JoVE Logo

Sign In

A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • תוצאות
  • Discussion
  • Disclosures
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

A protocol is described for isolating stably transfected melanoma cell clones using glass cylinders. We focus on practical advice that may be decisive for the success of the entire procedure.

Abstract

Cell populations that have stable changes in their genomic information are widely used by scientists as a research model. They do not require repeated cell transfection as it can lead to a heterogeneous cell population and variable transfection efficiency, affecting reproducibility. Moreover, they are preferable for large-scale analyses. The generation of stable cell clones is useful for a wide range of applications, such as research on gene functions and recombinant protein production. There are a few methods to obtain a homogenous cell population upon initial transient transfection. Here, we describe the isolation of single cell clones with glass cylinders. Although this method has been known for some time, there are a few crucial steps, and neglecting them may lead to failure. We have successfully used this method to obtain clones stably overexpressing a protein of interest (POI) or with knockout of a gene of interest (GOI). We describe preparation steps such as the optimization of selecting drug concentrations, preparation of glass cylinders, and validation of whether the obtained clones have the desired change in the expression of the GOI by PCR, western blot analysis, immunostaining, or gDNA sequencing (depending on the type of derived clones). We also discuss the phenotypic heterogeneity of well-established cell lines as this might be an issue in obtaining stable cell clones.

Introduction

Stable transfection of mammalian cells is a routinely used method in several cell culture applications, including cancer research. Its advantage over transient transfection is that the introduced foreign genetic material cannot be lost due to environmental factors (e.g., cell confluency or replication stage) and cell division because it is integrated into the genome of the host1. Development of stably expressing cell lines can be laborious and challenging, but if a sustained expression of genes is required over an extended period, derivation of stable cell lines is a preferred option. The most common aim of transfection is to study the functions of a specific gene or gene product by overproduction or downregulation of its expression. However, the production of recombinant proteins and genetic therapies also requires the introduction of foreign genetic material into the cell2.

A clone is defined as a cell population derived from one individual cell. The isolation of single cell clones is a crucial aspect of cell biology when studying cells with genotypic and phenotypic variability. Three major techniques are used for deriving cell clones: the dilution technique, cloning ring technique3, and cell sorting technique4. Each one has advantages and disadvantages. We provide a detailed description of a method for isolating melanoma cell clones using the glass cylinder technique. The advantage of this method is that the cells exhibit moderate clonal growth from cell cultures with low density. Moreover, the cells selected have already demonstrated proliferation capability because they have already formed colonies5. This procedure involves seeding transfected cells sparsely, but not at limiting dilution, into a large vessel and allowing them to expand and form colonies for 2-3 weeks in the presence of a selective antibiotic. The individual colonies can then be isolated using glass cylinders that are placed over the colonies and adhered to the vessel using silicone grease. Next, cells are detached with trypsin and then transferred to multiwell plates for further culture in the presence of a selective medium.

There are a number of studies describing the isolation of clones, but we focus on showing details such as the size that clones should be after 2 weeks of selection, how to mark the location of the clones during their isolation, and how to choose an appropriate concentration of antibiotic for the selection. We focus on practical advice that may be decisive for the success of the entire procedure. The presented protocol allows us to obtain stable cell clones within 2-4 weeks. The method is easy and cheap and does not require complicated equipment. We share a technique that has allowed us to obtain many research models, including GSN KO clones6,7,8.

Protocol

1. Cell subculture and seeding for drug concentration optimization

  1. Warm the cell culture medium (in this case, Dulbecco's modified Eagle's medium with a reduced concentration (1.5 g/L) of NaHCO3, 10% (v/v) fetal bovine serum (FBS), 1% (v/v) L-glutamine, and 1% (v/v) antibiotic-antimycotic) and trypsin solution in a water bath to 37 °C.
  2. Aspirate and discard the cell culture medium from the A735 cells growing in a T25 cell culture flask. The cell line is obtained from commercial sources.
  3. Wash out any remaining cell culture medium from the cells by washing the flask with 1 mL of trypsin or PBS solution.
  4. Aspirate and discard the trypsin or PBS solution from the cells.
  5. Add 1 mL of trypsin solution to the flask and incubate it at 37 °C. Carefully observe the detachment of the cells using an inverted microscope.
  6. Stop the trypsin activity by adding 3 mL of fresh complete cell culture medium and rinse the cell culture flask with it when cells detach.
  7. Transfer the cell suspension from the flask to a 15 mL centrifuge tube.
  8. Centrifuge the cells at 800 x g for 5 min at room temperature (RT).
  9. Aspirate and discard the supernatant.
  10. Resuspend cells in 1 mL of the fresh cell culture medium.
  11. To calculate the cell density, count the cells with an automatic cell counter or hemocytometer.
  12. Seed the appropriate number of cells in a culture dish of the appropriate size.
    NOTE: In this experiment, 450,000 cells of the A375 cell line were seeded in 2 mL of the cell culture medium in a 35 mm culture dish.

2. Optimization of selected drug concentration

  1. Find the manufacturer's recommended concentration range of the drug to be used to select stable cell clones.
    NOTE: A selection gene introduced into a cell by transfection with a genetic vector provides the cell with resistance to the selection drug. Puromycin at a concentration of 1 µg/mL was used as a selection marker to obtain stable expression of the genetic vector and eliminate untransfected cells.
  2. Seed the cells in the wells of a 96-well plate to reach 50% confluence on the next day. Prepare three wells for each drug concentration and an untreated control. Seed 10,000 cells per well. The cell number depends on the cell line being used and needs to be determined empirically.
  3. After 24 h, prepare 10 dilutions of the drug in the complete medium from the lowest to the highest concentration recommended by the manufacturer and add them to the cells.
    NOTE: In this case, puromycin was used. The concentration range was 0-10 µg/mL. Every 3 days, or when many dead cells are observed in the medium, change to fresh medium.
  4. Observe the cells daily for a week and make notes regarding their confluence, proliferation, and death with respect to the control plate.
    NOTE: An appropriate concentration is one at which cells stop proliferating and does not cause cell death immediately but kills all treated cells after 48-120 h. However, for some combinations of cell lines and drugs, there may not be a phase where cells stop proliferating but die. In such a situation, the lowest concentration of drug that kills all cells would be appropriate for selection.

3. Cell seeding and transfection

  1. Seed the cells in a well of a six-well plate.
    NOTE: The final volume of the cell suspension in the cell culture medium should be 2.5 mL. For this experiment 450,000 cells per well were seeded. The cell number needs to be determined empirically so that their confluence cannot exceed 90% after 48 h of seeding.
  2. Culture the cells at 37 °C in a humidified atmosphere containing 5% CO2 for 24 h.
    NOTE: Cells were cultivated for 24 h before transfection. However, 48 h after seeding, it was observed that the cells were transfected more efficiently.
  3. Aspirate and discard the cell culture medium above the cells.
  4. Replace the discarded medium with prewarmed antibiotic-free cell culture medium (10% (v/v) FBS, glutamine-supplemented DMEM).
    NOTE: The need for changing the cell culture medium is due to the increased cell permeability caused by some transfection reagents, which can cause an increased influx of antibiotics into the cells, resulting in cell death.
  5. Dilute transfection reagents in antibiotic- and serum-free DMEM. Use polyethyleneimine (PEI), lipid-based transfection reagent, or electroporation. For cell transfection, use 2 mg/mL polyethyleneimine solution at a weight ratio of 1:2.175 for 4 µg of DNA.
    NOTE: As a DNA solution, a mixture of two plasmids was used in the CRISPR/Cas9(D10A) system with the following gRNA sequences: 5'ccgggccgtgcagcaccgtg3' and 5'atccagctgcacggtaaaga3'.
  6. Incubate the transfection mixture for 30 min at RT.
  7. After incubation, carefully add the transfection mixture dropwise to the cells growing in the wells of a six-well plate.
  8. Culture the cells at 37 °C in a humidified atmosphere containing 5% CO2 for 2-6 h.
  9. Change the medium to the complete cell culture medium.
  10. Culture the cells at 37 °C in a humidified atmosphere containing 5% CO2 for the next 24 h.

4. Generation of cell clones

  1. Trypsinize and transfer the transfected cells into a 150 mm diameter culture dish with a 20 mm molded grid according to the instructions in section 1 of the protocol.
    NOTE: Due to the merging of the cells with each other in the case of high density, it is recommended that the cells be transferred evenly into two cell culture dishes. The grid on the culture dish helps locate clones and track their migration. On a printed dish plan, one can later mark the location of the clones (Figure 1B). In addition, for cells that do not tolerate removal of the medium and exposure to air (resulting in death/irreversible damage), it would be better to use more dishes with a smaller surface area to isolate fewer colonies from one dish. This could reduce the time of exposure to air during clone isolation and reduce the likelihood of cell dehydration.
  2. Culture the cells at 37 °C in a humidified atmosphere containing 5% CO2 for 24 h.
  3. Change the cell culture medium to a medium containing a selective antibiotic.
    NOTE: From this point on, it is important to culture the cells in the presence of a selective antibiotic; otherwise, there is a chance of cutting the integrated transgene out of the gene.
  4. Change the medium every 3 days or when there are many dead cells floating in the medium.
    NOTE: In this experiment, the cells were incubated with puromycin at a concentration of 1 µg/mL. The cell clone selection step takes approximately 2 weeks. The formation of clones should be monitored by observing their growth under an inverted microscope, because they should not grow and come into contact with neighboring cell clones. Cells from one colony cannot be prevented from migrating and growing with another colony. Therefore, it is important to observe the plate for cell migration from the clones and note the information about it on the dish plan.

5. Choosing the clones for isolation

  1. Examine the cell culture dish for cell clones under an inverted microscope with a 10x or 20x objective.
    NOTE: The clones are made up of approximately 500-30,000 cells. However, it depends on the cell line used. A satisfactory colony should be separated from other cell colonies and be of average size as very large and outstanding clones can arise from more than one cell (Figure 1B).
  2. Find a suitable colony using the inverted microscope by carefully examining the dish and assessing the clones found. Place the marker at the location of the selected clone with the marker on the dish underneath. Simultaneously, mark the colony localization on the printed dish plan (Figure 1B).
    NOTE: Approximately 20-30 colonies from the dish should be selected. Sometimes, fewer cell clones are obtained, and all of them should be isolated in such cases.

6. Preparation of glass cylinders

  1. Before isolation of the clones, place the glass cylinders (6.4 mm in diameter and 8 mm in height) (Figure 1C) in the first glass Petri dish and autoclave them.
  2. Autoclave the second glass Petri dish.
  3. Apply a thin layer of silicone grease to the bottom of the second autoclaved glass Petri dish. Place the dish under a laminar flow cabinet and apply UV light for 30 min to sterilize the silicone grease.
    NOTE: Optionally, the silicone grease can be autoclaved.
  4. Immerse the autoclaved cylinders in a silicone grease-coated Petri dish. Now they are ready to isolate the clones.
  5. After isolating the clones, clean the cylinders in accordance with the rules applicable to the cellular material with which they are handled. In the case of genetic modification, use sodium hypochlorite for sterilization.
  6. Wash the cylinders with xylene overnight to clear them of silicone grease.
  7. Wash the cylinders with deionized water under a chemical hood to remove the xylene solution.
  8. Put the cylinders on a paper towel and let them dry.
  9. Store the cylinders in a glass Petri dish.
  10. Prepare the cylinders before the next use, starting from point 1 of this manual.

7. Isolation of clones

  1. Prepare a 24-well plate containing 0.5 mL of prewarmed complete cell culture medium in each well.
  2. Carefully wash the transfected cells growing on a 150 mm dish three times with 15 mL of warm, sterile PBS. Carefully aspirate and discard the PBS.
  3. Use sterile tweezers to transfer cylinders that have grease on one side. Press the cylinders on the bottom of a culture dish at the sites of the marked clones to create isolated wells around the growing colonies of single-cell clone origin.
    NOTE: The cylinder should stick well to the bottom to prevent leakage of fluids.
  4. Add 50 µL of trypsin solution to each cylinder and incubate for a few minutes. Be careful not to damage the cells enzymatically. Process the colonies one by one. Remember to change the pipette tip for each cylinder so as not to contaminate the colonies with other ones.
    NOTE: The incubation time depends on the cell line being used and needs to be determined empirically. The trypsin solution can be pipetted up and down to facilitate cell detachment. Monitor cell detachment carefully using an inverted microscope. Following cell detachment, stop the trypsin activity by adding 50 µL of cell culture medium to each cylinder.
  5. Immediately transfer 100 µL of the cell suspension into the medium in one well of a 24-well plate.
    NOTE: Here, clone growth was continued with a selective antibiotic at a concentration of 0.5 µg/mL.
  6. Monitor the cell clones' growth in the 24-well plate, and when they reach 90% confluence, transfer them to a six-well plate. Follow the instructions in section 1 of the protocol; change only the volumes of trypsin (0.5 mL) and stopping medium (1.5 mL).
  7. Monitor the cell clones growing in a six-well plate, and when they reach confluence, transfer them to the T12.5 cell culture flask.
  8. Observe cell clones in the T12.5 cell culture flask, and when they reach confluence, subculture and count them with a suitable method, such as using an automated cell counter or hemocytometer. Freeze half of the cells in the medium containing 70% complete medium with selective antibiotic, 20% (v/v) FBS, and 10% (v/v) DMSO. Seed the rest of the cells on coverslips (12 mm x 12 mm) for immunostaining and into two wells of a six-well plate for gDNA isolation and lysate preparation.
    NOTE: In the case of the A375 cell line, seed 45,000 cells per coverslip and 450,000 cells per well of a six-well plate.

8. Validation of the generated cell clones

  1. Immunostaining
    NOTE: Perform immunostaining on the cells to determine the level of expression of the protein of interest (POI). It is important to stain wild-type cells or control clones simultaneously as a control to be able to compare the expression levels of the POI (Figure 2A).
    1. Aspirate and discard the cell culture medium.
    2. Wash the cells growing on the coverslips three times with PBS.
    3. Fix the cells by adding 0.5 mL of 4% formaldehyde solution to each well and incubate them for 20 min at RT.
      NOTE: Different antibodies can require different fixation methods.
    4. Wash the cells twice with PBS.
    5. To permeabilize the cells, incubate the coverslips in 0.1% Triton X-100 in PBS for 5 min at RT.
      NOTE: Different antibodies can require different permeabilization methods.
    6. Wash the coverslips twice with PBS.
    7. Place the coverslips in a staining chamber9.
    8. Incubate the coverslips in 1% (w/v) BSA in 0.1% (v/v) Triton X-100 in PBS solution for 30 min at RT to avoid unspecific binding of antibodies.
    9. Remove the solution by placing the coverslip with the edge on a piece of lignin using a needle and tweezers.
    10. Prepare a staining solution composed of primary antibodies in 1% (w/v) BSA and 0.1% (v/v) Triton X-100 in PBS. Drop 30 µL of solution on each coverslip and incubate them for 24 h at 4 °C in a moist humidity chamber.
      NOTE: Mouse anti-GSN antibody at 1:200 dilution was used in this experiment.
    11. Remove the solution by placing the coverslips with the edge on a piece of lignin using a needle and tweezers. Place the coverslips in a 24-well plate.
    12. Wash the coverslips three times with PBS for 5 min at RT.
    13. Prepare secondary antibodies and dyes in 1% (w/v) BSA and 0.1% (v/v) Triton X-100 in PBS solution. Drop 30 µL of solution on each coverslip and incubate them for 1 h at RT in the dark.
      NOTE: Use donkey anti-mouse-fluorescent labeled secondary antibodies 488 at 1:200 dilution. To detect F-actin and cell nuclei, we used phalloidin-Alexa Fluor 568 at 1:200 dilution and Hoechst 33342 at 1:1000 dilution.
    14. Remove the solution by placing the coverslips with the edge on a piece of lignin using a needle and tweezers. Place the coverslips in a 24-well plate.
    15. Wash the coverslips three times with PBS for 5 min at RT in the dark.
    16. Wash the coverslips once with deionized water.
    17. Mount the coverslips using mounting medium on microscope glass.
    18. Visualize the cell staining using a confocal microscope to establish the level of the POI expressed in derived clones (Figure 2A).
  2. Western Blot analysis
    NOTE: To confirm the lack, elevated level, or lowered level of POI expression in derived clones, perform the western blot analysis under standard conditions10. Analyze the wild-type cells or control clones simultaneously (Figures 2B,C).
    1. Wash the cells growing in the well of a six-well plate three times with PBS.
    2. Harvest the cells using a scraper to a buffer of choice and vortex gently for 20 s. Perform three cycles of freezing (at -80 °C) and thawing (at 4 °C) of the sample.
      NOTE: Use either cytoskeletal-bound protein extraction buffer [10 mM Tris-HCl pH 7.4, 100 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA), 1 mM ethylene glycol-bis(2-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA), 1 mM NaF, 20 mM Na4P2O7, 2 mM Na3VO4, 1% (v/v) Triton X-100, 10% (v/v) glycerol, 0.1% (w/v) SDS, 0.5% sodium deoxycholate], or urea buffer [50 mM TRIS-HCl pH 7, 5% (w/v) SDS, 8.6% (w/v) sucrose, 74 mM urea, 1 mM DTT], both with addition of 1:100 protease inhibitor cocktail, 1:100 serine phosphatase inhibitor, and 1:100 tyrosine phosphatase inhibitor.
    3. Centrifuge the lysates at 12,000 x g for 5 min at 4 °C.
    4. Determine the protein concentration in the samples (e.g., by BCA assay).
      NOTE: The assay depends on the compatibility with the buffer composition.
    5. To conduct western blot analysis of the samples, load 30 µg of protein into each well on polyacrylamide gel (7%-15%).
    6. Perform SDS-PAGE electrophoresis and transfer the proteins to a nitrocellulose membrane.
    7. Visualize the level of the POI expression by staining the membrane with suitable antibodies (Figures 2B,C).
      NOTE: Mouse anti-GSN antibodies at 1:2000 dilution and mouse anti-GAPDH antibodies at 1:200 dilution were used. See our papers for details2,11. Exposure time should be long enough for faint signals not to be overlooked (Figure 2C).
  3. gDNA analysis
    NOTE: After estimation of the POI expression level in derived clones by microscopic and western blot techniques, genomic DNA should be analyzed. A comparison of the length of the PCR reaction product obtained on the gDNA template of the obtained clones provides information on whether the sequence of the GOI was edited (Figure 2D).
    1. Wash the cells growing in the well of a six-well plate three times with PBS.
    2. Harvest the cells using a scraper in 1 mL of PBS.
    3. Centrifuge the cells at 5000 x g for 5 min at 4 °C.
    4. Aspirate and discard the supernatants.
      NOTE: Pellets can be stored for several months at -80 °C.
    5. Isolate gDNA from pellets of derived clones using a commercially available gDNA extraction kit.
    6. Design PCR primers by annealing at least 300 bp upstream and downstream of the gRNA target at the CRISPR/Cas9 gene-editing site.
      NOTE: The following primers were used: Fwd: 5'gtgcagccaggatgagag3', Rev: 5'ccctgttactggtgcatc3'.
    7. Carry out PCR reactions using DNA Polymerase Master Mix according to the manufacturer's instructions.
      NOTE: The composition of the PCR reaction mixture is shown in Table 1, and thermocycler settings for the PCR reaction are presented in Table 2.
    8. Analyze PCR products in 1% or 2% (w/v) agarose gel in Tris-acetate-EDTA buffer (40 mM Tris pH 8.0, 20 mM acetic acid, 1 mM EDTA).
    9. Compare the PCR product amplicon length of GSN KO clones to PCR product length of CTRL KO clones (203 bp; Figure 2D).
  4. gDNA sequencing
    1. Design PCR primers by annealing to the sequences upstream and downstream from the sequences recognized by the gRNAs coded by CRISPR/Cas9(D10A) plasmids.
      NOTE: Design primers as follows: Fwd: 5'gatctcgagctcaagcttcgaattctgaacagtgcagacctttg3', Rev: 5'cgcggtaccgtcgactgcagaattcaattcaccagaacaggactaggc3'.
    2. Carry out PCR using High-Fidelity DNA Polymerase (such an analysis requires high accuracy during DNA amplification) and gDNA as a template.
      NOTE: The composition of the PCR reaction mixture is shown in Table 3, and thermocycler settings for the PCR reaction are presented in Table 4.
    3. Linearize the plasmid with a restriction enzyme within multiple cloning sites by incubating for 1 h at 37°C.
      NOTE: The composition of the restriction digestion reaction mixture is shown in Table 5. It does not matter what plasmid is being used. pACGFP-C1 was linearized with the EcoRI enzyme.
    4. Estimate the concentration of inserts and cut plasmid by agarose gel electrophoresis.
    5. Prepare DNA assembly reactions.
      NOTE: A traditional cloning method or any other method can be used.
    6. Transform competent bacteria (e.g., by heat shock procedure)12.
    7. Isolate plasmids (e.g., from six bacteria colonies per construct according to the manufacturer's instructions or to the protocol cited)13.
    8. Check whether the insert has been successfully cloned into the plasmid and that its length is appropriate by restriction digestion and DNA electrophoresis.
      NOTE: If the selected colonies do not contain a plasmid with an insert, the plasmids should be isolated from subsequent bacterial colonies.
    9. Confirm gene editing by plasmid sequencing (Figure 3).
      NOTE: One should obtain at least two different results of DNA sequencing for each derived cell clone because of the existence of two alleles of genes. For multiploid cell lines (greater than 2 n), it is necessary to sequence more plasmids to obtain the sequence of all gene copies in the cell that are obtained. Isolate as many colonies as necessary until plasmids with the cloned sequences of all the copies of the gene are isolated. One can use a commercially available kit to estimate the number of loci for the studied gene.
    10. Compare the gDNA sequences obtained for the GSN KO and CTRL KO clones using a multiple sequence alignment program (Figure 3).
ReagentsVolume
DNA Polymerase Master Mix7.5 µl
Forward primer (10 μM)1.5 µl
Reverse primer (10 μM)1.5 µl
Sterile water3.5 µl
gDNA1 µl containing 10 ng gDNA

Table 1. Composition of the PCR reaction mixture.

StepsTemperature [°C]Time [minutes: seconds]
19504:00
29500:30
35700:30
47200:45
5go to 2, 35xX
67210:00
78

Table 2. Thermocycler settings for the PCR reaction.

ReagentsVolume
5 x High-Fidelity DNA Polymerase Buffer4 µl
dNTPs (10 mM)0.4 µl
Forward primer (10 μM)1 µl
Reverse primer (10 μM)1 µl
Sterile water12.4 µl
gDNA1 µl containing 10 ng gDNA
High-Fidelity DNA Polymerase0.2 µl

Table 3. Composition of the PCR reaction mixture.

StepsTemperature [°C]Time [minutes: seconds]
19800:30
29800:30
36100:30
47201:00
5go to step 2, 35 timesX
67210:00
78

Table 4. Thermocycler settings for the PCR reaction.

ReagentsAmount
10 x buffer3 μl
Restriction enzyme1 μl
Sterile water20.7 μl
Plasmid5.3 μl containing 5 μg of DNA

Table 5. Composition of the restriction digestion reaction mixture.

9. Assess the cell line's phenotypic heterogeneity

  1. Perform immunostaining of the cells to determine the level of POI expression.
  2. Take photos without magnification using a 60x oil immersion lens in a confocal microscope.
  3. To establish the distribution ratio of cells with different levels, use the "over- /underexposure" tool that is usually available in most microscopic image analysis programs. Treat cells that show underexposed areas as producing the POI at a low level. Classify overexposed cells as cells with a high level of POI expression and the remaining cells as expressing POI at a medium level.

תוצאות

Using the protocol presented, we provide a detailed demonstration of the isolation of stably transfected melanoma cell clones with the glass cylinder method (Figure 1A). Our studies relate to melanoma cell biology, and the most common research model that we use is the adherent and highly invasive A375 melanoma line. Since our research has shown that melanoma cells produce gelsolin (GSN) at a high level compared to other types of cancer14, we are investigating the role...

Discussion

We have provided a detailed description of the isolation of stably transfected melanoma cell clones with glass cylinders. It is important to obtain control clones when deriving clones with changed expression of genes because the results obtained for the targeted modification clones should always be compared to results obtained for controls. In this way, we can check whether the transfection itself or culture with a selective antibiotic does not affect the results of the experiments, instead of some other factors, such as...

Disclosures

The authors declare no competing financial interests.

Acknowledgements

This work was supported by the National Center for Science, Poland (project #2016/22/E/NZ3/00654, granted to AJM).

Materials

NameCompanyCatalog NumberComments
15 ml centrifuge tubeGoogleLab ScientificG66010522
150 mm cell culturedish with 20 mm gridFalcon353025
24-wells plateVWR International10062-896
35 mm culture dishEppendorfEP0030700112
6-well plateEppendorfEP0030700113
96-well plateVWR International10062-900 
Acetic acid, 80% solutionChempur115687330
AgaroseProna-AboBLE500
Antibiotic-AntimycoticGibco15240062
anti-GAPDH antibodiesSanta Cruz Biotechnology Inc.,sc-47724
anti-GSN antibodies  - clone C20Santa Cruz Biotechnology Inc.,sc-6405
anti-GSN antibodies  - clone GS-2C4Sigma-AldrichG44896
Bovine Serum Albumin (BSA)Sigma-AldrichA3294
Color Taq PCR Master Mix (2x)EurXE2525
Control Double Nickase PlasmidSanta Cruz Biotechnology Inc.,sc-437281
Coverslipsbionovo16283
Dako Mounting medium ClontechS3023
DMSO -  Dimethyl sulfoxideapplichemA3672,0250
DNA Purification Kit EurX3555-02
donkey anti- mouse-Alexa Fluor 488Invitrogen# A-21202
DTT - 1,4-DithiothreitolSigma-Aldrich10197777001
EcoRI Thermo Fisher ScientificFD0274
EDTA- ethylenediaminetetraacetic acid Poch (Pol-Aura)593280117
EGTA - ethylene glycol-bis(2-aminoethyl ether)- N,N,N’,N’-tetraacetic acid Sigma-AldrichE0396
FBS - Fetal Bovine Serum Gibco10270-106
Gelsolin CRISPR PlasmidsSanta Cruz Biotechnology Inc.,sc-401005-NIC
FormaldehydeSigma-AldrichP6148
GlycerolSigma-AldrichL-4909
high glucose Dulbecco’s modified Eagle’s medium with reduced concentration (1.5 g/l) of NaHCO3 Polish Academy of Science,Wrocfigure-materials-2768aw, Poland11-500
Hoechst 33342 Thermo Fisher ScientificH3570
L-GlutamineGibco25030-024
Lignin BionovoB-0521
Lipofectamine 3000 Transfection Reagent InvitrogenL3000-008
Na3VO4Sigma-AldrichS6508
Na4P2O7Sigma-AldrichP8010
NaFSigma-Aldrich450022
NEBuilder Assembly Tool http://nebuilder.neb.com/#!/
pACGFP-C1 Clontech
PageRuler Prestained Protein LadderThermo Fisher Scientific 26616
Perfect 100 bp DNA ladderEurXE3134
phalloidin-Alexa Fluor 568InvitrogenA12380
Phosphatase Inhibitor Cocktail 2Sigma-AldrichP5726
Phosphatase Inhibitor Cocktail 3Sigma-AldrichP0044
Phusion High-Fidelity DNA Polymerase Thermo Fisher ScientificF530S
Pierce BCA Protein Assay Kit Thermo Fisher Scientific 23225
polyethylenimine (PEI)Sigma-Aldrich408727
protease inhibitor cocktailSigma-AldrichP8340
puromycinInviviGenant-pr
SDS - sodium dodecyl sulfate Sigma-AldrichL4509
silicone CX80 Polska
Sodium chloride - NaClChempur7647-14-5
sodium deoxycholateSigma-AldrichD6750259
sucrosePoch (Pol-Aura)PA-06-772090110
the glass cylinders Sigma-AldrichC3983-50EA
Tissue Culture Flask 25mLVWR International10062-868
Tissue-culture 75 cm2 flaskVWR10062-872
Trisma baseSigma-AldrichT1503
Triton X-100Sigma-AldrichX100
trypsin Polish Academy of Science,Wrocfigure-materials-5463aw, Poland20-500
ureaSigma-Aldrich8656
xylene solutionChempur115208603

References

  1. Recillas-Targa, F. Multiple strategies for gene transfer, expression, knockdown, and chromatin influence in mammalian cell lines and transgenic animals. Molecular Biotechnology. 34 (3), 337-354 (2006).
  2. Wurm, F. M. Production of recombinant protein therapeutics in cultivated mammalian cells. Nature Biotechnology. 22 (11), 1393-1398 (2004).
  3. McFarland, D. C. Preparation of pure cell cultures by cloning. Methods in Cell Science. 22 (1), 63-66 (2000).
  4. Mattanovich, D., Borth, N. Applications of cell sorting in biotechnology. Microbial Cell Factories. 5 (1), 1-11 (2006).
  5. Park, H. B., et al. Cell cloning-on-the-spot by using an attachable silicone cylinder. Biochemical and Biophysical Research Communications. 474 (4), 768-772 (2016).
  6. Malek, N., et al. Knockout of ACTB and ACTG1 with CRISPR/Cas9(D10A) technique shows that non-muscle β and γ actin are not equal in relation to human melanoma cells' motility and focal adhesion formation. International Journal of Molecular Sciences. 21 (8), 2746 (2020).
  7. Malek, N., et al. The origin of the expressed retrotransposed gene ACTBL2 and its influence on human melanoma cells' motility and focal adhesion formation. Scientific Reports. 11 (1), 3329 (2021).
  8. Mazurkiewicz, E., Nowak, D., Mazur, A. J. Gelsolin contributes to the motility of A375 melanoma cells and this activity is mediated by the fibrous extracellular matrix protein profile. Cells. 10 (8), 1848 (2021).
  9. Mazurkiewicz, E., Mrówczyńska, E., Simiczyjew, A., Nowak, D., Mazur, A. J. A Fluorescent gelatin degradation assay to study melanoma breakdown of extracellular matrix. Methods in Molecular Biology. , 47-63 (2021).
  10. Towbin, H., Staehelin, T., Gordon, J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. BioEssays. 76 (9), 4350-4354 (1979).
  11. Makowiecka, A., et al. Changes in biomechanical properties of A375 cells due to the silencing of TMSB4X expression are not directly correlated with alterations in their stemness features. Cells. 10 (4), 769 (2021).
  12. Pope, B., Kent, H. M. High efficiency 5 min transformation of Escherichia coli. Nucleic Acids Research. 24 (3), 536-537 (1996).
  13. JoVE Science Education Database. Plasmid Purification: Basic Methods in Cellular and Molecular Biology. JoVE. , (2022).
  14. Mazur, A. J., et al. Gelsolin interacts with LamR, hnRNP U, nestin, Arp3 and in human melanoma cells as revealed by immunoprecipitation and mass spectrometry. European Journal of Cell Biology. 95 (1), 26-41 (2016).
  15. Litwin, M., et al. Gelsolin affects the migratory ability of human colon adenocarcinoma and melanoma cells. Life Sciences. 90 (21-22), 851-861 (2012).
  16. Feldt, J., et al. Structure, regulation and related diseases of the actin-binding protein gelsolin. Expert Reviews in Molecular Medicine. 20, 1-10 (2019).
  17. Chong, Z. X., Yeap, S. K., Ho, W. Y. Transfection types, methods and strategies: A technical review. PeerJ. 9, 1-37 (2021).
  18. Casden, N., Behar, O. An approach for accelerated isolation of genetically manipulated cell clones with reduced clonal variability. Journal of Cell Science. 132 (6), (2019).
  19. Nicosia, R. F., Villaschi, S., Smith, M. Isolation and characterization of vasoformative endothelial cells from the rat aorta. In Vitro Cellular & Developmental Biology-Animal. 30 (6), 394-399 (1994).
  20. Li, D., et al. Generation of human lens epithelial-like cells from patient-specific induced pluripotent stem cells. Journal of Cellular Physiology. 231 (12), 2555-2562 (2016).

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Explore More Articles

Stably Transfected CellsMelanoma Cell ClonesGenomic InformationCell TransfectionHeterogeneous Cell PopulationReproducibilityStable Cell ClonesGene FunctionsRecombinant Protein ProductionTransient TransfectionGlass CylindersProtein Of InterestGene Of InterestDrug ConcentrationsPCR ValidationWestern Blot AnalysisImmunostainingGDNA SequencingPhenotypic Heterogeneity

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved