תודה רבות לסלקו קיפר, שרה קיפר, מיכאל וייס, קוני Bartsch וסלק ויגט-Heucke לאוסף נלהב מדגם בתחום, לJanett ירקנפלד להמשך סיוע, לאולה Kobalz לג&#39;לים היפה וטוביאס קראוזה לתמיכה מוראלית.

כל הנהלים בוצעו בעמידה בחוק הגרמני להגנה על בעלי חיים (TierSchG). 1. הכנה של חומרים כימיים ומתכלה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן במי כיתה מולקולרית Chelex-100 5% (w / w) פתרון. הכן aliquots של 200 μl בצינורות תגובת 1.5 מיליליטר סטנדרטיים. כמו שרף Chelex משקעים מהר מההשעיה יש צורך מחדש homogenize ההשעיה במהלך תקופת ההכנה של aliquots כל הזמן. זה רצוי להכין 50 מיליליטר או יותר בצרור אחד ולשמור על ההשעיה הומוגני באמצעות בוחש מגנטי. פתרון Chelex יכול להיות מאוחסן במשך שנים בתנאי הסביבה. </li><li style=";text-align:right;direction:rtl"> חותכים חתיכות של נייר Whatman עם רוחב קטן יותר מאשר רוחב המקור של ציפור להיבדק. אורכו של הנייר תלוי בשיטה לקחת המדגם: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בעזרת מלקחיים, החתיכה צריכה להיות ארוכה מספיק כדי לאפשר איסוף דגימה בלי המלקחיים להיות מוכנסים לתוך המקור של ציפור. בתורהערכה גסה, לאורך מקור של 0.5 סנטימטר פיסת נייר עם האורך של 1 סנטימטר צריכה להיות בסדר. </li><li style=";text-align:right;direction:rtl"> אם לא משתמש במלקחיים, החתיכה צריכה להיות ארוכה יותר, אך את הנוקשות של פיסה עדיין צריכה לאפשר דגימה של תאי האפיתל. </li></ol></li><li style=";text-align:right;direction:rtl"> הכן aliquot אחד premix PCR עבור כל דגימה להיות מנותחים. עבור ה-PCR בנפח כולל של 25 μl התערובת מכילה 0.18 מ&quot;מ dNTPs, 2 מ&quot;מ MgCl 2, 70 מ&quot;מ טריס-HCl, אמוניום סולפט 17.25 מ&quot;מ, 0.1% (TCTGCATCGCTAAATCCTTT), P8 0.32 מיקרומטר Tween-20, פריימר P2 0.32 מיקרומטר פריימר פולימראז תקי (CTCCCAAGGATGAGRAAYTG) 16 ו -2 יחידות. ניתן להשתמש פולימראז תקי תוצרת בית 17. כדי לאפשר תוספת של הסכום המקסימאלי של ה-DNA פתרון, premix 6 μl יכולה להיות מוכנה ומאוחסן ב -20 מעלות צלזיוס למשך מספר שבועות. </li></ol> 2. אוסף דוגמאות לבישת כפפות אינה חיונית לקביעת מין עופות כprimers PCR לא יכול לחשל את ה-DNA האנושי. עבורמטרות גנוטיפ אחרות זה יכול להיות מומלץ. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ללכוד את ציפור של עניין ובעדינות להחזיק אותו ביד לדוגמא, אחד עם &quot;אחיזתו של הצלצול &#39;18. ודא שלא לסחוט את ציפור. </li><li style=";text-align:right;direction:rtl"> להחזיק פיסת נייר Whatman עם מלקחיים ולסחוב אותה כמה פעמים על פני החלק הפנימי של הלחיים, הלשון וchoana. בדרך כלל דגימות מתקבלות בתוך פחות מ 30 שניות. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בעלי חיים מבוגרים: בהתאם למין זה עלול להיות קשה כדי לקבל את ציפור לפתוח את מקורו. בדרך כלל מלגעת בצד של המקור והפעלת לחץ עדין יעבוד. </li><li style=";text-align:right;direction:rtl"> גוזלים: דגימה מגוזלים או גוזלים היא קלה במיוחד שימוש בטכניקה זו, כהתנהגות מתחננת מספקת גישה קלה לחלק הפנימי של המקור. זה יכול להיות אפילו להסיג לך את המדגם ללא טיפול בהם בכלל, כפי שהם בקלות להתחנן למשל, כאשר nestbox נפתח. </li></ol></li><li style=";text-align:right;direction:rtl"> מייד לאחסן את הנייר בcontai צינור תגובה מוכןנינג 200 μl של 5% (w / w) Chelex-100 פתרון. </li></ol> אם גם אתם מתכוונים / צריכים לסמן את הגוזלים, לעשות זאת עכשיו כאמור בסעיף 6. 3. אחסון של דגימות לפני הפקת DNA <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> אם עובד במעבדה, דגימות חנות ב -20 ° C. אם זה לא דגימות חנות אפשרי או קשה (למשל בתחום) בטמפרטורות סביבה. </li><li style=";text-align:right;direction:rtl"> דוגמאות יכולות להיות מאוחסנות במשך יותר מ -3 שנים בטמפרטורות הנעות בין טמפרטורת חדר ל-20 ° C. </li></ol> 4. הפקת DNA <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> אם המדגם הוא קפוא, להפשיר אותו בטמפרטורת חדר. </li><li style=";text-align:right;direction:rtl"> ודא שפיסת נייר היא בחלק התחתון של הצינור השקוע בפתרון Chelex-100. </li><li style=";text-align:right;direction:rtl"> דגירה דגימות ל15 דקות ב 56 ° C. </li><li style=";text-align:right;direction:rtl"> וורטקס בקצרה ספין למטה את התוכן של הצינור. </li><li style=";text-align:right;direction:rtl"> דגירה הדגימות במשך 8 דקות ב100 ° C. </li><li style=";text-align:right;direction:rtl"> ספין הדגימות ב 15,000 XG במשך 3 דקות. </li><li style=";text-align:right;direction:rtl"> השתמש ביםupernatant לגנוטיפ שלאחר מכן. </li></ol> 5. קביעת מין מולקולרית <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן אחד צינור PCR עם 6 premix μl לדגימה בתוספת שני צינורות נוספים עבור שלילי שליטה (חובה) וחיובית (אופציונלית). לקביעת מין שגרתית כולל מדגם מזיהוי המין באמצעים המוצלחים האחרונים כביקורת חיובית. </li><li style=";text-align:right;direction:rtl"> הוספת 19 μl של supernatant ממיצוי DNA לpremix ה-PCR. הקפד פיפטה מפני שטח של הפתרון כדי למנוע שריד של חרוזים Chelex. זה חיוני, כמו Chelex הוא מחליף קטיון ולכן קשה מעכבת את כל התגובות אנזימטיות. </li><li style=";text-align:right;direction:rtl"> הפעל את תכנית ה-PCR הבאה: דגירה ב94 מעלות צלזיוס במשך 3 דקות, 45 מחזורים כל אחד עם צעד 30 שניות היתוך 94 מעלות צלזיוס, ואחריו צעד 30 שניות חישול על 55 מעלות צלזיוס, ואחריו צעד התארכות 45 שניות ב72 ° ג בשלב אחרון מרדף כבוי, התגובות שלהם טופחו במשך 5 דקות ב72 ° C. </li><li style=";text-align:right;direction:rtl"> הכן TBE סטנדרטי 2% או agaro טה<html> ג&#39;ל se להפריד את מוצרי ה-PCR. </li><li style=";text-align:right;direction:rtl"> הרץ את הג&#39;ל agarose עם הגדרות מתח מתאימות. </li><li style=";text-align:right;direction:rtl"> דמיינו את הלהקות תחת אור UV ולצלם. ודא שתי הלהקות בדגימות שמקורן בנקבות מופרדות היטב. </li><li style=";text-align:right;direction:rtl"> להבדיל זכר מדגימות נשיות על ידי הנוכחות של אחד (זכר) או שתי להקות (נקבה). </li></ol> 6. סימון גוזלים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בדקו קינים לגוזלים שזה עתה בקעו על מתאים לוח זמנים למינים / המחקר (כגון שיקים מדי יום בשעתי הבוקר מומלץ כמו רוב האפרוחים יבקעו לאחר מכן). </li><li style=";text-align:right;direction:rtl"> חותכים את הנוצות למטה של ​​כל אפרוח בתוך קן במיקום אופייני שונה. בזברה פינק קווצות מורדות לצמוח בארבעה תחומים אופייניים ומובהקים על פני (איור 4 א) גופו של הגוזל. עבור כל אפרוח לחתוך תחום אחד (איור 4). אם יש יותר מארבעה אפרוחים בתוך קן אחד, ארבעה &quot;התספורות&quot; הייחודיות ניתן לשלב. </li></ol>ove_content &quot;&gt; לזברה פינק: למרוח להקות רגל בעשרה ימים שלאחר הבקיעה, כאשר למטה הנוצות להיות קשה לזהות וגודל גוזל מאפשר לצלצל.

<ol>
	<li>Russell, W. M. S., Burch, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+principles+of+humane+experimental+technique.">The principles of humane experimental technique.</a> , (1959).</li><li>Robertson, B. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+kakapo,+Strigops+habroptilus+Aves,+from+feces.">Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces.</a> Mol. Ecol. 8, 1349-1350 (1999).</li><li>Yannic, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Description+of+microsatellite+markers+and+genotyping+performances+using+feathers+and+buccal+swabs+for+the+Ivory+gull+(Pagophila+eburnea).">Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea).</a> Mol. Ecol. Resour. 11, 877-889 (2011).</li><li>Bello, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+feathers.">Isolation of genomic DNA from feathers.</a> J. Vet. Diagn. Invest. 13, 162-164 (2001).</li><li>Handel, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+buccal+swabs+for+sampling+DNA+from+nestling+and+adult+birds.">Use of buccal swabs for sampling DNA from nestling and adult birds.</a> Wildl. Soc. Bull. 34, 1094-1100 (2006).</li><li>Brubaker, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+noninvasive,+direct+real-time+PCR+method+for+sex+determination+in+multiple+avian+species.">A noninvasive, direct real-time PCR method for sex determination in multiple avian species.</a> Mol. Ecol. Resour. 11, 415-417 (2011).</li><li>Arima, H., Ohnishi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Usefulness+of+avian+buccal+cells+for+molecular+sexing.">Usefulness of avian buccal cells for molecular sexing.</a> Ornithological Science. 5, 139-143 (2006).</li><li>Seki, S. -. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+Ryukyu+Robins+Erithacus+komadori+using+buccal+cells+as+a+non-invasive+source+of+DNA.">Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA.</a> Ornithological Science. 2, 135-137 (2003).</li><li>Wellbrock, A. H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Buccal+swabs+as+a+reliable+source+of+DNA+for+sexing+young+and+adult+Common+Swifts+(Apus+apus).">Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus).</a> J. Ornithol. 153, 991-994 (2012).</li><li>Marion, W. R., Shamis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotated-Bibliography+of+Bird+Marking+Techniques.">Annotated-Bibliography of Bird Marking Techniques.</a> Bird Banding. 48, 42-61 (1977).</li><li>Scharff, C., Adam, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurogenetics+of+birdsong.">Neurogenetics of birdsong.</a> Curr. Opin. Neurobiol. , (2012).</li><li>Griffith, S. C., Buchanan, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Zebra+Finch:+the+ultimate+Australian+supermodel.">The Zebra Finch: the ultimate Australian supermodel.</a> Emu. 110, 5-12 (2010).</li><li>Fee, M. S., Scharff, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+songbird+as+a+model+for+the+generation+and+learning+of+complex+sequential+behaviors.">The songbird as a model for the generation and learning of complex sequential behaviors.</a> Ilar J. 51, 362-377 (2010).</li><li>Honarmand, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stressful+dieting:+nutritional+conditions+but+not+compensatory+growth+elevate+corticosterone+levels+in+zebra+finch+nestlings+and+fledglings.">Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings.</a> PLoS On. 5, (1371).</li><li>Krause, E. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebra+finch+nestlings+beg+more+under+better+nutritional+conditions.">Zebra finch nestlings beg more under better nutritional conditions.</a> Behaviour. 148, 1239-1255 (2011).</li><li>Griffiths, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA+test+to+sex+most+birds.">A DNA test to sex most birds.</a> Mol. Ecol. 7, 1071-1075 (1998).</li><li>Pluthero, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+purification+of+high-activity+Taq+DNA+polymerase.">Rapid purification of high-activity Taq DNA polymerase.</a> Nucleic Acids Res. 21, 4850-4851 (1993).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Joint+Working+Group+on+Refinement.+Laboratory+birds:+refinements+in+husbandry+and+procedures.+Fifth+report+of+BVAAWF/FRAME/RSPCA/UFAW+Joint+Working+Group+on+Refinement.">Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement.</a> Lab Anim. 35, 1-163 (2001).</li></ol>

יש המחברים אין לחשוף.

זיהוי מין ממטליות buccal באמצעות Chelex הראה שיעור הצלחה גבוה מאוד. הנוצות למטה של ​​גוזל חיתוך אפשרו הבחנה בין גוזלים עד פסי רגל היו אפשריים. חילוץ Chelex-DNA ממטליות buccal הניב מספיק DNA כדי לבצע זיהוי מין באמצעים מולקולריים בהצלחה. קביעת מי...

הכרת פרט, זיהוי מין באמצעים וגנוטיפ הם תנאים מוקדמים בסיסיים במגוון רחב של מחקרים ניסיוניים. השגת חומר נושאות דנ&quot;א וסימון נושאים באופן חד משמעי (גם בגיל צעיר) צריכה להיות השפעה מינימאלית על פיזיולוגיה, התנהגות והישרדות. במידת האפשר, יש להימנע מפרוצדורות פולשניות על פי עיקרון RRR 1. שיטות לא פולשנית אינן מועילות רק לבעלי החיים אלא גם עשויה לשפר את הנתונים המתקבלים כחיות מושפעות פחות מהטיפולים. בציפורים, זיהוי מין באמצעי DNA יכולים להתבצע על מספר חומרים בר השגה הלא פולשני כגללים 2, נוצות 3,4 או מטליות buccal 3,5,9. ללא קשר למטליות buccal המצב וגיל של הנבדק הן שיטת בחירה של זיהוי מין באמצעי עופות, כי הם קלים לביצוע, רק לעתים נדירות מצליחות והטיפול הוא קצר. עד כה, ה-DNA ממטליות buccalהופק גם עם ערכות זמינות מסחרי 3,6 או זמן רב פרוטוקולי מיצוי DNA סטנדרטיים 3,6-8. ערכות הן לא רק יקרות למדי, אבל בפרוטוקולים שלהם יכולים להטיל אתגרים לעבודת שטח. כמה פרטים פרוצדורליים, כגון ייבוש ודגירה של דגימות, אינם מעשיים בתחום. במיוחד בסביבה שבי פרוטוקולי ניסוי דורשים טיפול תלוי מין ממוקדם ככל שלאחר דקות ספורות בקיעה, יש דחף לשיטה מהירה, לא פולשנית, אמינה וקלה להשגת תוצאות. מעבר למיני עופות ארגז כלים משמעותיים ליחידים לציון פותחו 10. המגוון הרחב של הטכניקות זמינות חשבונות עבור מגוון רחב של מטרות מחקר, מינים ותקציבים. עם זאת, סימון גוזלים קטנים התמודד חוקרים עם אתגרים נוספים. בכמה מיני אפרוחים (למשל passerines) הם קטנים מדי כדי להחיל להקות רגל ודורשים שיטות חלופיות, אשראינו משנה הורה לצאצאי התנהגות. כמודעות ועניין בשיפור רווחת בעלי חיים וטכניקות במחקרי שדה ומעבדה גדלה, השימוש בטכניקות לא פולשנית הוא מומלץ מאוד ועדיף. פרוטוקול זה מספק שיטה לא פולשנית, מהירה, קל לזיהוי ומתמשכת לציון גוזלים צעירים מאוד אינדיבידואלי לפני יישום להקות רגל אינו ריאלי. שיטת סימון זו הציגה באחד מיני מודל מעבדת עופות החשובים ביותר, הזברה פינק (guttata Taeniopygia) 11-13. הפרוטוקול עומד בכל המטרות שפורסמו בעבר לטכניקות סימון בודד 10 וכבר הוחל 14,15 בהצלחה.

<table border="0" cellpadding="0" cellspacing="0" width="702">
	<tbody>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">Whatman 3MM Chromatography paper</td>
			<td style="width:163px;">e.g. Fisher Scientific</td>
			<td style="width:269px;">No.:3030-153</td>
			<td style="width:80px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:191px;">Chelex 100 Resin</td>
			<td style="width:163px;">Biorad</td>
			<td style="width:269px;">#143-2832</td>
			<td></td>
		</tr>
		<tr height="50">
			<td height="50" style="height:50px;width:191px;">Taq polymerase</td>
			<td style="width:163px;">addgene</td>
			<td style="width:269px;">http://www.addgene.org/25712/</td>
			<td></td>
		</tr>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">leg band (Flexi number rings for birds, diameter 2,5 mm)</td>
			<td style="width:163px;">Horst Stengel &#38; Sohn</td>
			<td style="width:269px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

who is who? non-invasive methods to individually sex and mark altricial chicks

ניסויים רבים דורשים נחישות מוקדמת של המין של הצאצאים, כמו גם מוקדם סימון של יילודים לזיהוי פרט. על פי הנחיות לרווחת בעלי החיים, יש להעדיף טכניקות לא פולשנית בכל פעם שישימה. בקבוצה שלנו, אנחנו עובדים על מינים שונים של ציפורים שיר במעבדה ובשדה, ואנחנו מיישמים בהצלחה בשיטות שאינן פולשנית למין ובנפרד לסמן אפרוחים. מאמר זה מציג ארגז כלים לא פולשנית מקיף. זיהוי מין ציפורים לפני הביטוי של תכונות מיניות משניים דורש איסוף חומר DNA נושא עבור ה-PCR. הקמנו שיטה מהירה וקלה לציפורים ממין בכל גיל (לאחר בקיעה) על ידי מיצוי DNA ממטליות buccal. ניתן להשיג תוצאות בתוך 3 שעות. לנוצות במורד של חומוס סימון בודד הם גזומים בדפוסים מסוימים המאפשרים זיהוי מהיר בתוך סדר הבקיעה. זו קבוצה של שיטות היא ישימה בקלות במעבדה סטנדרטית מאובזרת ומתאים במיוחד לעובדg בתחום כללא ציוד מיוחד הנדרש לדגימה ואחסון. טיפול באפרוחים הוא ממוזער וטכניקות לסימון וזיהוי מין הן לא פולשנית וכך תומכות RRR-העיקרון של קווים מנחים לרווחת בעלי החיים.

<html> מטליות buccal יכולות לשמש כדי להשיג DNA לקביעת מין במגוון רחב של ציפורים קטנות דגימות נאספו מהזברה פינק (guttata Taeniopygia, 99 אנשים, גיל 0 ימים - 5 שנים), כנריות (קנריה Serinus), Bengalese פינק (striata Lonchura), זמירים (megarhynchos זמיר), שדיים ג?...

Watch this Scientific Journal Video about Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks at JoVE.com

Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

פרוטוקול זה מספק ערכה נוחה של שיטות, אשר מאפשרת מהיר מאוד, קל, לא פולשנית, אמין ובעלות נמוכה, נחישות מולקולרית מין של ציפורים ולא פולשנית מהירה, בטוח וקלה לזיהוי לסימונם, זמן קצר לאחר הבקיעה. רק טיפול מוגבל של אפרוחים נדרש. ארגז כלים נוחים זה של שיטות תואם לחלוטין עם RRR-ההנחיות.

מי הוא מי? שיטות לא פולשנית בנפרד כדי סקס ואפרוחים חובשי קן מארק

Many experiments require early determination of offspring's sex as well as early marking of newborns for individual recognition. According to animal ...

who-is-who-non-invasive-methods-to-individually-sex-mark-altricial

Research

JoVE Journal

Biology

18.2K Views.  Freie Universität Berlin.  פרוטוקול זה מספק ערכה נוחה של שיטות, אשר מאפשרת מהיר מאוד, קל, לא פולשנית, אמין ובעלות נמוכה, נחישות מולקולרית מין של ציפורים ולא פולשנית מהירה, בטוח וקלה לזיהוי לסימונם, זמן קצר לאחר הבקיעה. רק טיפול מוגבל של אפרוחים נדרש. ארגז כלים נוחים זה ?...

Video: Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Labeling hESCs and hMSCs with Iron Oxide Nanoparticles for Non-Invasive in vivo Tracking with MR Imaging

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative medicine. A non-invasive method to monitor the transplanted stem cells repeatedly in vivo would greatly enhance our ability to understand the mechanisms that control stem cell death and identify trophic factors and signaling pathways that improve stem cell engraftment. MR imaging has been proven to be an effective tool for the in vivo depiction of stem cells with near microscopic anatomical resolution. In order to detect stem cells with MR, the cells have to be labeled with cell specific MR contrast agents. For this purpose, iron oxide nanoparticles, such as superparamagnetic iron oxide particles (SPIO), are applied, because of their high sensitivity for cell detection and their excellent biocompatibility. SPIO particles are composed of an iron oxide core and a dextran, carboxydextran or starch coat, and function by creating local field inhomogeneities, that cause a decreased signal on T2-weighted MR images. This presentation will demonstrate techniques for labeling of stem cells with clinically applicable MR contrast agents for subsequent non-invasive in vivo tracking of the labeled cells with MR imaging.

For the evaluation of new stem cell therapies it is important to non-invasively track the injected cells in vivo. This video will show you how to label human mesenchymal and embryonic stem cells with iron oxide based contrast agents in vivo for subsequent MR imaging in vivo.

תיוג hESCs ו hMSCs עם ברזל אוקסיד חלקיקים עבור פולשני של מעקב vivo עם MR Imaging

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative ...

Labeling Stem Cells with Fluorescent Dyes for non-invasive Detection with Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo labeling of stem cells with a fluorescent dye, subsequent intravenous injection of the labeled cells and visualization of their accumulation in specific target organs or pathologies. The presented technique demonstrates how we label human mesenchymal stem cells (hMSC) by simple incubation with the lipophilic fluorescent dye DiD (C67H103CIN2O3S) and how we label human embryonic stem cells (hESC) with the FDA approved fluorescent dye Indocyanine Green (ICG). The uptake mechanism is via adherence and diffusion of the lypophilic dye across the phospholipid cell membrane bilayer. The labeling efficiency is usually improved if the cells are incubated with the dye in serum-free media as opposed to incubation in serum-containing media. Furthermore, the addition of the transfection agent Protamine Sulfate significantly improves contrast agent uptake.

This video shows techniques for labeling of human embryonic stem cells and mesenchymal stem cells with fluorescent dyes. This technique can be used for an in vivo tracking of transplanted stem cells with optical imaging and for histopathological correlations with fluorescence microscopy.

תיוג בתאי גזע עם צבעי ניאון על איתור פולשני עם דימות אופטי

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo ...

Non-invasive 3D-Visualization with Sub-micron Resolution Using Synchrotron-X-ray-tomography

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard cuticle which makes it difficult to use protocols of classical histology. In addition, histological sectioning destroys the sample and can therefore not be used for unique material. Hence, a non-destructive method is desirable which allows to view inside small samples without the need of sectioning.
We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) in Grenoble (France) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows us to reconstruct the internal organization in its natural state without the artefacts produced by histological sectioning. These date can be used for quantitative morphology, landmarks, or for the visualization of animated movies to understand the structure of hidden body parts and to follow complete organ systems or tissues through the samples.

We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows the reconstruction of internal structures in their natural state without the artefacts produced by histological sectioning.

לא פולשני-3D ויזואליזציה עם תת מיקרון החלטה שימוש Synchrotron-X-ray-טומוגרפיה

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard ...

A Magnetic Tether System to Investigate Visual and Olfactory Mediated Flight Control in Drosophila

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. As such, visual stabilization of upwind tracking directly aids in odor tracking. But do olfactory signals directly influence visual tracking behavior independently from wind cues? Also, the recent deluge of research on the neurophysiology and neurobehavioral genetics of olfaction in Drosophila has motivated ever more technically sophisticated and quantitative behavioral assays. Here, we modified a magnetic tether system originally devised for vision experiments by equipping the arena with narrow laminar flow odor plumes. A fly is glued to a small steel pin and suspended in a magnetic field that enables it to yaw freely. Small diameter food odor plumes are directed downward over the fly s head, eliciting stable tracking by a hungry fly. Here we focus on the critical mechanics of tethering, aligning the magnets, devising the odor plume, and confirming stable odor tracking.

Here we describe how to tether a fly in an olfactory magnetic-tether (OMT) apparatus. We describe how to align the rare-earth magnets and odor ports, and how to set mass flow rates for both the stimulus delivery and vacuum suction to achieve optimal odor tracking.

מערכת מגנטית לקשור לחקור חזותית חוש הריח בקרת טיסה מתווך תסיסנית

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. ...

Cell Block Preparation from Cytology Specimen with Predominance of Individually Scattered Cells

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually scattered cells and small cell groups. This technique uses HistoGel (Thermo Scientific) with conventional laboratory equipment.
The use of cell block sections is a valuable ancillary tool for evaluation of non-gynecologic cytology. They enable the cytopathologist to study additional morphologic specimen detail including the architecture of the lesion. Most importantly, they allow for the evaluation of ancillary studies such as immunocytochemistry, in-situ hybridization tests (FISH/CISH) and in-situ polymerase chain reaction (PCR). Traditional cell block preparation techniques have mostly been applied to non-gynecologic cytology specimens, typically for body fluid effusions and fine needle aspiration biopsies.
Liquid based cervicovaginal specimens are relatively less cellular than their non-gynecologic counterparts with many individual scattered cells. Because of this, adequate cellularity within the cell block sections is difficult to achieve. In addition, the histotechnologist sectioning the block cannot visualize the level at which the cells are at the highest concentration. Therefore, it is difficult to monitor the appropriate level at which sections can be selected to be transferred to the glass slides for testing. As a result, the area of the cell block with the cells of interest may be missed, either by cutting past or not cutting deep enough. Current protocol for Shidham's method addresses these issues. Although this protocol is standardized and reported for gynecologic liquid based cytology specimens, it can also be applied to non-gynecologic specimens such as effusion fluids, FNA, brushings, cyst contents etc for improved quality of diagnostic material in cell block sections.

Shidham's method for preparation of cell blocks with AV-marker from cytology specimens containing individually scattered cells and small cell groups.

בלוק תא הכנה מן הדגימה ציטולוגיה עם דומיננטיות של תאים פזורים בנפרד

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually ...

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing and adult tissue. An advance in this concept is Genetic Inducible Fate Mapping (GIFM), linking gene expression, cell fate, and cell behaviors in vivo, to create fate maps based on genetic lineage.
GIFM exploits X-CreER lines where X is a gene or set of gene regulatory elements that confers spatial expression of a modified bacteriophage protein, Cre recombinase (CreERT). CreERT contains a modified estrogen receptor ligand binding domain which renders CreERT sequestered in the cytoplasm in the absence of the drug tamoxifen. The binding of tamoxifen releases CreERT, which translocates to the nucleus and mediates recombination between DNA sequences flanked by loxP sites. In GIFM, recombination typically occurs between a loxP flanked Stop cassette preceding a reporter gene such as GFP.
Mice are bred to contain either a region- or cell type-specific CreER and a conditional reporter allele. Untreated mice will not have marking because the Stop cassette in the reporter prevents further transcription of the reporter gene. We administer tamoxifen by oral gavage to timed-pregnant females, which provides temporal control of CreERT release and subsequent translocation to the nucleus removing the Stop cassette from the reporter. Following recombination, the reporter allele is constitutively and heritably expressed. This series of events marks cells such that their genetic history is indelibly recorded. The recombined reporter thus serves as a high fidelity genetic lineage tracer that, once on, is uncoupled from the gene expression initially used to drive CreERT.
We apply GIFM in mouse to study normal development and ascertain the contribution of genetic lineages to adult cell types and tissues. We also use GIFM to follow cells on mutant genetic backgrounds to better understand complex phenotypes that mimic salient features of human genetic disorders.
This video article guides researchers through experimental methods to successfully apply GIFM. We demonstrate the method using our well characterized Wnt1-CreERT;mGFP mice by administering tamoxifen at embryonic day (E)8.5 via oral gavage followed by dissection at E12.5 and analysis by epifluorescence stereomicroscopy. We also demonstrate how to micro-dissect fate mapped domains for explant preparation or FACS analysis and dissect adult fate-mapped brains for whole mount fluorescent imaging. Collectively, these procedures allow researchers to address critical questions in developmental biology and disease models.

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Genetic Inducible Fate Mapping (GIFM) marks and tracks cells with fine spatial and temporal control in vivo and elucidates how cells from a specific genetic lineage contribute to developing and adult tissues. Demonstrated here are the techniques required to fate map E12.5 mouse embryos for epifluorescent and explant analysis.

גישה מעשית מיפוי גנטי ועין מתנהלת הגורל: מדריך חזותי כדי מארק עקוב אחר תאים In vivo</em

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing ...

A Reversible, Non-invasive Method for Airway Resistance Measurements and Bronchoalveolar Lavage Fluid Sampling in Mice

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated procedures to obtain such measurements in the same animal are generally not feasible.  Here, we demonstrate protocols for obtaining from mice repeated measurements of AHR and bronchoalveolar lavage fluid samples.  Mice were challenged intranasally seven times over 14 days with a potent allergen or sham treated.  Prior to the initial challenge, and within 24 hours following each intranasal challenge, the same animals were anesthetized, orally intubated and mechanically ventilated.  AHR, assessed by comparing dose response curves of respiratory system resistance (RRS) induced by increasing intravenous doses of acetylcholine (Ach) chloride between sham and allergen-challenged animals, were determined.  Afterwards, and via the same intubation, the left lung was lavaged so that differential enumeration of airway cells could be performed.  These studies reveal that repeated measurements of AHR and BAL fluid collection are possible from the same animals and that maximal airway hyperresponsiveness and airway eosinophilia are achieved within 7-10 days of initiating allergen challenge.  This novel technique significantly reduces the number of mice required for longitudinal experimentation and is applicable to diverse rodent species, disease models and airway physiology instruments.  

Repeated measurements of rodent respiratory physiology and sampling of airway inflammatory cells are desirable, but generally not feasible. Here we describe a repeatable method for orally intubating mice that permits repeated measurements of airway hyperreactivity and sampling of airway inflammatory cells.

הפיך, לא פולשני שיטת ההתנגדות מדידות דרכי הנשימה ואת נוזל שטיפה ברונכואלוואולרית דגימה של עכברים

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

ניתוח Glucocorticoid צואה: לא פולשני ניטור הכליה ב Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

Methods to Discover Alternative Promoter Usage and Transcriptional Regulation of Murine Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually untranslated &#8212; first exons. Bcrp1 (Abcg2), the murine orthologue of the ABC transporter Breast Cancer Resistance Protein (BCRP, ABCG2), has at least four alternative promoters that are designated by the corresponding four alternative first exons produced: E1U, E1A, E1B, and E1C. Herein, in-silico protocols are presented to predict alternative promoter usage for Bcrp1. Furthermore, reporter assay methods are described to produce reporter constructs for alternative promoters and to determine the functionality of putative promoters upstream of the alternative first exons that are identified.

With the murine ABC transporter Bcrp1 (Abcg2) as an example, in-silico protocols are presented to detect alternative promoter usage in genes expressed in mouse tissues, and to evaluate the functionality of the alternative promoters identified using reporter assays.

שיטות לגלות אלטרנטיבי שימוש יזם ותקנת תעתיק של Murine Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually ...

Methods to Classify Cytoplasmic Foci as Mammalian Stress Granules

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to stress conditions, are implicated in various aspects of cell metabolism and survival. SGs modulate cellular signaling pathways, post-transcriptional gene expression, and stress response programs. The formation of these mRNA-containing granules is directly connected to cellular translation. SG assembly is triggered by inhibited translation initiation, and SG disassembly is promoted by translation activation or by inhibited translation elongation. This relationship is further highlighted by SG composition. Core SG components are stalled translation pre-initiation complexes, mRNA, and selected RNA-binding Proteins (RBPs). The purpose of SG assembly is to conserve cellular energy by sequestering translationally stalled housekeeping mRNAs, allowing for the enhanced translation of stress-responsive proteins. In addition to the core constituents, such as stalled translation preinitiation complexes, SGs contain a plethora of other proteins and signaling molecules. Defects in SG formation can impair cellular adaptation to stress and can thus promote cell death. SGs and similar RNA-containing granules have been linked to a number of human diseases, including neurodegenerative disorders and cancer, leading to the recent interest in classifying and defining RNA granule subtypes. This protocol describes assays to characterize and quantify mammalian SGs.

Stress Granules (SGs) are nonmembranous cytoplasmic structures that form in cells exposed to a variety of stresses. SGs contain mRNAs, RNA-binding proteins, small ribosomal subunits, translation-related factors, and various cell signaling proteins. This protocol describes a workflow that uses several experimental approaches to detect, characterize, and quantify bona fide SGs.

שיטות לסיווג מוקדים Cytoplasmic כמו גרגרי מתח יונקים

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to ...