokI dominios de 24,25 para la edición genoma óptima en células de mamífero. Este protocolo también puede ser adoptado para la microinyección de otras nucleasas de diseño o para preparaciones inyectables combinados de nucleasas diseñadory construcciones de donantes (diseño de los donantes de ADN ha sido descrito en publicaciones técnicas excelentes por Wefers et al. 26,27). Declaración de Ética Todos los experimentos con animales se realizaron de acuerdo con las directrices y reglamentos de la Oficina Veterinaria Cantonal del Cantón de Zurich.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

Los ratones transgénicos que llevan modificaciones específicas del sitio del genoma (knockout, knock-in) son de vital importancia para la disección de los sistemas biológicos complejos, así como para la modelización de enfermedades humanas y probar estrategias terapéuticas. Los recientes avances en el uso de las nucleasas de diseño tales como nucleasas de dedos de zinc (ZFNs), transcripción nucleasas efectoras del tipo activador (Talens) y los agrupados interspaced regularmente repeticiones palindrómicas cortas (CRISPR) / sistema CRISPR-asociado (CAS) 9 para el sitio- la ingeniería del genoma específico abierta la posibilidad de realizar la modificación del genoma centrada y urgente en prácticamente cualquier especie de laboratorio sin la necesidad de depender de la tecnología de células madre embrionarias (ES). Un experimento de edición genoma normalmente comienza con la identificación de diseño de nucleasa sitios diana dentro de un gen de interés seguido por la construcción de los dominios de unión a ADN personalizadas para dirigir la actividad de nucleasa para el locus genómico investigador-definido. Plásmidos de nucleasa Designer son in vitro &lt;/ Em&gt; transcrita para generar ARNm para la microinyección de los ovocitos de ratón fertilizados. Aquí, ofrecemos un protocolo para el logro de modificación del genoma dirigida por inyección directa de TALEN mRNA en ovocitos de ratón fertilizados.

Hemos construido plásmidos de destino compatible con el conjunto de oro GateTALEN publicado por Cermak et al. 13 que permiten la expresión de talens en células de mamífero, así como in vitro la síntesis de ARNm a partir del promotor del fago T7 (Figura 1C). Estos plásmidos llevan dominios FokI heterodiméricas (mutaciones ELD o KKR) que han sido mostrados para reducir fuera de objetivo efectos relativos a homodímeros FokI y para mejorar la actividad de escisión en comparación con la primera generación FokI heterodímeros 25,29. Reacciones de montaje de puerta de oro # 1 y # 2 son por lo general muy eficiente y cada colonia blanco, cuando se analiza por PCR de colonias, muestra el patrón esperado para el número particular de RVDS clonados (Figuras 1B y 1D). Análisis en gel de ARNm sintetizado in vitro (Figura 2) debe revelar una sola banda distinguibles con poco o nada de frotis para cada muestra analizada. Debe haber un cambio de tamaño claramente entre muestras L1/R1 y L2/R2, L3/R3, lo que indica poliadenilación éxito. Los animales fundadores pueden ser examinados para alelos mutados inducidas-NHEJ utilizando PCR genotipo seguido de digestión con endonucleasas de T7 (Figura 3) o una digestión de restricción usando una enzima que escinde la secuencia de tipo salvaje dentro de la región espaciadora del par de nucleasa (Figura 4). El ensayo de T7 endonucleasa es aplicable a cualquier tipo de mutación, independientemente de la secuencia genómica específica dentro de la región espaciadora del par nucleasa inyectado; sin embargo, sólo detecta desajustes entre las hebras de ADN en los productos de PCR heterodúplex. Así, en el raro caso de que uno de los fundadores lleva dos alelos mutados de forma idéntica, los productos PCR se no mostrar ningún patrón de digestión T7. Tal distinción es, sin embargo, siempre es posible cuando un sitio de restricción específica se encuentra dentro de la región espaciadora nucleasa que se elimina por NHEJInducida inserciones / supresiones (Figura 5). Aquí, las bandas no digeridas indican la presencia de mutaciones, y la ausencia de cualquiera de los productos digeridos sugiere fuertemente un fundador llevar a mutaciones en ambos alelos del gen diana (marcadas con asteriscos en la Figura 4b). <img alt="Figura 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> Figura 1. Golden Gate clonación de Talen RVDS en vectores pCAG-T7-Destination heterodímeras. A) Asamblea de arrays RVD en vectores UFP. Aquí se muestra un ejemplo de un par TALEN con matrices CUENTO individuales que comprende 15 RVDS y 17 RVDS, respectivamente (para matrices CUENTO más de 21 RVDS, se requieren tres UFP-RVDS asambleas, no se muestra). Las flechas indican cebadores para pfus específica reacciones de PCR colonia. B) Los productos de PCRamplificado a partir de conjuntos de pfus correctas típicamente muestran una banda correspondiente a la longitud combinada de todos los RVDS clonados (por ejemplo, alrededor de 1,1 kb para RVDS 10) y una &quot;escalera&quot; de pequeñas bandas menos prominentes debido a la naturaleza repetitiva de matrices de RVD. C) El montaje final de arrays pfus-RVD y un plásmido que contiene la última repetición (PLR) en vectores de expresión heterodímeras Talen con FokIELD y FokIKKR variantes, respectivamente. La columna vertebral TALEN (anotado como N y C) se asemeja a la arquitectura publicado por Miller et al. 23 El CAG (CMV elemento potenciador temprano / pollo beta-actina) promotor asegura altos niveles de expresión en células de mamífero transfectadas, mientras que el promotor del fago T7 permite en la síntesis de ARNm in vitro (SacI utilizar para la linealización del vector de aguas abajo del codón STOP nucleasa). D) PCR de colonias usando cebadores indicados por las flechas en C) permite la identificación de ensamblado correctamente Talens. Full-lengtproductos h PCR suelen ser menos prominente, mientras que el &quot;efecto escalera&quot; representa un sólido indicador de reunión exitosa. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">Haga clic aquí para ver la imagen más grande</a> . <img alt="Figura 2" fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> Figura 2. . Control de calidad de ARNm de nucleasa en la síntesis in vitro usando electroforesis en gel de agarosa ARNm ZFN se muestra como un ejemplo (L, izquierda ZFN, R, ZFN derecha). Muestras L1/R1 muestran ARNm antes de poliadenilación, muestras L2/R2 espectáculo polyadenylated mRNA y L3/R3 muestran mRNA poliadenilado purificado. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">Haga clic aquí para ver la imagen más grande</a> . <img<html> alt = &quot;Figura 3&quot; fo: content-width = &quot;6 pulgadas&quot; fo: src = &quot;/ files/ftp_upload/50930/50930fig3highres.jpg&quot; src = &quot;/ files/ftp_upload/50930/50930fig3.jpg&quot; width = &quot;600&quot; /&gt; Figura 3. Ejemplo de un ensayo de T7 endonucleasa utilizado para la identificación de animales fundadores que llevan las mutaciones inducidas por nucleasa-de el locus diana. A) Un par TALEN fue diseñado para romper dentro de la región codificante del gen de la proteína del prión del ratón (Prnp, secuencia diana TALEN pueden ser disponibles bajo petición). Un producto de la PCR se genera usando un cebador directo (F) situado 110 pb aguas arriba y un cebador inverso (R) 250 pb aguas abajo del sitio de escisión TALEN. B) El producto de PCR posteriormente se somete a la formación de heterodúplex y T7 digestión con endonucleasas. C) mutagénesis inducida por TALEN dentro de la región genómica específica de los fundadores individuales se revela por la presencia de un producto de PCR de longitud completa con productos de digestión de 250 y 110 pb.50930/50930fig3highres.jpg &quot;target =&quot; _blank &quot;&gt; Haga clic aquí para ver la imagen más grande. <img alt="Figura 4" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> Figura 4. Ejemplo de un digesto de restricción de productos de PCR utilizados para la identificación de animales fundadores que llevan las mutaciones inducidas por nucleasa-de el locus diana. ZFN específicas para el locus de ratón Rosa26 29 diana un sitio de restricción XbaI en el intrón 1.) Fundadores A fueron seleccionadas por PCR genotipo utilizando un cebador directo (F) situado 500 pb aguas arriba y un cebador inverso (R) 250 pb aguas abajo del sitio de escisión. B) La digestión de los productos de PCR con XbaI revela patrones de digestión que indican ratones con mutaciones bi-alélicas (marcados con asteriscos), mono -alélicas mutaciones (bandas digeridos y no digeridos, por ejemplo, animales 2)y los ratones wt (digestión completa, por ejemplo, los animales 21.) C) La secuenciación de los ratones con posibles modificaciones bi-alélica muestra un máximo de 3 (24 animales) distintas inserciones / supresiones. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">Haga clic aquí para ver la imagen más grande</a> . <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Nombre de la cartilla </td><td> Secuencia 5 &#39;a 3&#39; </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr><tr><td> TAL_Seq_5-1 </td><td> catcgcgcaatgcactgac </td></tr></tbody></table> Tabla 1. Las secuencias de los primers utilizados para la PCR de colonias y secuenciación dentro del conjunto de la puerta de oro TALENprotocolo. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Plásmido / Colección </td><td> Contribuyente </td><td> Addgene ID </td><td> Comentarios </td></tr><tr><td> Golden Gate TALEN y TAL Efector Kit 2.0 </td><td> Laboratorio Voytas </td><td> 1000000024 </td><td> Contiene todos los plásmidos necesarios para el montaje de la puerta de oro TALEN </td></tr><tr><td> destino vectores pCAG-T7-TALEN -KKR/ELD </td><td> Laboratorio Pelczar </td><td> 40131, 40132 </td><td> Add-on plásmidos para la expresión TALEN en células de mamíferos y en la síntesis de ARNm vitro </td></tr></tbody></table> Tabla 2. Plásmidos y colecciones de plásmidos requeridos para el montaje de puerta de oro TALEN se pueden obtener de Addgene ( <a href="http://www.addgene.org">www.addgene.org</a> ). <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> OnlineRecurso </td><td> Comentarios </td></tr><tr><td> http://tale-nt.cac.cornell.edu </td><td> Diseño de TALEN; TALEN predicción fuera del objetivo </td></tr><tr><td> http://zifit.partners.org/ZiFiT/ </td><td> Diseño de TALEN, OPEN ZFN, CoDA ZFN, CRISPR/Cas9 </td></tr><tr><td> http://www.genome-engineering.org </td><td> Diseño de TALEN, CRISPR/Cas9; CRISPR/Cas9 fuera del objetivo de predicción </td></tr><tr><td> http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html </td><td> Asamblea de TALEN secuencias para la confirmación de los resultados de secuenciación </td></tr><tr><td> http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html </td><td> Diseño de montaje modular ZFN </td></tr><tr><td> www.genomecenter.ucdavis.edu/s egallab / segallabsoftware </td><td> Diseño de montaje modular ZFN </td></tr></tbody></table> Tabla 3. Recursos en línea para diseñar ZFN, TALEN y CRISPR/Cas9. </strong&gt;

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

Nucleasas de diseñadores como nucleasas de dedos de zinc (ZFNs) y transcripción nucleasas efectoras del tipo activador (Talens) se pueden utilizar para modificar el genoma de preimplantación de embriones de ratones mediante la activación de ambos al final no homóloga (NHEJ) y recombinación homóloga (HR) itinerarios. Estos avances permiten la rápida generación de ratones con modificaciones genéticas precisas.

Del genoma del ratón Ingeniería Utilizando Nucleasas Designer

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

mouse-genome-engineering-using-designer-nucleases

Research

JoVE Journal

Biology

28.6K vistas.  University of Zurich.  Nucleasas de diseñadores como nucleasas de dedos de zinc (ZFNs) y transcripción nucleasas efectoras del tipo activador (Talens) se pueden utilizar para modificar el genoma de preimplantación de embriones de ratones mediante la activación de ambos al final no homóloga (NHEJ) y recombinación homóloga (HR) itinerarios. Estos avances permiten la rápida generación de ratones con modificaciones genéticas precisas. 

Video: Mouse Genome Engineering Using Designer Nucleases

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

La disección fina y gruesa de los epitelios sensoriales del oído interno en adultos de pez cebra ( Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Investigación

Biología

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

Ingeniería penetran en las células de proteínas

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Genome-wide Analysis of Aminoacylation (Charging) Levels of tRNA Using Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both prokaryotic and eukaryotic cells lead to translational regulation which is a major cellular mechanism of stress response. Familiar examples are the stringent response in E. coli and the Gcn2 stress response pathway in yeast ([2-6]). Recent work in E. coli and S. cerevisiae have shown that tRNA charging patterns are highly dynamic and depends on the type of stress experienced by cells [1, 6, 7]. The highly dynamic, variable nature of tRNA charging makes it essential to determine changes in tRNA charging levels at the genomic scale, in order to fully elucidate cellular response to environmental variations. In this review we present a method for simultaneously measuring the relative charging levels of all tRNAs in S. cerevisiae . While the protocol presented here is for yeast, this protocol has been successfully applied for determining relative charging levels in a wide variety of organisms including E. coli and human cell cultures[7, 8].

Genome-wide Analysis of Aminoacylation Charging Levels of tRNA Using Microarrays

We describe a method for microarray analysis to determine relative aminoacylation levels of all tRNAs from S. cerivisiae.

Todo el genoma análisis de Aminoacilación (de carga) Niveles de tRNA utilizando microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both ...

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Análisis de todo el genoma con chip para identificar objetivos específicos para cada isoforma Gene

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Human cancer and response to therapy is better represented in orthotopic animal models. This paper describes the development of an orthotopic mouse model of ovarian cancer, treatment of cancer via oral delivery of drugs, and monitoring of tumor cell behavior in response to drug treatment in real time using in vivo imaging system. In this orthotopic model, ovarian tumor cells expressing luciferase are applied topically by injecting them directly into the mouse bursa where each ovary is enclosed. Upon injection of D-luciferin, a substrate of firefly luciferase, luciferase-expressing cells generate bioluminescence signals. This signal is detected by the in vivo imaging system and allows for a non-invasive means of monitoring tumor growth, distribution, and regression in individual animals. Drug administration via oral gavage allows for a maximum dosing volume of 10 mL/kg body weight to be delivered directly to the stomach and closely resembles delivery of drugs in clinical treatments. Therefore, techniques described here, development of an orthotopic mouse model of ovarian cancer, oral delivery of drugs, and in vivo imaging, are useful for better understanding of human ovarian cancer and treatment and will improve targeting this disease.

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Orthotopic animal models of ovarian cancer replicate better human disease and therefore enhance our understanding of cancer progression and tumor response to therapy. A mouse model receives an intrabursal injection of luciferase-expressing ovarian tumor cells. Treatment is administered via oral gavage. Tumor growth is monitored by in vivo imaging system.

En vivo de imágenes y tratamientos terapéuticos en un modelo de ratón ortotópico de cáncer de ovario

Human cancer and response to therapy is better represented in orthotopic animal models.  This paper describes the development of an orthotopic mouse model ...

Flow Cytometry Purification of Mouse Meiotic Cells

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the unique differentiation programs that are manifest during meiosis. Two principal methods have been developed to purify, to varying degrees, various meiotic fractions from both adult and immature animals: elutriation or Staput (sedimentation) using BSA and/or percoll gradients. Both of these methods rely on cell size and density to separate meiotic cells1-5. Overall, except for few cell populations6, these protocols fail to yield sufficient purity of the numerous meiotic cell populations that are necessary for detailed molecular analyses. Moreover, with such methods usually one type of meiotic cells can be purified at a given time, which adds an extra level of complexity regarding the reproducibility and homogeneity when comparing meiotic cell samples.
Here, we describe a refined method that allows one to easily visualize, identify, and purify meiotic cells, from germ cells to round spermatids, using FACS combined with Hoechst 33342 staining7,8. This method provides an overall snapshot of the entire meiotic process and allows one to highly purify viable cells from most stage of meiosis. These purified cells can then be analyzed in detail for molecular changes that accompany progression through meiosis, for example changes in gene expression9,10and the dynamics of nucleosome occupancy at hotspots of meiotic recombination11.

An efficient method to obtain highly purified viable meiotic fractions from mouse testis is described, which combines a refined cell dissociation protocol with fluorescent activated cell sorting (FACS). This method takes advantage of differences in the DNA content and nuclear density of discrete meiotic fractions.

Citometría de flujo de purificación de las células de ratón meiótica

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

Genoma toda la pantalla de los genes miARN objetivos mediante el objetivo de la misión Carnet de identificación

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

Genoma Edición con CompoZr nucleasas de dedos de zinc personalizados (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

En Vivo Modelado del Genoma Humano Morbid usando Danio rerio

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

Edición genoma en<em&gt; Astyanax mexicanus</em&gt; Uso de transcripción activador de efector nucleasas (Talens)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...