עבודה זו נתמכה על ידי קרנות מהגנום קנדה, מכון ג&#39;נומיקס אונטריו, והמכון הקנדי למענקי מחקר לבריאות JG ו AE AG הוא מקבל מלגת Vanier קנדה בוגר.

<ol>
	<li>Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+maps+of+protein+complexes+from+quantitative+genetic+interaction+data.">Functional maps of protein complexes from quantitative genetic interaction data.</a> PLoS Comput. Biol. 4, e1000065 (2008).</li><li>Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Charting+the+genetic+interaction+map+of+a+cell.">Charting the genetic interaction map of a cell.</a> Curr. Opin. Biotechnol. 22, 66-74 (2011).</li><li>Costanzo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genetic+landscape+of+a+cell.">The genetic landscape of a cell.</a> Science. 327, 425-4231 (2010).</li><li>Fiedler, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+organization+of+the+S.+cerevisiae+phosphorylation+network.">Functional organization of the S. cerevisiae phosphorylation network.</a> Cell. 136, 952-963 (2009).</li><li>Roguev, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservation+and+rewiring+of+functional+modules+revealed+by+an+epistasis+map+in+fission+yeast.">Conservation and rewiring of functional modules revealed by an epistasis map in fission yeast.</a> Science. 322, 405-4010 (2008).</li><li>Schuldiner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+function+and+organization+of+the+yeast+early+secretory+pathway+through+an+epistatic+miniarray+profile.">Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile.</a> Cell. 123, 507-519 (2005).</li><li>Wilmes, G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+interaction+map+of+RNA-processing+factors+reveals+links+between+Sem1/Dss1-containing+complexes+and+mRNA+export+and+splicing.">A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing.</a> Mol. Cell. 32, 735-746 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systems-level+approaches+for+identifying+and+analyzing+genetic+interaction+networks+in+Escherichia+coli+and+extensions+to+other+prokaryotes.">Systems-level approaches for identifying and analyzing genetic interaction networks in Escherichia coli and extensions to other prokaryotes.</a> Mol. Biosyst. 12, 1439-1455 (2009).</li><li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=coli+synthetic+genetic+array+analysis.">coli synthetic genetic array analysis.</a> Nat. Methods. 5, 789-7895 (2008).</li><li>Typas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+peptidoglycan+synthesis+by+outer-membrane+proteins.">Regulation of peptidoglycan synthesis by outer-membrane proteins.</a> Cell. 143, 1097-10109 (2010).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, 2006-200008 (2006).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+interaction+maps+in+Escherichia+coli+reveal+functional+crosstalk+among+cell+envelope+biogenesis+pathways.">Genetic interaction maps in Escherichia coli reveal functional crosstalk among cell envelope biogenesis pathways.</a> PLoS Genet. 7, e1002377 (2011).</li><li>Nichols, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phenotypic+landscape+of+a+bacterial+cell.">Phenotypic landscape of a bacterial cell.</a> Cell. 144, 143-156 (2011).</li><li>Babu, M., Gagarinova, A., Greenblatt, J., Emili, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-based+synthetic+genetic+screens+to+map+bacterial+pathways+and+functional+networks+in+Escherichia+coli.">Array-based synthetic genetic screens to map bacterial pathways and functional networks in Escherichia coli.</a> Methods Mol Biol. 765, 125-153 (2011).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-665 (2000).</li><li>Yu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+recombination+system+for+chromosome+engineering+in+Escherichia+coli.">An efficient recombination system for chromosome engineering in Escherichia coli.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).</li><li>Typas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=quantitative+analyses+of+genetic+interactions+in.">quantitative analyses of genetic interactions in.</a> E. coli. Nat. Methods. 5, 781-787 (2008).</li><li>Zeghouf, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+Peptide+Affinity+(SPA)+system+for+the+identification+of+mammalian+and+bacterial+protein+complexes.">Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes.</a> J. Proteome Res. 3, 463-468 (2004).</li><li>Davierwala, A. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> , 1147-1152 (2005).</li><li>Breslow, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+strategy+enabling+high-resolution+functional+analysis+of+the+yeast+genome.">A comprehensive strategy enabling high-resolution functional analysis of the yeast genome.</a> Nat. Methods. 5, 711-718 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+peptide+affinity+purification+system+for+the+systematic+isolation+and+identification+of+protein+complexes+from+Escherichia+coli.">Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli.</a> Methods Mol. Biol. 564, 373-400 (2009).</li><li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+network+containing+conserved+and+essential+protein+complexes+in+Escherichia+coli.">Interaction network containing conserved and essential protein complexes in Escherichia coli.</a> Nature. 433, 531-537 (2005).</li><li>Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+functional+atlas+of+Escherichia+coli+encompassing+previously+uncharacterized+proteins.">Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins.</a> PLoS Biol. 7, (2009).</li><li>Anderson, R. P., Roth, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+genetic+duplications+in+phage+and+bacteria.">Tandem genetic duplications in phage and bacteria.</a> Annu. Rev. Microbiol. 31, 473-505 (1977).</li><li>Boone, C., Bussey, H., Andrews, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+genetic+interactions+and+networks+with+yeast.">Exploring genetic interactions and networks with yeast.</a> Nat. Rev. Genet. 8, 437-449 (2007).</li><li>Collins, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+dissection+of+protein+complexes+involved+in+yeast+chromosome+biology+using+a+genetic+interaction+map.">Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map.</a> Nature. 446, 806-8010 (2007).</li><li>Le Meur, N., Gentleman, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+synthetic+lethality.">Modeling synthetic lethality.</a> Genome Biol. 9, R135 (2008).</li><li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+mapping+of+the+yeast+genetic+interaction+network.">Global mapping of the yeast genetic interaction network.</a> Science. 303, 808-813 (2004).</li><li>Wong, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combining+biological+networks+to+predict+genetic+interactions.">Combining biological networks to predict genetic interactions.</a> Proc. Natl. Acad. Sci. U.S.A. 101, 15682-15687 (2004).</li><li>van Opijnen, T., Bodi, K. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn-seq:+high-throughput+parallel+sequencing+for+fitness+and+genetic+interaction+studies+in+microorganisms.">Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms.</a> Nat. Methods. 6, 767-772 (2009).</li><li>Gagarinova, A., Emili, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+genetic+manipulation+methods+for+exploring+bacterial+molecular+biology.">Genome-scale genetic manipulation methods for exploring bacterial molecular biology.</a> Mol. Biosyst. 8, 1626-1638 (2012).</li><li>Dewey, C. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positional+orthology:+putting+genomic+evolutionary+relationships+into+context.">Positional orthology: putting genomic evolutionary relationships into context.</a> Brief Bioinform. 12, 401-412 (2011).</li><li>St Onge, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+pathway+analysis+using+high-resolution+fitness+profiling+of+combinatorial+gene+deletions.">Systematic pathway analysis using high-resolution fitness profiling of combinatorial gene deletions.</a> Nat. Genet. 39, 199-206 (2007).</li></ol>

אין ניגודי האינטרסים הכריזו.

נציין פרוטוקול צעד חכם לשימוש בהקרנת eSGA רובוטית לחקור פונקציות גני חיידקים ברמת מסלול על ידי חוקר במערכת עיכול. גישה זו יכולה לשמש כדי לחקור גנים בודדים, כמו גם מערכות ביולוגיות שלמות בE. coli. זהירות ביצוע צעדי הניסוי שתוארו לעיל, כולל את כל הבקרות המתאימות, וקפדנו...

<table border="1" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>I. Antibiotics</td>
			<td>2</td>
			<td>36471 
			Remove</td>
		</tr>
		<tr>
			<td>Chloramphenicol</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#CLR201</td>
			<td>&nbsp;</td>
			<td>3</td>
			<td>36472 
			Remove</td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>#KAN201</td>
			<td>&nbsp;</td>
			<td>4</td>
			<td>36480 
			Remove</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td># AMP201</td>
			<td>&nbsp;</td>
			<td>5</td>
			<td>36473 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>2. Luria-Bertani medium</td>
			<td>6</td>
			<td>36474 
			Remove</td>
		</tr>
		<tr>
			<td>LB powder</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#LBL405</td>
			<td>&nbsp;</td>
			<td>7</td>
			<td>36478 
			Remove</td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#AGR003</td>
			<td>&nbsp;</td>
			<td>8</td>
			<td>36481 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>3. Bacterial Strains and Plasmids</td>
			<td>9</td>
			<td>36475 
			Remove</td>
		</tr>
		<tr>
			<td>Hfr Cavalli strain &lambda;red system (JL238)</td>
			<td>&nbsp;</td>
			<td>Babu et al.14.</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10</td>
			<td>36476 
			Remove</td>
		</tr>
		<tr>
			<td>pKD3</td>
			<td>&nbsp;</td>
			<td>E. coli Genetic Stock Centre, Yale</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>11</td>
			<td>36477 
			Remove</td>
		</tr>
		<tr>
			<td>Keio E. coli F- recipient collection</td>
			<td>&nbsp;</td>
			<td>National BioResource Project (NBRP) of Japan11</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>12</td>
			<td>36479 
			Remove</td>
		</tr>
		<tr>
			<td>Hypomorphic E. coli F- SPA-tag strains</td>
			<td>&nbsp;</td>
			<td>Open biosystems; Babu et al.14</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>13</td>
			<td>36491 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>4. Primers</td>
			<td>14</td>
			<td>36486 
			Remove</td>
		</tr>
		<tr>
			<td>pKD3-based desalted constant primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>F1: 5'-GGCTGACATGGGAATTAGC-3' 
			R1: 5'-AGATTGCAGCATTACACGTCTT-3'</td>
			<td>15</td>
			<td>36482 
			Remove</td>
		</tr>
		<tr>
			<td>Desalted custom primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>Cm-R: 5'-TTATACGCAAGGCGACAAGG-3' 
			Cm-F: 5'- GATCTTCCGTCACAGGTAGG-3'</td>
			<td>16</td>
			<td>36483 
			Remove</td>
		</tr>
		<tr>
			<td>Desalted custom primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions 
			F2 constant region: 
			5'-CATATGAATATCCTCCTTA-3' 
			R2 constant region: 
			5'-TGTGTAGGCTGGAGCTGCTTC-3'S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions 
			S1 constant region: 
			5'AGCTGGAGGATCCATGGAAAAGAGAAG -3' 
			S2 constant region: 
			5'- GGCCCCATATGAATATCCTCCTTAGTT -3' 
			 
			KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential 
			gene SPA-tag insertion site</td>
			<td>17</td>
			<td>36484 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>5. PCR and Electrophoresis Reagents</td>
			<td>18</td>
			<td>36485 
			Remove</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>19</td>
			<td>36487 
			Remove</td>
		</tr>
		<tr>
			<td>10X PCR buffer</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>20</td>
			<td>36488 
			Remove</td>
		</tr>
		<tr>
			<td>10 mM dNTPs</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>21</td>
			<td>36489 
			Remove</td>
		</tr>
		<tr>
			<td>25 mM MgCl2</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>22</td>
			<td>36490 
			Remove</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># AGA002</td>
			<td>&nbsp;</td>
			<td>23</td>
			<td>36492 
			Remove</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>&nbsp;</td>
			<td>NEB</td>
			<td>#B7021S</td>
			<td>&nbsp;</td>
			<td>24</td>
			<td>36493 
			Remove</td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># ETB444</td>
			<td>&nbsp;</td>
			<td>25</td>
			<td>36497 
			Remove</td>
		</tr>
		<tr>
			<td>10X TBE buffer</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># ETB444.10</td>
			<td>&nbsp;</td>
			<td>26</td>
			<td>36494 
			Remove</td>
		</tr>
		<tr>
			<td>Tris Base</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># TRS001</td>
			<td>&nbsp;</td>
			<td>27</td>
			<td>36495 
			Remove</td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td># T1503-1KG</td>
			<td>&nbsp;</td>
			<td>28</td>
			<td>36496 
			Remove</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0)</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td># B6768-500G</td>
			<td>&nbsp;</td>
			<td>29</td>
			<td>36498 
			Remove</td>
		</tr>
		<tr>
			<td>DNA ladder</td>
			<td>&nbsp;</td>
			<td>NEB</td>
			<td>#N3232L</td>
			<td>&nbsp;</td>
			<td>30</td>
			<td>36499 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>6. DNA isolation and Clean-up Kits</td>
			<td>31</td>
			<td>36500 
			Remove</td>
		</tr>
		<tr>
			<td>Genomic DNA isolation and purification kit</td>
			<td>&nbsp;</td>
			<td>Promega</td>
			<td>#A1120</td>
			<td>&nbsp;</td>
			<td>32</td>
			<td>36501 
			Remove</td>
		</tr>
		<tr>
			<td>Plasmid Midi kit</td>
			<td>&nbsp;</td>
			<td>Qiagen</td>
			<td># 12143</td>
			<td>&nbsp;</td>
			<td>33</td>
			<td>36502 
			Remove</td>
		</tr>
		<tr>
			<td>QIAquick PCR purification kit</td>
			<td>&nbsp;</td>
			<td>Qiagen</td>
			<td>#28104</td>
			<td>&nbsp;</td>
			<td>34</td>
			<td>36512 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>7. Equipment for PCR, Transformation and Replica-pinning</td>
			<td>35</td>
			<td>36503 
			Remove</td>
		</tr>
		<tr>
			<td>Thermal cycler</td>
			<td>&nbsp;</td>
			<td>BioRad, iCycler</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>36</td>
			<td>36504 
			Remove</td>
		</tr>
		<tr>
			<td>Agarose gel electrophoresis</td>
			<td>&nbsp;</td>
			<td>BioRad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>37</td>
			<td>36505 
			Remove</td>
		</tr>
		<tr>
			<td>Electroporator</td>
			<td>&nbsp;</td>
			<td>Bio-Rad GenePulser II</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>38</td>
			<td>36506 
			Remove</td>
		</tr>
		<tr>
			<td>0.2 cm electroporation cuvette</td>
			<td>&nbsp;</td>
			<td>Bio-Rad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>39</td>
			<td>36507 
			Remove</td>
		</tr>
		<tr>
			<td>42 &deg;C water bath shaker</td>
			<td>&nbsp;</td>
			<td>Innova 3100</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>40</td>
			<td>36508 
			Remove</td>
		</tr>
		<tr>
			<td>Beckman Coulter TJ-25 centrifuge</td>
			<td>&nbsp;</td>
			<td>Beckman Coulter</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>41</td>
			<td>36519 
			Remove</td>
		</tr>
		<tr>
			<td>32 &deg;C shaker</td>
			<td>&nbsp;</td>
			<td>New Brunswick Scientific, USA</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>42</td>
			<td>36509 
			Remove</td>
		</tr>
		<tr>
			<td>32 &deg;C plate incubator</td>
			<td>&nbsp;</td>
			<td>Fisher Scientific</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>43</td>
			<td>36510 
			Remove</td>
		</tr>
		<tr>
			<td>RoToR-HDA benchtop robot</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>44</td>
			<td>36511 
			Remove</td>
		</tr>
		<tr>
			<td>96, 384 and 1,536 pin density pads</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>45</td>
			<td>36513 
			Remove</td>
		</tr>
		<tr>
			<td>96 or 384 long pins</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>46</td>
			<td>36514 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>8. Imaging Equipments</td>
			<td>47</td>
			<td>36515 
			Remove</td>
		</tr>
		<tr>
			<td>Camera stand</td>
			<td>&nbsp;</td>
			<td>Kaiser</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>48</td>
			<td>36516 
			Remove</td>
		</tr>
		<tr>
			<td>Digital camera, 10 megapixel</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>49</td>
			<td>36517 
			Remove</td>
		</tr>
		<tr>
			<td>Light boxes, Testrite 16" x 24" units</td>
			<td>&nbsp;</td>
			<td>Testrite</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>50</td>
			<td>36527 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>9. Pads or Plates Recycling </td>
			<td>51</td>
			<td>36518 
			Remove</td>
		</tr>
		<tr>
			<td>10% bleach</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>52</td>
			<td>36520 
			Remove</td>
		</tr>
		<tr>
			<td>70% ethanol</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>53</td>
			<td>36521 
			Remove</td>
		</tr>
		<tr>
			<td>Sterile distilled water</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>54</td>
			<td>36522 
			Remove</td>
		</tr>
		<tr>
			<td>Flow hood</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>55</td>
			<td>36523 
			Remove</td>
		</tr>
		<tr>
			<td>Ultraviolet lamp</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>56</td>
			<td>36524 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10. Labware</td>
			<td>57</td>
			<td>36525 
			Remove</td>
		</tr>
		<tr>
			<td>50 ml polypropylene tubes</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>58</td>
			<td>36526 
			Remove</td>
		</tr>
		<tr>
			<td>1.5 ml micro-centrifuge tubes</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>59</td>
			<td>36528 
			Remove</td>
		</tr>
		<tr>
			<td>250 ml conical flaks</td>
			<td>&nbsp;</td>
			<td>VWR</td>
			<td># 29140-045</td>
			<td>&nbsp;</td>
			<td>60</td>
			<td>36529 
			Remove</td>
		</tr>
		<tr>
			<td>15 ml sterile culture tubes</td>
			<td>&nbsp;</td>
			<td>Thermo Scientific</td>
			<td># 366052</td>
			<td>&nbsp;</td>
			<td>61</td>
			<td>36530 
			Remove</td>
		</tr>
		<tr>
			<td>Cryogenic vials</td>
			<td>&nbsp;</td>
			<td>VWR</td>
			<td># 479-3221</td>
			<td>&nbsp;</td>
			<td>62</td>
			<td>36531 
			Remove</td>
		</tr>
		<tr>
			<td>Rectangular Plates</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>63</td>
			<td>36532 
			Remove</td>
		</tr>
		<tr>
			<td>96-well and 384-well microtitre plates</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>Nunc</td>
			<td>&nbsp;</td>
			<td>64</td>
			<td>36533 
			Remove</td>
		</tr>
		<tr>
			<td>Plate roller for sealing multi-well</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td>#R1275</td>
			<td>&nbsp;</td>
			<td>65</td>
			<td>36535 
			Remove</td>
		</tr>
		<tr>
			<td>plates</td>
			<td>&nbsp;</td>
			<td>ABgene</td>
			<td># AB-0580</td>
			<td>&nbsp;</td>
			<td>66</td>
			<td>36534 
			Remove</td>
		</tr>
		<tr>
			<td>Adhesive plate seals</td>
			<td>&nbsp;</td>
			<td>Fisher Scientific</td>
			<td># 13-990-14</td>
			<td>&nbsp;</td>
			<td>67</td>
			<td>36537 
			Remove</td>
		</tr>
		<tr>
			<td>-80 &deg;C freezer</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>68</td>
			<td>36536 
			Remove</td>
		</tr>
	</tbody>
</table>

mapping bacterial functional networks and pathways in escherichia coli using synthetic genetic arrays

פנוטיפים נקבעים על ידי סדרה מורכבת של אינטראקציות פיסיות (בין חלבונים לדוגמה) ופונקציונליות (גני גן או גנטי לדוגמה) (GI) 1. בעוד אינטראקציות פיסיות יכולות להעיד שחלבונים חיידקיים משויכים כמתחמים, שהם לא בהכרח לחשוף relationships1 הפונקציונלי מסלול ברמה. מסכי מערכת עיכול, שבו הצמיחה של מוטנטים כפולים, ושני גנים שנמחקו או מומתים נמדדה והשוואה למוטנטים הבודדים המתאימים, יכולים להאיר תלות epistatic בין לוקוסים ומכאן לספק אמצעים לשאילתה ולגלות קשרים פונקציונליים חדשים 2. מפות GI בקנה מידה גדולה כבר דיווחו לאורגניזמים האיקריוטים כמו שמרים 3-7, אך מידע GI נותר דליל לפרוקריוטים 8, אשר מעכב את הביאור הפונקציונלי של הגנום של חיידקים. לשם כך, אנחנו ואחרים פתחנו שיטות תפוקה גבוהה כמותיים חיידקים במערכת עיכול הקרנה 9, 10 </sup&gt;. כאן, אנו מציגים את השלבים העיקריים הנדרשים לביצוע ה כמותית coli מערך הליך סינטטי גנטי (eSGA) הקרנה על הגנום בהיקף 9, תוך שימוש בנטייה טבעית חיידקים והומולוגיים רקומבינציה המערכתית כדי להפיק ולמדוד את הכושר של מספר גדול של מוטציות כפולות בפורמט מערך מושבה. בקצרה, רובוט משמש להעברה , דרך הצמידה chloramphenicol (CM) - מסומן אללים מוטנטים מHFR המהונדס (תדירות גבוהה של רקומבינציה) &#39;זנים תורמים&#39; למערך מסודר של kanamycin (קאן) - זנים מסומנים F-נמענים. בדרך כלל, אנחנו משתמשים במוטציות אובדן של פונקציה בודדות נושא מחיקות גנים שאינם חיוניות (למשל, האוסף &#39;קיו&#39; 11) ומוטציות גנטיות hypomorphic חיוניות (כלומר האללים מקנים ביטוי מופחת חלבון, יציבות, או פעילות 9, 12, 13) כדי שאילתא העמותות הפונקציונליות של גנים שאינם חיוניים והכרחיים, מילpectively. לאחר הצמיד ותיווך חילופים גנטי שהתפתח על ידי הומולוגי רקומבינציה, המוטציות הכפולות כתוצאה מכך הם נבחרו על המצע מוצק המכיל גם אנטיביוטיקה. לאחר תולדה, הצלחות הם צלמו באופן דיגיטלי וגדלי מושבת כמותית מקבלים נקודות באמצעות מערכת בבית אוטומטית עיבוד תמונת 14. החיילים אמריקאים מתגלים כאשר שיעור הצמיחה של מוטציה כפולה הוא גם באופן משמעותי טוב יותר או גרוע יותר מצפויים 9. חיילים אמריקאים מחמירים (או שלילי) לעתים קרובות תוצאה בין מוטציות אובדן של פונקציה בזוגות של גנים ממסלולי פיצוי התלויים באותו התהליך החיוני 2. הנה, אובדנו של גן יחיד נאגר, כך שגם מוטציה אחת היא בת קיימא. עם זאת, ההפסד של שני המסלולים הוא מזיק ותוצאות בהקטלניות או מחלה סינטטיות (כלומר צמיחה איטית). לעומת זאת, אינטראקציות הקלה (או חיובי) יכולות להתרחש בין גנים באותו מסלול או חלבון מורכב 2 כמומחיקה של שני הגנים בלבד היא לעתים קרובות מספיק כדי לטרוד את התפקוד התקין של המסלול או המורכב כגון הפרעות נוספות שלא לצמצם את הפעילות, ולכן צמיחה, נוספת. בסך הכל, באופן שיטתי זיהוי וניתוח רשתות GI יכול לספק מפות משוחדות, גלובליות של קשרים הפונקציונליים בין מספר הגדול של גנים, שממנו מידע מסלול ברמה החמיץ ידי גישות אחרות ניתן להסיק 9.

GIs reveal functional relationships between genes. Similarly, since genes in the same pathway display similar GI patterns and the GI profile similarity represents the congruency of phenotypes, we can group functionally related genes into pathways by clustering their GI profiles. Integrating GI and GI correlation networks with physical interaction information or other association data, such as genomic context (GC) relationships can also reveal the organization of higher-order functional modules that define core bio...

Watch this Scientific Journal Video about Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays at JoVE.com

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

(גני גן או epistasis) מסכים שיטתיים, בקנה מידה גדול סינטטיים גנטיים אינטראקציה יכולים לשמש כדי לחקור יתירות ומסלול-הצטלבות גנטית. כאן, אנו מתארים טכנולוגית תפוקה גבוהה כמותית סינטתית גנטית מערך הקרנה, כינת eSGA שפתחנו להבהרת יחסי epistatic ולחקור רשתות אינטראקציה גנטיות ב<em&gt; חיידקי Escherichia</em&gt;.

מיפוי רשתות פונקציונליות חיידקיים ומסלולים ב<em&gt; חיידקי Escherichia</em&gt; באמצעות מערכים גנטיים סינטטיים

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

mapping-bacterial-functional-networks-pathways-escherichia-coli-using

Research

JoVE Journal

Biology

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

46.4K Views.  University of Toronto. (גני גן או epistasis) מסכים שיטתיים, בקנה מידה גדול סינטטיים גנטיים אינטראקציה יכולים לשמש כדי לחקור יתירות ומסלול-הצטלבות גנטית. כאן, אנו מתארים טכנולוגית תפוקה גבוהה כמותית סינטתית גנטית מערך הקרנה, כינת eSGA שפתחנו להבהרת יחסי epistatic ולחקור רשתות אינטראקציה גנטיות ב

Video: Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Light/dark Transition Test for Mice

Although all of the mouse genome sequences have been determined, we do not yet know the functions of most of these genes. Gene-targeting techniques, however, can be used to delete or manipulate a specific gene in mice. The influence of a given gene on a specific behavior can then be determined by conducting behavioral analyses of the mutant mice. As a test for behavioral phenotyping of mutant mice, the light/dark transition test is one of the most widely used tests to measure anxiety-like behavior in mice. The test is based on the natural aversion of mice to brightly illuminated areas and on their spontaneous exploratory behavior in novel environments. The test is sensitive to anxiolytic drug treatment. The apparatus consists of a dark chamber and a brightly illuminated chamber. Mice are allowed to move freely between the two chambers. The number of entries into the bright chamber and the duration of time spent there are indices of bright-space anxiety in mice. To obtain phenotyping results of a strain of mutant mice that can be readily reproduced and compared with those of other mutants, the behavioral test methods should be as identical as possible between laboratories. The procedural differences that exist between laboratories, however, make it difficult to replicate or compare the results among laboratories. Here, we present our protocol for the light/dark transition test as a movie so that the details of the protocol can be demonstrated. In our laboratory, we have assessed more than 60 strains of mutant mice using the protocol shown in the movie. Those data will be disclosed as a part of a public database that we are now constructing.

Visualization of the protocol will facilitate understanding of the details of the entire experimental procedure, allowing for standardization of the protocols used across laboratories and comparisons of the behavioral phenotypes of various strains of mutant mice assessed using this test.

The light/dark transition test is one of the most widely used tests to measure anxiety-like behavior in mice. Here, we present a movie that shows detailed procedures on how we conduct the test.

אור / חושך מעבר מבחן עכברים

Although all of the mouse genome sequences have been determined, we do not yet know the functions of most of these genes. Gene-targeting techniques, ...

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme acid stresses including passage through the mammalian stomach where the pH can fall to as low as pH 1 - 22. To enable such a broad range of acidic pH survival, E. coli possesses four different inducible amino acid decarboxylases that decarboxylate their substrate amino acids in a proton-dependent manner thus raising the internal pH. The decarboxylases include the glutamic acid decarboxylases GadA and GadB3, the arginine decarboxylase AdiA4, the lysine decarboxylase LdcI5, 6 and the ornithine decarboxylase SpeF7. All of these enzymes utilize pyridoxal-5'-phospate as a co-factor8 and function together with inner-membrane substrate-product antiporters that remove decarboxylation products to the external medium in exchange for fresh substrate2. In the case of LdcI, the lysine-cadaverine antiporter is called CadB. Recently, we determined the X-ray crystal structure of LdcI to 2.0 &#197;, and we discovered a novel small-molecule bound to LdcI the stringent response regulator guanosine 5'-diphosphate,3'-diphosphate (ppGpp) 14. The stringent response occurs when exponentially growing cells experience nutrient deprivation or one of a number of other stresses9. As a result, cells produce ppGpp which leads to a signaling cascade culminating in the shift from exponential growth to stationary phase growth10. We have demonstrated that ppGpp is a specific inhibitor of LdcI 14. Here we describe the lysine decarboxylase assay, modified from the assay developed by Phan et al.11, that we have used to determine the activity of LdcI and the effect of pppGpp/ppGpp on that activity. The LdcI decarboxylation reaction removes the &alpha;-carboxy group of L-lysine and produces carbon dioxide and the polyamine cadaverine (1,5-diaminopentane)5. L-lysine and cadaverine can be reacted with 2,4,6-trinitrobenzensulfonic acid (TNBS) at high pH to generate N,N'-bistrinitrophenylcadaverine (TNP-cadaverine) and N,N&#8242;-bistrinitrophenyllysine (TNP-lysine), respectively11. The TNP-cadaverine can be separated from the TNP-lysine as the former is soluble in organic solvents such as toluene while the latter is not (See Figure 1). The linear range of the assay was determined empirically using purified cadaverine.

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

The activity of the inducible lysine decarboxylase is monitored by reacting the substrate L-lysine and the product cadaverine with 2,4,6-trinitrobenzensulfonic acid to form adducts that have differential solubility in toluene.

Assay למדידת פעילות Escherichia coli ועין מתנהלת ליזין Decarboxyase

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular signatures, or to evolve proteins in the laboratory. Here, we present a protocol that allows the generation of large (>1011) mutant libraries for a given target sequence. This method is based on replication of a ColE1 plasmid encoding the desired sequence by a low-fidelity variant of DNA polymerase I (LF-Pol I). The target plasmid is transformed into a mutator strain of E. coli and plated on solid media, yielding between 0.2 and 1 mutations/kb, depending on the location of the target gene. Higher mutation frequencies are achieved by iterating this process of mutagenesis. Compared to alternative methods of mutagenesis, our protocol stands out for its simplicity, as no cloning or PCR are involved. Thus, our method is ideal for mutational labeling of plasmids or other Pol I templates or to explore large sections of sequence space for the evolution of activities not present in the original target. The tight spatial control that PCR or randomized oligonucleotide-based methods offer can also be achieved through subsequent cloning of specific sections of the library. Here we provide protocols showing how to create a random mutant library and how to establish drug-based selections in E. coli to identify mutants exhibiting new biochemical activities.

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Here we demonstrate a simple protocol to create a random mutant library for a given target sequence. We show how this method, which is performed in vivo in Escherichia coli, can be coupled with functional selections to evolve new enzymatic activities.

בחירת הפרוטוקולים mutagenesis ו פונקציונאלי אבולוציה מכוונת של חלבונים א coli</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted into fuel alcohols1. The potential for enzymatic hydrolysis of cellulosic biomass to provide renewable energy has intensified efforts to engineer cellulases for economical fuel production2. Of particular interest are fungal cellulases3-8, which are already being used industrially for foods and textiles processing.
Identifying active variants among a library of mutant cellulases is critical to the engineering process; active mutants can be further tested for improved properties and/or subjected to additional mutagenesis. Efficient engineering of fungal cellulases has been hampered by a lack of genetic tools for native organisms and by difficulties in expressing the enzymes in heterologous hosts. Recently, Morikawa and coworkers developed a method for expressing in E. coli the catalytic domains of endoglucanases from H. jecorina3,9, an important industrial fungus with the capacity to secrete cellulases in large quantities. Functional E. coli expression has also been reported for cellulases from other fungi, including Macrophomina phaseolina10 and Phanerochaete chrysosporium11-12. 
We present a method for high throughput screening of fungal endoglucanase activity in E. coli. (Fig 1) This method uses the common microbial dye Congo Red (CR) to visualize enzymatic degradation of carboxymethyl cellulose (CMC) by cells growing on solid medium. The activity assay requires inexpensive reagents, minimal manipulation, and gives unambiguous results as zones of degradation (&#x201C;halos&#x201D;) at the colony site. Although a quantitative measure of enzymatic activity cannot be determined by this method, we have found that halo size correlates with total enzymatic activity in the cell. Further characterization of individual positive clones will determine , relative protein fitness. 
Traditional bacterial whole cell CMC/CR activity assays13 involve pouring agar containing CMC onto colonies, which is subject to cross-contamination, or incubating cultures in CMC agar wells, which is less amenable to large-scale experimentation. Here we report an improved protocol that modifies existing wash methods14 for cellulase activity: cells grown on CMC agar plates are removed prior to CR staining. Our protocol significantly reduces cross-contamination and is highly scalable, allowing the rapid screening of thousands of clones. In addition to H. jecorina enzymes, we have expressed and screened endoglucanase variants from the Thermoascus aurantiacus and Penicillium decumbens (shown in Figure 2), suggesting that this protocol is applicable to enzymes from a range of organisms.

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

We describe a low cost, high throughput method to screen for fungal endoglucanase activity in E. coli. The method relies on a simple visual readout of substrate degradation, does not require enzyme purification, and is highly scalable. This allows for the rapid screening of large libraries of enzyme variants.

הקרנת תפוקה גבוהה של פעילות Endoglucanase פטרייתיים ב Escherichia coli</em

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted ...

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the identification of the subunit composition of multi-protein complexes can provide insight into gene function and enhance understanding of biological systems1, 2. Physical interactions can be mapped with high confidence vialarge-scale isolation and characterization of endogenous protein complexes under near-physiological conditions based on affinity purification of chromosomally-tagged proteins in combination with mass spectrometry (APMS). This approach has been successfully applied in evolutionarily diverse organisms, including yeast, flies, worms, mammalian cells, and bacteria1-6. In particular, we have generated a carboxy-terminal Sequential Peptide Affinity (SPA) dual tagging system for affinity-purifying native protein complexes from cultured gram-negative Escherichia coli, using genetically-tractable host laboratory strains that are well-suited for genome-wide investigations of the fundamental biology and conserved processes of prokaryotes1, 2, 7. Our SPA-tagging system is analogous to the tandem affinity purification method developed originally for yeast8, 9, and consists of a calmodulin binding peptide (CBP) followed by the cleavage site for the highly specific tobacco etch virus (TEV) protease and three copies of the FLAG epitope (3X FLAG), allowing for two consecutive rounds of affinity enrichment. After cassette amplification, sequence-specific linear PCR products encoding the SPA-tag and a selectable marker are integrated and expressed in frame as carboxy-terminal fusions in a DY330 background that is induced to transiently express a highly efficient heterologous bacteriophage lambda recombination system10. Subsequent dual-step purification using calmodulin and anti-FLAG affinity beads enables the highly selective and efficient recovery of even low abundance protein complexes from large-scale cultures. Tandem mass spectrometry is then used to identify the stably co-purifying proteins with high sensitivity (low nanogram detection limits).
Here, we describe detailed step-by-step procedures we commonly use for systematic protein tagging, purification and mass spectrometry-based analysis of soluble protein complexes from E. coli, which can be scaled up and potentially tailored to other bacterial species, including certain opportunistic pathogens that are amenable to recombineering. The resulting physical interactions can often reveal interesting unexpected components and connections suggesting novel mechanistic links. Integration of the PPI data with alternate molecular association data such as genetic (gene-gene) interactions and genomic-context (GC) predictions can facilitate elucidation of the global molecular organization of multi-protein complexes within biological pathways. The networks generated for E. coli can be used to gain insight into the functional architecture of orthologous gene products in other microbes for which functional annotations are currently lacking.

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Affinity purification of tagged proteins in combination with mass spectrometry (APMS) is a powerful method for the systematic mapping of protein interaction networks and for investigating the mechanistic basis of biological processes. Here, we describe an optimized sequential peptide affinity (SPA) APMS procedure developed for the bacterium Escherichia coli that can be used to isolate and characterize stable multi-protein complexes to near homogeneity even starting from low copy numbers per cell.

זיהוי של קומפלקסי חלבונים ב<em&gt; חיידקי Escherichia</em&gt; באמצעות טיהור זיקת פפטיד סדרתית בשילוב עם טנדם המוני ספקטרומטריית

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the ...

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Electroporation has become a widely used method for rapidly and efficiently introducing foreign DNA into a wide range of cells. Electrotransformation has become the method of choice for introducing DNA into prokaryotes that are not naturally competent. Electroporation is a rapid, efficient, and streamlined transformation method that, in addition to purified DNA and competent bacteria, requires commercially available gene pulse controller and cuvettes. In contrast to the pulsing step, preparation of electrocompetent cells is time consuming and labor intensive involving repeated rounds of centrifugation and washes in decreasing volumes of sterile, cold water, or non-ionic buffers of large volumes of cultures grown to mid-logarithmic phase of growth. Time and effort can be saved by purchasing electrocompetent cells from commercial sources, but the selection is limited to commonly employed E. coli laboratory strains. We are hereby disseminating a rapid and efficient method for preparing electrocompetent E. coli, which has been in use by bacteriology laboratories for some time, can be adapted to V. cholerae and other prokaryotes. While we cannot ascertain whom to credit for developing the original technique, we are hereby making it available to the scientific community.

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Electroporation is a commonly employed method for introducing DNA into bacteria in a process known as transformation. Traditional protocols for the preparation of electrocompetent cells are time consuming and labor intensive. This article describes an alternate, rapid, and efficient method for the preparation of electrocompetent cells presently employed by some laboratories.

ראפיד פרוטוקול להכנת Electrocompetent<em&gt; חיידקי Escherichia</em&gt; ו<em&gt; Vibrio cholerae</em

Electroporation has become a widely used method for rapidly and efficiently introducing foreign DNA into a wide range of cells. Electrotransformation has ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

פרוטוקולים ליישום<em&gt; חיידקי Escherichia</emמערכת&gt; בהתבסס TX-TL סלולרי ללא ביטוי של ביולוגיה סינתטית

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

איתור של שידור חי<em&gt; חיידקי Escherichia</em&gt; O157: H7 תאים על ידי PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and the inherent instability of many membrane proteins once solubilized in detergents. A protocol is described that combines ligation independent cloning of membrane proteins as GFP fusions with expression in Escherichia coli detected by GFP fluorescence. This enables the construction and expression screening of multiple membrane protein/variants to identify candidates suitable for further investment of time and effort. The GFP reporter is used in a primary screen of expression by visualizing GFP fluorescence following SDS polyacrylamide gel electrophoresis (SDS-PAGE). Membrane proteins that show both a high expression level with minimum degradation as indicated by the absence of free GFP, are selected for a secondary screen. These constructs are scaled and a total membrane fraction prepared and solubilized in four different detergents. Following ultracentrifugation to remove detergent-insoluble material, lysates are analyzed by fluorescence detection size exclusion chromatography (FSEC). Monitoring the size exclusion profile by GFP fluorescence provides information about the mono-dispersity and integrity of the membrane proteins in different detergents. Protein: detergent combinations that elute with a symmetrical peak with little or no free GFP and minimum aggregation are candidates for subsequent purification. Using the above methodology, the heterologous expression in E. coli of SED (shape, elongation, division, and sporulation) proteins from 47 different species of bacteria was analyzed. These proteins typically have ten transmembrane domains and are essential for cell division. The results show that the production of the SEDs orthologues in E. coli was highly variable with respect to the expression levels and integrity of the GFP fusion proteins. The experiment identified a subset for further investigation.

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

A streamlined approach to screening for the expression of recombinant membrane proteins in Escherichia coli based on fusion to green fluorescent protein is presented.

הקרנה ירוקה פלורסנט מבוסס חלבון ביטוי של החלבונים ממברנה ב<em&gt; Coli Escherichia</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in vitro. In particular, we show that the poor solubility of Escherichia coli DNA polymerase III &#949; subunit (featuring 3&#8217;-5&#8217; exonuclease activity) is highly improved when the same protein is co-expressed with the &#945; and &#952; subunits (featuring DNA polymerase activity and stabilizing &#949;, respectively). We also show that protein co-expression in E. coli can be used to efficiently test the competence of subunits from different bacterial species to associate in a functional protein complex. We indeed show that the &#945; subunit of Deinococcus radiodurans DNA polymerase III can be co-expressed in vivo with the &#949; subunit of E. coli. In addition, we report on the use of protein co-expression to modulate mutation frequency in E. coli. By expressing the wild-type &#949; subunit under the control of the araBAD promoter (arabinose-inducible), and co-expressing the mutagenic D12A variant of the same protein, under the control of the lac promoter (inducible by isopropyl-thio-&#946;-D-galactopyranoside, IPTG), we were able to alter the E. coli mutation frequency using appropriate concentrations of the inducers arabinose and IPTG. Finally, we discuss recent advances and future challenges of protein co-expression in E. coli.

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

Protein co-expression is a powerful alternative to the reconstitution in vitro of protein complexes, and is of help in performing biochemical and genetic tests in vivo. Here we report on the use of protein co-expression in Escherichia coli to obtain protein complexes, and to tune the mutation frequency of cells.

תועלת רבה פנים של Co-ביטוי חלבון ב<em&gt; Coli Escherichia</em

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in ...

מיפוי רשתות פונקציונליות חיידקיים ומסלולים ב

Summary

Explore More Videos

Chapters in this video

אור / חושך מעבר מבחן עכברים

Assay למדידת פעילות Escherichia coli ועין מתנהלת ליזין Decarboxyase

בחירת הפרוטוקולים mutagenesis ו פונקציונאלי אבולוציה מכוונת של חלבונים א coli

הקרנת תפוקה גבוהה של פעילות Endoglucanase פטרייתיים ב Escherichia coli

זיהוי של קומפלקסי חלבונים ב

ראפיד פרוטוקול להכנת Electrocompetent

פרוטוקולים ליישום

איתור של שידור חי

הקרנה ירוקה פלורסנט מבוסס חלבון ביטוי של החלבונים ממברנה ב

תועלת רבה פנים של Co-ביטוי חלבון ב