מחקר זה מומן על ידי הקרן הלאומית למדע מענק IOS-1025642 (GBM). אנו מודים מריה הריסון למתן את המתח ARqua1.

1. עיצוב מדריך RNA ובינוי וקטור <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לזהות רצפי היעד עבור הגנים של עניין. יש מגוון של תוכניות יעד-מציאת CRISPR באינטרנט מתאימה בשלב זה 13,14. הערה: כאן אנו משתמשים מוטיב היעד GN 20 GG, אבל עיצובים אחרים עשויים להיות מתאימים בהתאם למערכת יישום או וקטור בשימוש. </li><li style=";text-align:right;direction:rtl"> עיצוב 60-mer oligos gRNA לכלול את חלק 19 GN של מוטיבי היעד מוקפים 5 &#39;ו 3&#39; 20-NT רצפים שנדרשים הרכבת DNA. מוטיב 60-mer הסופי הוא: 5&#39;-TCAAGCGAACCAGTAGGCTT-GN 19 -GTTTTAGAGCTAGAAATAGC-3 &quot;. הערה: רגיל, desalted פריימרים לעבוד בסדר. </li><li style=";text-align:right;direction:rtl"> הכן את הארבע DNAs להרכבה (איור 1). ראה קובץ משלים רצפי DNA. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תקציר 1 - 5 מיקרוגרם של p201N: Cas9 10 פלסמיד עם אנזים הגבלה Spe לי ב 1x הצפת 4 ב 37 מעלות צלזיוס למשך 2 שעות. טור-לטהר את לעכלccording להוראות היצרן. Resuspend ב ~ 15 μl של 10 mM Tris-HCl, ולכמת ידי spectrophotometry UV. </li><li style=";text-align:right;direction:rtl"> בצע לעכל שני עם אנזים ההגבלה Swa לי ב 1x הצפת 3.1 ב 25 מעלות צלזיוס למשך 2 שעות. בדקו 100 - 200 ng על ג&#39;ל agarose 0.8% כדי לאשר עיכול שלם. הערה: פלסמיד מתעכל כראוי יהיה להקה אחת ב 14,313 BP. הערה: איון חום של האנזים dephosphorylation אינו נדרש. פלסמיד מתעכל עשוי להיות מאוחסן ב -20 ° C. </li><li style=";text-align:right;direction:rtl"> PCR להגביר את truncatula Medicago (הר) DNAs האמרגן פיגום U6 מן הפלסמיד Puc gRNA הסעות 10 באמצעות פריימרים Swa I_MtU6F / MtU6R ו ScaffoldF / Spe I_ScaffoldR, בהתאמה. השתמש פולימראז באיכות גבוהה עם תנאי PCR: 95 מעלות צלזיוס במשך 3 דקות; 31 מחזורים (98 מעלות צלזיוס למשך 20 שניות, 60 מעלות צלזיוס למשך 15 שניות, 72 ° C למשך 30 שניות); ו 72 מעלות צלזיוס למשך 5 דקות. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> דמיינו ~ 3 aliquots μl של pr PCRoducts על ג&#39;ל agarose 1% כדי לאשר הגברה. Amplicon MtU6 הוא 377 נ&quot;ב ואת amplicon הפיגום הוא 106 נ&quot;ב. טור-לטהר את מוצרי ה- PCR שנותרו על פי הוראות היצרן, לכמת ידי לספקטרופוטומטריה UV ולאחסן ב -20 מעלות צלזיוס. </li></ol></li><li style=";text-align:right;direction:rtl"> Resuspend הצינור כולו של oligos gRNA 100 מיקרומטר במים מעבדה כיתה. הוסף 1 μl של 100 מיקרומטר אוליגו 500 μl של 1x הצפת 2.1. מערבבים היטב. אם איגום oligos המרובה, להוסיף 1 μl של כל אוליגו 100 מיקרומטר אל צינור 1x הצפת 2.1. oligos המדולל ניתן לאחסן ב -20 ° C. </li></ol></li><li style=";text-align:right;direction:rtl"> לתכנת Cycler תרמית להחזיק ב 50 מעלות צלזיוס, באמצעות מכסה מחומם. מערבבים 100 ננוגרם (0.011 pmol) של וקטור לינארית, 50 ng (0.2 pmol) של האמרגן MtU6, 12 ng (0.2 pmol) של הפיגום, 1 μl (0.2 pmol) של אוליגו gRNA מדולל (ים), ומים בהיקף של 5 μl. הוסף 5 μl של תמהיל מאסטר הרכבה DNA באיכות גבוהה 2x, מערבבים היטב ספין למטה. דגירת תגובה במשך 60 דקות ב50 ° C Cycler תרמית. אז במקום את התגובה על הקרח. הערה: ניתן להגדיל כמויות תגובה כדי להתאים תשואות DNA נמוכות. </li><li style=";text-align:right;direction:rtl"> Transform 2 μl של התגובה לתוך E. המוסמכת קולי תאים באמצעות טכניקות סטנדרטיות צלחת על LB בתוספת 50 מ&quot;ג ל -1 kanamycin (Kan 50). לגדול-תאים מצופים ב 37 מעלות צלזיוס למשך הלילה. שמור את תגובת ההרכבה DNA הנותר ב -20 ° C. </li><li style=";text-align:right;direction:rtl"> מסך המושבה על ידי PCR באמצעות פריימרים StUbi3P218R ו ISceIR. לדלל aliquot של תגובת ההרכבה DNA הנותרת במים 1: 5. השתמש 1 μl כביקורת חיובית עבור מסך המושבה 1 ננוגרם של p201N המעגלי: פלסמיד Cas9 כביקורת ללא הוספה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> PCR להגביר את התנאים; 95 מעלות צלזיוס במשך 3 דקות; 31 מחזורים (95 מעלות צלזיוס למשך 30 שניות, 58 ° C למשך 30 שניות, 72 ° C למשך 30 שניות); ו ב 72 מעלות צלזיוס למשך 5 דקות. דמיינו מוצרי ה- PCR על ג&#39;ל 1% agarose. ודא הוספות נכונות יש להקה ב 725 נ&quot;ב ו וקטורי שנינותמוסיף Hout (למשל, וקטור נימול) תהיה להקה 310-BP. </li></ol></li><li style=";text-align:right;direction:rtl"> לגדול מושבות חיוביות LB Kan 50 תרבויות נוזלי הלילה בשעת 37 ° C ולטהר פלסמידים פי הוראות היצרן. רצף סנגר פלסמידים עם פריימר StUbi3P218R וליישר chromatograms אמרגן MtU6, היעד, רצפי הפיגום כדי להבטיח שאין טעויות הוכנסו במהלך שיבוט. </li><li style=";text-align:right;direction:rtl"> בצע אבחון לעכל ידי לעכל ~ 1 מיקרוגרם של פלסמיד עם RV אקו ואני בדיר דמיינו על ג&#39;ל 0.8% agarose. שברים (ב BP) הם: 4192, 2001, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, ו -174. </li><li style=";text-align:right;direction:rtl"> השתמש הרכבת DNA לבנות וקטורים עם gRNAs המרובה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כדי לבנות וקטור עם שתי קלטות gRNA, PCR להגביר את gRNA-העמדה הראשונה עם פריימרים Swa I_MtU6F / UNS1_ScaffoldR ואת gRNA שנייה עמדה עם פריימרים UNS1_MtU6F / Spe I_ScaffoldR מ -1 ng של כל אחד בהתאמהפלסמידים נבנה בשלבים 1.1 - 1.8. השתמש תנאי PCR בשלב 1.3.3. דמיינו ~ 3 aliquots μl של מוצרי ה- PCR על ג&#39;ל agarose 1% כדי לאשר הגברה. Amplicons הם ~ 500 נ&quot;ב. </li><li style=";text-align:right;direction:rtl"> מערבבים ומערבבים כמויות שווה של מוצרי ה- PCR מטוהרים האו&quot;ם בתוך שפופרת 200 μl (בדרך כלל 3 - 4 μl של כל אחד). להרכבה, להוסיף 1 μl בשילוב מוצרי ה- PCR, 50 ng של Swa לי ו SPE שאני לינארית p201N: Cas9, מים מעבדה כיתה 2.5 μl 2.5 μl של תמהיל מאסטר הרכבה DNA באיכות גבוהה 2x. מדגירים את Cycler תרמית 50 מעלות צלזיוס במשך 15 דקות. הערה: מדריכי DNA ההרכבה ממליץ על דגירת 15 דקות עבור 2 - 3 שברים. </li><li style=";text-align:right;direction:rtl"> Transform 1 - 2 μl לתוך E. המוסמכת תאי צלחת coli על LB Kan 50. לגדל תאים מצופים ב 37 מעלות צלזיוס למשך לילה. שמור את התגובה הנותרים ב -20 ° C. </li><li style=";text-align:right;direction:rtl"> מסך מושבה על ידי PCR עם פריימרים StUbi3P218R ו ISceIR עם אותם התנאים כמו צעד 1.6. ג הנכונהlones תהיה amplicon 1,200 נ&quot;ב. לגדול מושבות חיוביות LB Kan 50 תרבויות נוזלי הלילה ולטהר פלסמידים. </li><li style=";text-align:right;direction:rtl"> פלסמידים רצף סנגר עם StUbi3P218R פריימרים (מכסה-העמדה הראשונה gRNA) ו p201R (מכסה-העמדה השנייה gRNA). יישר chromatograms אל רצפי אמרגן, יעד, פיגום MtU6. האבחון לעכל עם RV אקו בדיר שאני אביא את שהברים הבאים (נ&quot;ב): 4192, 2476, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, 174. שבר מודגש מכיל את gRNA השני. </li></ol></li><li style=";text-align:right;direction:rtl"> אחרי הפגישה כל הציפיות-בקרת איכות, להפוך פלסמידים לתוך Agrobacterium rhizogenes זן ARqua1 15. הוסף 1 μl של הכנה פלסמיד 50 μl של תאים electrocompetent ו electroporate ב קובט 1 מ&quot;מ עם הגדרות: 2.4 קילו וולט, 25 μF, ו -200 Ω. שחזור תאים ~ 500 μl של SOC ולנער על 28 מעלות צלזיוס למשך 2 שעות. פלייט על LB Kan 50 גרםשורה על 28 מעלות צלזיוס למשך 2 ימים. בצע מסך המושבה באמצעות באותו פריימרים ותנאי PCR כמו 1.3.3. הפוך מניות גליצרול של שיבוטים חיוביים. </li></ol> 2. טרנספורמציה שעירים שורש <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לעקר זרעי עגבניות ב אקונומיקה ביתית 20% במשך 15 דקות, עם ערבוב מתמיד. במנדף זרימה למינרית, להסיר את האקונומיקה ולשטוף במי מעבדת כיתה סטריליים 3 פעמים. </li><li style=";text-align:right;direction:rtl"> פלייט 30 זרעים בקופסה GA-7 המכיל התקשורת ½ MS (2.22 גרם ל -1 מלחים MS + Gamborg ויטמינים, 10 גרם ל -1 סוכרוז, 3 גרם ל -1 מסטיק gellan, pH 5.8). לנבוט עבור ~ 2 ימים בחושך, ואז לעבור GA-7 תיבות אור. לגדל שתילים עבור ~ 4 ימים יותר באור. </li><li style=";text-align:right;direction:rtl"> היום לפני השינוי, מתוך פס א rhizogenes תרבויות על LB Kan 50 ולגדול מוצק ב 28 מעלות צלזיוס למשך הלילה. </li><li style=";text-align:right;direction:rtl"> יום של טרנספורמציה, בשכונת הזרימה למינרית להרכיב חומרים מעוקרים: 12 מיליליטר צינורות תרבות, 50 מ&quot;ל צינור חרוטים, ½ נוזל MS (לא גרם gellanאממ), 200 מיקרומטר acetosyringone, נייר סינון, צלחות פטרי, מלקחיים אזמל, טפטפות וטיפים פיפטה. הוסף 25 μl של acetosyringone 50 מ&quot;ל של ½ MS ויוצקים ~ 6 מ&quot;ל לתוך צינור אחד תרבות. </li><li style=";text-align:right;direction:rtl"> השתמש טיפ 200 μl כפוף לגרד א rhizogenes תאים מהצלחת ו resuspend ב 6 מ&quot;ל של נוזל ½ MS. הצינור וורטקס resuspend התאים לחלוטין. לאחר resuspending תאים מפני כל וקטור, למדוד את הצפיפות האופטית (OD) של 1 מיליליטר של תאים באורך גל קבוע של 600 ננומטר. ודא OD הוא בין 0.2 ו 0.4; לדלל או להוסיף עוד תאים לפי הצורך. חזור על הפעולה עבור כל מבנה. </li><li style=";text-align:right;direction:rtl"> הוסף ~ 2 מ&quot;ל של נוזל ½ MS כדי בצלחת פטרי עם נייר סינון סטרילי. cotyledons בלו מן השתילים ומניחים על נייר פילטר טבול. לאחר כל cotyledons כבר נאספו, לחתוך את דיסטלי ~ 1 ס&quot;מ הנחה של cotyledons, וכתוצאה מכך חלקים טבורית עם שני הקצוות לחתוך. להוסיף explants א פתרונות rhizogenes, לערבב, דגירה במשך 20 דקותעם היפוך מזדמן. הערה: כ 12 explants לכל לבנות משמשים באופן שגרתי, אם כי רבים כמו 80 explants כבר מחוסן ב 6 מ&quot;ל של א פתרון rhizogenes. </li><li style=";text-align:right;direction:rtl"> במהלך א דגירת rhizogenes, להוסיף נייר סינון כדי צלחות פטרי, לבנות לכל אחד טרנספורמציה. כמו כן נקבע ½ MS תקשורת מוצקה, ללא אנטיביוטיקה, בשכונת הזרימה למינרית לייבוש. </li><li style=";text-align:right;direction:rtl"> סקופ cotyledons מתוך א פתרון rhizogenes עם מלקחיים ומניחים סטרילי על נייר סינון יבש. מכסים עם מכסה פטרי כדי להבטיח רקמות שלא יתייבשו תוך שתמשיך השינוי הבא. cotyledons הכתם על נייר הסינון והעברה, abaxial כלפי מעלה, כדי ½ תקשורת MS. גלישת צלחות עם הקלטת וכירורגי שיתוף לטפח בחושך בטמפרטורת החדר למשך 2 ימים. </li><li style=";text-align:right;direction:rtl"> לאחר שיתוף טיפוח, cotyledons העברה, abaxial כלפי מעלה, כדי ½ התקשורת MS בתוספת 300 מ&quot;ג ל -1 ticarcillin / חומצה clavulanic (טים 300, כדי למנוע את צמיחת residרע&quot;מ א rhizogenes) ו קאן 50 (לבחירת צמח) ולעטוף בעזרת פלסטר. לשמור על תרבויות תחת אורות הניאון בטמפרטורת החדר עם photoperiod 16 שעות ביממה. </li><li style=";text-align:right;direction:rtl"> לאחר ~ 1.5 - 2 שורשים שבועות לפחות 2 ס&quot;מ אורך הם נכרת מן cotyledons באמצעות מלקחיים סטרילית אזמל והועברו ½ MS Kan 50 טים 300 מדיה. העבר 10 עד 15 שורשי צלחת אחת. סמן את המיקום של טיפים שורש בטוש, לעטוף בעזרת פלסטר, ולשמור בחדר התרבות. </li><li style=";text-align:right;direction:rtl"> אחרי שבוע אחד, שורשי טרנספורמציה נראים הגוברים על התקשורת סלקטיבית. בציר subsample של שורשי טרנספורמציה להפקת DNA בשיטת DNA שאיבת המועדפת. הערה: צלחות עם cotyledons יכולות להישמר במשך 2 - 3 יבולים שבועיים, ולאחר מכן הם השורשים לצמוח לתוך בלגן סבוך וקשים לבודד. יכול להישמר רקמות השורש ללא שנקטפו ללא הגבלת זמן. מגוון של מבחנים יכול להתבצע על דגימת DNA המבודדתים כדי לקבוע תדירות מוטציה בדנ&quot;א וסוג. תוצאות מכמה מבחנים כאלה מתוארות להלן. </li></ol>

<ol><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li>
<li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li>
<li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-throughput+screening+of+a+CRISPR%2FCas9+library+for+functional+genomics+in+human+cells%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li>
<li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+new+frontier+of+genome+engineering+with+CRISPR-Cas9%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li>
<li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Editing+plant+genomes+with+CRISPR%2FCas9%5BTitle%5D)+AND+%22Current+Opinion+in+Biotechnology%22%5BJournal%5D)">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li>
<li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+CRISPR%2FCas9+system+for+plant+genome+editing+and+beyond%5BTitle%5D)+AND+%22Biotechnology+Advances%22%5BJournal%5D)">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li>
<li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeted+genome+editing+of+sweet+orange+using+Cas9%2FsgRNA%5BTitle%5D)+AND+%22Plos+One%22%5BJournal%5D)">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li>
<li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat%5BTitle%5D)+AND+%22G3-Genes+Genomes+Genetics%22%5BJournal%5D)">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li>
<li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model%5BTitle%5D)+AND+%22Plant+Physiology%22%5BJournal%5D)">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li>
<li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeted+genome+modifications+in+soybean+with+CRISPR%2FCas9%5BTitle%5D)+AND+%22BMC+Biotechnology%22%5BJournal%5D)">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li>
<li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chemical+synthesis+of+the+mouse+mitochondrial+genome%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li>
<li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate%3ACoA+ligase+specificity+and+redundancy%5BTitle%5D)+AND+%22New+Phytologist%22%5BJournal%5D)">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li>
<li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CCTop%3A+An+Intuitive%2C+Flexible+and+Reliable+CRISPR%2FCas9+Target+Prediction+Tool%5BTitle%5D)+AND+%22Plos+One%22%5BJournal%5D)">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li>
<li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-P%3A+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants%5BTitle%5D)+AND+%22Molecular+Plant%22%5BJournal%5D)">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li>
<li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES%5BTitle%5D)+AND+%22Molecular+Plant-Microbe+Interactions%22%5BJournal%5D)">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li>
<li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR%2FCas9+system%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li>
<li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Plant+genome+editing+made+easy%3A+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR%2FCas+system%5BTitle%5D)+AND+%22Plant+Methods%22%5BJournal%5D)">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39(2013).</li>
<li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+genome+engineering+using+CRISPR%2FCas+systems%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li>
<li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9%5BTitle%5D)+AND+%22Nat+Biotech%22%5BJournal%5D)">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li>
<li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li>
<li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li>
<li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+multiplicity+of+hairy+root+cultures%3A+Prolific+possibilities%5BTitle%5D)+AND+%22Plant+Science%22%5BJournal%5D)">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li>
<li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.%3A+sexual+transmission+of+the+transformed+genotype+and+phenotype%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li>
<li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Misexpression+of+miR482%2C+miR1512%2C+and+miR1515+Increases+Soybean+Nodulation%5BTitle%5D)+AND+%22Plant+Physiology%22%5BJournal%5D)">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li>
<li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations%5BTitle%5D)+AND+%22Molecular+Plant-Microbe+Interactions%22%5BJournal%5D)">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li>
<li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ex+vitro.+composite+plants%3A+an+inexpensive%2C+rapid+method+for+root+biology%5BTitle%5D)+AND+%22Plant+Journal%22%5BJournal%5D)">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li>
</ol>

החוקרים אין לי מה לחשוף.

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single, one-hour reaction and gRNA oligos can be pooled to further streamline the cloning procedure. Furthermore, the DNA assembly mechanism is independent of restriction enzymes, which makes this method compatible with virtually any DNA sequence. Conveniently, a master mix of the invariable DNA components (linearized vector, MtU6 promoter, and scaffold) can be made and stored at -20 &#176;C for later assemblies. 
While we use the GN20GG gRNA target motif, there are several alternative gRNA target motifs that can be used17. Shorter gRNAs have been demonstrated to increase specificity in animal cells20. By using a 5' G with a U6 promoter in the gRNA sequence (or A in the case of a U3 promoter), regardless if it matches the intended target sequence, the more abundant target motif N21GG may be used. However, the GN20GG target motif does not present a major technical limitation as several suitable targets can be found in most plant genes. The cloning scheme presented here can be easily modified to accommodate any gRNA design; simply substitute bases in the gRNA oligo.
Another advantage of the DNA assembly cloning system is that the same reagents can be used to insert multiple gRNAs into a single vector. A protocol for two gRNAs is presented here, and with the same methodology, using unique nucleotide sequences21 as spacers between gRNAs, it should be possible to assemble six gRNAs or more in a single cloning reaction.
As presented in step 1.9, the sequential cloning of gRNA vectors into a final multi-gRNA vector will take several days to perform because of the multiple cloning and screening steps. A modification of this protocol permits the construction of multi-gRNA vectors in a single day by bypassing the single-gRNA vector cloning step. First assemble individual gRNAs with just the MtU6 amplicon, gRNA oligo, and scaffold amplicon. Individual reactions must be performed for each gRNA. Following step 1.4, omit the linearized vector and reduce the 50 &#176;C incubation to 15 minutes. A 1:5 dilution of the reactions can be used as template in step 1.9.1. 
A potential problem with step 1.9 is the carry-over of residual single-gRNA plasmids from the PCR amplification of the gRNAs since all plasmids are selected with kanamycin. While we have never observed single-gRNA vectors in any of our colony screens following the specified protocol, gel purification of the PCR products or DpnI treatment of the PCR reactions could be used should the problem occur.
The ability to generate CRISPR vectors in a high-throughput manner necessitates a high-throughput method of generating transgenic materials to use the CRISPR vectors. Hairy roots are well suited for this task as they are technically simple to generate, require relatively little laboratory space to maintain and can be produced in a wide range of plant species22,23. However one limitation is that hairy roots are generally not used to generate whole plants and root systems are not suitable models for investigating most above-ground phenotypes. The former limitation may be advantageous when targeting genes that are null-lethal in whole-plant systems.
An important consideration for any transformation experiment is that results may vary with the different genotypes of plants and bacterial strains used. We routinely induce hairy roots in the cultivar (cv.) Rio Grande but have had difficulty obtaining hairy roots with cv. Moneymaker. Here, we report the use of the A. rhizogenes strain ARqua1, but it should be noted that strain ATCC 15834 has also been reported to work in tomato9.
Another critical consideration for hairy root transformation is the potential for overgrowth of A. rhizogenes on the cotyledon explants. Bacterial overgrowth typically leads to cotyledon death and low transformation efficiencies. Cotyledons must be blotted dry after soaking with A. rhizogenes. Likewise, co-cultivation should be limited to two days to prevent excessive bacterial overgrowth. Some bacterial growth is typically observed on co-cultivation plates, but should be absent once cotyledons are transferred to media containing ticarcillin/clavulanic acid.
The ease of constructing CRISPR vectors and generating hairy roots enables large-scale reverse-genetic screens, similar to those that are used in animal cell culture systems2. Hairy roots have been used to study a variety of plant functions including root development9, symbiotic associations24,25, and nematode resistance26 and the use of hairy roots for screening immunity-related genes is an area of active research in our lab. In addition to overexpression, gene silencing, and other transgenic technologies, targeted gene deletion via CRISPR/Cas9 is a powerful tool for functional genomic studies.

היכולת ליצור שינויי DNA ממוקדים עם CRISPR / יש Cas9 פוטנציאל גדול ללימודי גנומיקה תפקודית. ישנם שני מרכיבים של מערכת CRISPR / Cas9; nuclease Cas9, נגזר pyogenes Staphylococcus ו RNA מדריך כ 100-NT (gRNA) מולקולה שמנתב Cas9 לאתר DNA ממוקד (ים) 1. זיהוי מטרות הוענק על היד הראשונה ~ 20-NT של gRNA, המאפשר לייצור תפוקה גבוהה של וקטורי מיקוד 2,3. רוב האורגניזמים שיכול להיות מהונדסים, כבר היה עם CRISPR / Cas9 הטכנולוגיה 4,5. בצמחים, יזמים מכוננים, כמו המקדם 35S CaMV, משמשים בדרך כלל לנהוג הביטוי של nuclease Cas9 6. GRNAs באים לידי ביטוי באמצעות היזמים U6 או U3 RNA פולימראז III המגביל את הבסיס הראשון של gRNA או א G עבור U6 או עבור U3, שעתוק יעיל. עם זאת RNA פולימראז II לנשףoters, שהם ללא הגבלות אלה, יש גם שימש 7,8. gRNAs שונים לגרום מוטציות DNA עם יעילות שונים, ולכן זה יכול להיות חשוב כדי לאמת וקטורים CRISPR הראשון לפני השקעה טרנספורמציות כל-צמח או הגדרת מסכי פנוטיפי נרחב. ביטוי חולף של CRISPR בונה בצמחים, באמצעות agroinfiltration למשל, בדרך כלל תוצאות בתדירות נמוכה יותר של שינוי ה- DNA לעומת צמחים יציבים 6, ביצוע זיהוי של מוטציות מבחני פנוטיפי קשות מעשיים עם גישות כאלה. מה שנקראו שורשי שעירים הם מערכת נוחה, חלופה מאז מספר רב של עצמאיים, חומרים טרנספורמציה ביציבות יכול להיוצר תוך מספר שבועות, בניגוד לחודשים לצמחים יציבים. וקטורי CRISPR יעילים מאוד גרימת מוטציות DNA ב שורשי שעירי 9,10. שיטות הרכבת DNA ולקשור ביעילות שברת DNA המכיל overlapping מסתיים 11. יתרון עיקרי של כמה שיטות הרכבת DNA הוא היכולת לשלב ssDNA (כלומר, oligos) לתוך המוצרים הנאספים. מאז gRNAs הוא רק ~ 20-NT ארוך מטרות חדשות יכולות להתבצע עם oligos המסונתז, שיטות הרכבת DNA אלה בהחלט מתאימות לשיבוט CRISPR. הפרוטוקולים המתוארים כאן מבוססים על סדרת P201 של וקטורי CRISPR כי נעשה שימוש בהצלחת סויה 10, צפצפת 12 ועכשיו עגבניות. תהליך השכפול הציג מציע מספר יתרונות על פני שיטת השיבוט הנוכחית 10. כלומר, וקטורים מתפקדים במלואה יכולים להיוצר תגובת שיבוט יחידה ביום אחד. בניית וקטור ניתנת ותקווה גם כדי לייצר וקטורי CRISPR מרובים במקביל, מקטינה עוד יותר ידות על עלויות זמן וחומר. כמו כן, אנו מציגים פרוטוקול ההדור של שורשי שעירים עגבניים כמו שיטה יעילה להפקת חומרים מהונדסים עם מחיקות גן ממוקדות. שורשי שעירים משמשים תקףאכלו הווקטורים CRISPR ולספק חומר לניסויים הבאים.

<table><tbody><tr><td>NEBuilder&amp;reg; (HiFi DNA assembly mix)</td><td>New England Biolabs</td><td>E5520</td><td></td></tr><tr><td>p201N:Cas9</td><td>Addgene</td><td>59175</td><td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td></tr><tr><td>pUC gRNA Shuttle</td><td>Addgene</td><td>47024</td><td></td></tr><tr><td>&lt;em&gt;Swa&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0604S</td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0133S</td><td></td></tr><tr><td>Zymo clean and concentrator-5 column purification</td><td>Zymo Research</td><td>D4003</td><td></td></tr><tr><td>NEB Buffer 2.1</td><td>New England Biolabs</td><td>B7202S</td><td></td></tr><tr><td>NEB CutSmart (Buffer 4)</td><td>New England Biolabs</td><td>B7204S</td><td></td></tr><tr><td>NEB Buffer 3.1</td><td>New England Biolabs</td><td>B7203S</td><td></td></tr><tr><td>EconoSpin Mini Spin Column (plasmid prep)</td><td>Epoch Life Sciences</td><td>1910-050/250</td><td></td></tr><tr><td>EcoRV-HF&amp;reg;</td><td>New England Biolabs</td><td>R3195S</td><td></td></tr><tr><td>StyI-HF&amp;reg;</td><td>New England Biolabs</td><td>R3500S</td><td></td></tr><tr><td>MS Salts + Gamborg Vitamins</td><td>Phytotechnology Laboratories</td><td>M404</td><td></td></tr><tr><td>Phytagel&amp;trade; (gellan gum)</td><td>Sigma Aldrich</td><td>P8169</td><td></td></tr><tr><td>GA-7 Boxes</td><td>Sigma Aldrich</td><td>V8505</td><td></td></tr><tr><td>Micropore&amp;trade; surgical tape</td><td>3M</td><td>1535-0</td><td></td></tr><tr><td>Timentin&amp;reg; (Ticarcillin/Clavulanic acid)</td><td>Various</td><td>0029-6571-26</td><td></td></tr><tr><td>Primers 5&#039; &amp;#8594; 3&#039;</td><td></td><td></td><td></td></tr><tr><td>SwaI_MtU6F&amp;nbsp;</td><td>&lt;strong&gt;GATATTAATCTCTTCGATGA&lt;br/&gt;AATTT&lt;/strong&gt;ATGCCTATCTTATAT&lt;br/&gt;GATCAATGAGG</td><td></td><td></td></tr><tr><td>MtU6R&amp;nbsp;&amp;nbsp;</td><td>AAGCCTACTGGTTCGCTTG&lt;br/&gt;AAG</td><td></td><td></td></tr><tr><td>ScaffoldF&amp;nbsp;</td><td>GTTTTAGAGCTAGAAATAGC&lt;br/&gt;AAGTT</td><td></td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I_Scaffold R</td><td>&lt;strong&gt;GTCATGAATTGTAATACGACTC&lt;br/&gt;A&lt;/strong&gt;AAAAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>StUbi3P218R&amp;nbsp;</td><td>ACATGCACCTAATTTCACTA&lt;br/&gt;GATGT</td><td></td><td></td></tr><tr><td>ISceIR</td><td>GTGATCGATTACCCTGTTAT&lt;br/&gt;CCCTAG</td><td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td><td></td></tr><tr><td>UNS1_Scaffold R&amp;nbsp;</td><td>GAGAATGGATGCGAGTAATGAA&lt;br/&gt;AAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>UNS1_MtU6 F&amp;nbsp;&amp;nbsp;</td><td>CATTACTCGCATCCATTCTCAT&lt;br/&gt;GCCTATCTTATATGATCAATGAGG</td><td></td><td></td></tr><tr><td>p201R&amp;nbsp;</td><td>CGCGCCGAATTCTAGTGATCG</td><td></td><td></td></tr><tr><td>Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td><td></td><td></td><td></td></tr></tbody></table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

בניית וקטור CRISPR עם הרכבת DNA בדרך כלל מייצרת עשרות עד מאה שיבוטים עצמאיים. הקרנת מושבה על ידי PCR בקלות מזהה שיבוטים נכונים ויכולה להבחין בין פלסמידים עם ובלי הוסיף (איור 2 א) וזה שימושי לפתרון בעיות. בדרך כלל, כל השיבוטים מכילים אינסרט לבין משתמש יכול לבחור לדלג על שלבי הקרנת מושבה לגמרי. מעכל אבחון (איור 2 ב) ו רצף סנגר משמשים לבקרת איכות. כאשר טעויות מתרחשות, הם בדרך כלל הם נצפו באזורי DNA החופפים, כלומר, &quot;סוף אמרגן MtU6, את gRNA, או 3 &#39;5 בסוף רצף הפיגום. אם oligos gRNA המרובה הם אספו לתוך תגובה אחת, gRNAs נקבע על ידי רצף סנגר. השילוב של הפרט gRNAs מופץ באופן שווה ורוב gRNAs יכול להיות מבודד טרנספורמציה יחיד (איור 2 ג </sטרונג&gt;). תמהיל הרכבת DNA באיכות הגבוהה עדיף על פני שילוב הרכבת DNA הסטנדרטי כמו הגרסה באיכות הגבוהה הוא פחות מועדות לטעויות (איור 2 ג). עגבניות שורשים שעירים בדרך כלל הם נצפו שבוע עד שבועיים לאחר השינוי (איור 3 א). שורשים ≥2 ס&quot;מ אורך הם נכרת והועברו מצע סלקטיבי ושורשים עמידים kanamycin ניתן לזהות אחרי שבוע (איור 3B). רוב השורשים יגדלו במידה מסוימת על תקשורת סלקטיבית וצמיחת שורש שורשים שינו יכול להיות משתנה; אם ניתן, בחר את השורשים הגדלים ביותר נמרצות לניתוח. אחת לשני שורשים עמידים kanamycin הם בדרך כלל התאושש לכל טבורית מחוסן. עם העברות קבועות, שורשי טרנספורמציה יכולים להישמר ללא הגבלה זמן על תקשורת סלקטיבית. DNA מופק שורשים עמידים kanamycin ו- PCR משמש ומחזקיםy באזור היעד (ים). מוצרי ה- PCR יכולים לשמש במגוון של מבחנים כדי לקבוע את יעילות מוטציה, כגון שיבוט וסדר (איור 3 ג), ניתוח פולימורפיזם אורך קטע הגבלה, ג&#39;ל אלקטרופורזה polyacrylamide 16 (איור 3D), T7E1 endonuclease 16, או רצף amplicon תפוקה גבוהה 10. כפי שדווח במערכות צמח-CRISPR אחרים 6, תלוי ברצף gRNA / היעד הנבחר, מגוון של מוטציות יעילות מוטציה אפשר לראות. <img alt="איור 1" src="/files/ftp_upload/53843/53843fig1.jpg" /> . עיקרון באיור 1. אסיפת CRISPR בשנת תגובת הרכבת DNA, ארבעה DNAs מעורבבים יחד; p201N: Cas9 לינארית עם Swa לי ו SPE אני (העיגול שחור), אמרגן MtU6 (חץ ירוק), פיגום (פס צהוב) ואת אוליגו gRNA 60-mer המכיל את רצף היעד 19 GN (בlue בר). הקצוות של כל מולקולת הדנ&quot;א חופפים 20 נ&quot;ב עם החתיכה הסמוכה. תגובת DNA ההרכבה משלבת מחדש DNAs אלה לתוך מולקולה בודדת, עגולה. פריימר StUbi3p218R ו ISceIR אתרי קישור מסומן חיצים שחורים, 2x35S: קלטת Cas9 היא סגולה, StUbi3: קלטת nptII היא כתומה והשאיר וגבולות תקינים מסומנים עם פסים אפורים. הערה:. מפת הווקטור הוא לא בקנה מידה <a href="https://www.jove.com/files/ftp_upload/53843/53843fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/53843/53843fig2.jpg" /> הקרנת מושבת איור 2. פלסמיד בקרה איכות. א) הקרנת מושבה של 20 שיבוטים של הרכבת DNA וטרנספורמציה. M, סולם 100-BP; +, P201N: Cas9: שליטה חיובית GFPT2; NI, p201N: שליטה ללא הוספה Cas9; GA, תגובת הרכבה המדוללת DNA; NT, ללא תבנית מלאה. B) נציג תקציר של ארבעה p201N: Cas9: וקטורי gRNA עם הגבלת אנזימי RV אקו בדיר א M, 2-יומן סולם. ג) השוואה בין הנאמנות של ההתקן ותערובות הרכבת DNA באיכות גבוהה והפצה של וקטורים התאוששו כאשר 11 oligos gRNA היה נקווה לתוך לתגובה אחת. <a href="https://www.jove.com/files/ftp_upload/53843/53843fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/53843/53843fig3.jpg" /> איור 3. תרבויות שעירים שורש וזיהוי של שינוי ה- DNA. א) שורשים שעירים ניתן לראות העולה מתוך cotyledons 11 ימים לאחר השינוי. B) שורשים נבחרו על התקשורת 50 ½ MS קאן עבור כשבוע. ברי גריי לציין עמדת טיפי שורש בשעת הציפוי. C) דוגמא של שיבוטרצף לקבוע מוטציות DNA עם שתי מטרות גן שונות בארבעה אירועים שעיר-שורש שונים. תיבת גריי מציינת רצף יעד GN 20 GG, Δ מציין סוג של מוטציה, ואת מספר השיבוטים עם המוטציה המצוינת. D) דוגמא של ג&#39;ל אלקטרופורזה polyacrylamide לקבוע מוטציות DNA. מחיקות גדולות ולהקות heteroduplex להעיד על נוכחות של מוטציות DNA על רצפי היעד. שש מתוך 12 אירועים עצמאיים דורגו כמו מוטציות (Δ). WT, בקרת wild-type; NT, ללא תבנית שליטה. <a href="https://www.jove.com/files/ftp_upload/53843/53843fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

CRISPR וקטור בינוי אפיון תפוקה גבוהה של שינויי DNA על ידי דור של שורשי עגבניות שעירים

באמצעות הרכבת DNA, וקטורי CRISPR מרובים ניתן לבנות במקביל לתגובת שיבוט יחידה, מה שהופך את הבנייה של מספר רב של CRISPR וקטורי משימה פשוטה. עגבניות שורשי שעירים מהווים מערכת מודל מצוינת כדי לאמת וקטורי CRISPR וליצור חומרי מוטציה.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

high-throughput-crispr-vector-construction-characterization-dna

Nanyang Technological University

Research

JoVE Journal

Biology

17.9K Views.  Boyce Thompson Institute for Plant Research.  באמצעות הרכבת DNA, וקטורי CRISPR מרובים ניתן לבנות במקביל לתגובת שיבוט יחידה, מה שהופך את הבנייה של מספר רב של CRISPR וקטורי משימה פשוטה. עגבניות שורשי שעירים מהווים מערכת מודל מצוינת כדי לאמת וקטורי CRISPR וליצור חומרי מוטציה. 

Video: High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to possess medicinally relevant biological activity. However, thus far this potential has not translated into a plethora of triterpene-derived drugs in the clinic. This is arguably (at least partially) a consequence of limited practical synthetic access to this class of compound, a problem that can stifle the exploration of structure-activity relationships and development of lead candidates by traditional medicinal chemistry workflows. Despite their immense diversity, triterpenes are all derived from a single linear precursor, 2,3-oxidosqualene. Transient heterologous expression of biosynthetic enzymes in N. benthamiana can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products that are not naturally produced by this host. Agro-infiltration is an efficient and simple means of achieving transient expression in N. benthamiana. The process involves infiltration of plant leaves with a suspension of Agrobacterium tumefaciens carrying the expression construct(s) of interest. Co-infiltration of an additional A. tumefaciens strain carrying an expression construct encoding an enzyme that boosts precursor supply significantly increases yields. After a period of five days, the infiltrated leaf material can be harvested and processed to extract and isolate the resulting triterpene product(s). This is a process that is linearly and reliably scalable, simply by increasing the number of plants used in the experiment. Herein is described a protocol for rapid preparative-scale production of triterpenes utilizing this plant-based platform. The protocol utilizes an easily replicable vacuum infiltration apparatus, which allows the simultaneous infiltration of up to four plants, enabling batch-wise infiltration of hundreds of plants in a short period of time.

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

Transient heterologous expression of biosynthetic enzymes in Nicotiana benthamiana leaves can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products. Herein is described a detailed protocol for rapid (5 days) preparative-scale production of triterpenes and analogs utilizing this powerful plant-based platform.

ארעי ביטוי טבק Benthamiana משאיר לייצור טריטרפן בקנה מידה מפוח

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to ...

Biochemistry

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to agriculture. However, the Ralstonia model is considerably underexplored in comparison to other models involving bacterial plant pathogens, such as Pseudomonas syringae in Arabidopsis. Research targeted to understanding the interaction between Ralstonia and crop plants is essential to develop sustainable solutions to fight against bacterial wilt disease but is currently hindered by the lack of straightforward experimental assays to characterize the different components of the interaction in native host plants. In this scenario, we have developed a method to perform genetic analysis of Ralstonia infection of tomato, a natural host of Ralstonia. This method is based on Agrobacterium rhizogenes-mediated transformation of tomato roots, followed by Ralstonia soil-drenching inoculation of the resulting plants, containing transformed roots expressing the construct of interest. The versatility of the root transformation assay allows performing either gene overexpression or gene silencing mediated by RNAi. As a proof of concept, we used this method to show that RNAi-mediated silencing of SlCESA6 in tomato roots conferred resistance to Ralstonia. Here, we describe this method in detail, enabling genetic approaches to understand bacterial wilt disease in a relatively short time and with small requirements of equipment and plant growth space.

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Here, we present a versatile method for tomato root transformation followed by inoculation with Ralstonia solanacearum to perform straightforward genetic analysis for the study of bacterial wilt disease.

שורש עגבניות המרה ואחריו חיסונים עם Ralstonia Solanacearum ניתוח גנטי פשוט של מחלת וילט חיידקי

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to ...

Genetics

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat (Fagopyrum tataricum)

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant secondary metabolites such as flavonoids, especially rutin. Agrobacterium rhizogenes have been gradually used worldwide to induce hairy roots in medicinal plants to investigate gene functions and increase the yield of secondary metabolites. In this study, we have described a detailed method to generate A. rhizogenes-mediated hairy roots in TB. Cotyledons and hypocotyledonary axis at 7&#8211;10 days were selected as explants and infected with A. rhizogenes carrying a binary vector, which induced adventitious hairy roots that appeared after 1 week. The generated hairy root transformation was identified based on morphology, resistance selection (kanamycin), and reporter gene expression (green fluorescent protein). Subsequently, the transformed hairy roots were self-propagated as required. Meanwhile, a myeloblastosis (MYB) transcription factor, FtMYB116, was transformed into the TB genome using the A. rhizogenes-mediated hairy roots to verify the role of FtMYB116 in synthesizing flavonoids. The results showed that the expression of flavonoid-related genes and the yield of flavonoid compounds (rutin and quercetin) were significantly (p &#60; 0.01) promoted by FtMYB116, indicating that A. rhizogenes-mediated hairy roots can be used as an effective alternative tool to investigate gene functions and the production of secondary metabolites. The detailed step-by-step protocol described in this study for generating hairy roots can be adopted for any genetic transformation or other medicinal plants after adjustment.

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat Fagopyrum tataricum

We describe a method of inducing hairy roots by Agrobacterium rhizogenes-mediated transformation in Tartary buckwheat (Fagopyrum tataricum). This can be used to investigate gene functions and production of secondary metabolites in Tartary buckwheat, be adopted for any genetic transformation, or used for other medicinal plants after improvement.

שורש שעירים על ידי Agrobacterium ריזוגנים-שינוי מתווך בתוך הטאררי כוסמת (Fagopyrum טאטארנום)

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant ...

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an Agrobacterium rhizogenes mediated transformation system on pigeon pea. The stem is infected with A. rhizogenes carrying a binary vector, which induced callus after 7 days and adventitious roots 14 days later. The generated transgenic hairy root was identified by morphological analysis and a GFP reporter gene.To further illustrate the application range of this system, CcCIPK14 (Calcineurin B-like protein-interacting protein kinases) was transformed into pigeon pea using this transformation method. The transgenic plants were treated with jasmonic acid (JA) and abscisic acid (ABA), respectively, for the purpose of testing whether CcCIPK14 responds to those hormones. The results demonstrated that (1) exogenous hormones could significantly upregulate the expression levelof CcCIPK14, especially in CcCIPK14 over-expression (OE) plants; (2) the content of Genistein in CcCIPK14-OE lines was significantly higher than the control; (3) the expression level of two downstream key flavonoid synthase genes, CcHIDH1 and CcHIDH2, were up-regulated in the CcCIPK14-OE lines; and (4) the hairy root transgenic system can be used to study metabolically functional genes in non-model plants.

<meta charset="utf8"></head><body>ניתוח תפקוד גנים CcCIPK14 כדי להאיר את המערכת הטרנסגנית היעילה של השורש

Here we present an efficient and stable transformation system for the functional analysis of the CcCIPK14 gene as an example, providing a technical basis for studying the metabolism of non-model plants.

CcCIPK14 ניתוח תפקוד גנים כדי להאיר את המערכת הטרנסגנית היעילה של השורשים

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an ...

בניית ספריית פלסמיד UAS-cDNA/ORF בעלת תפוקה גבוהה באמצעות CRISPRmass

CRISPR-Based Modular Assembly for High-Throughput Construction of a UAS-cDNA/ORF Plasmid Library

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. Conventional approaches for plasmid library construction are time-consuming and laborious. Therefore, we recently developed a simple and efficient method, CRISPR-based modular assembly (CRISPRmass), for high-throughput construction of a genome-wide upstream activating sequence-complementary DNA/open reading frame (UAS-cDNA/ORF) plasmid library. Here, we present a protocol for CRISPRmass, taking as an example the construction of a GAL4/UAS-based UAS-cDNA/ORF plasmid library. The protocol includes massively parallel two-step test tube reactions followed by bacterial transformation. The first step is to linearize the existing complementary DNA (cDNA) or open reading frame (ORF) cDNA or ORF library plasmids by cutting the shared upstream vector sequences adjacent to the 5&#39; end of cDNAs or ORFs using CRISPR/Cas9 together with single guide RNA (sgRNA), and the second step is to insert a UAS module into the linearized cDNA or ORF plasmids using a single step reaction. CRISPRmass allows the simple, fast, efficient, and cost-effective construction of various plasmid libraries. The UAS-cDNA/ORF plasmid library can be utilized for gain-of-function screening in cultured cells and for constructing a genome-wide transgenic UAS-cDNA/ORF library in Drosophila.&#160;

Author Spotlight: פישוט בניית ספריית פלסמיד רחבת גנום באמצעות CRISPRmass

We present a protocol for CRISPR-based modular assembly (CRISPRmass), a method for high-throughput construction of UAS-cDNA/ORF plasmid library in Drosophila using publicly available cDNA/ORF resources. CRISPRmass can be applied to editing various plasmid libraries.

הרכבה מודולרית מבוססת CRISPR לבניית ספריית פלסמיד UAS-cDNA/ORF

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. ...

Gene Digital Circuits Based on CRISPR-Cas Systems and Anti-CRISPR Proteins

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the CRISPR-Cas systems and their natural inhibitors-the anti-CRISPR proteins (Acrs)-provides a new tool to design and implement in vivo gene digital circuits. Here, we describe a protocol that follows the idea of the "Design-Build-Test-Learn" biological engineering cycle and makes use of dCas9/dCas12a together with their corresponding Acrs to establish small transcriptional networks, some of which behave like Boolean gates, in Saccharomyces cerevisiae. These results point out the properties of dCas9/dCas12a as transcription factors. In particular, to achieve maximal activation of gene expression, dSpCas9 needs to interact with an engineered scaffold RNA that collects multiple copies of the VP64 activation domain (AD). In contrast, dCas12a shall be fused, at the C terminus, with the strong VP64-p65-Rta (VPR) AD. Furthermore, the activity of both Cas proteins is not enhanced by increasing the amount of sgRNA/crRNA in the cell. This article also explains how to build Boolean gates based on the CRISPR-dCas-Acr interaction. The AcrIIA4 fused hormone-binding domain of the human estrogen receptor is the core of a NOT gate responsive to &#946;-estradiol, whereas AcrVAs synthesized by the inducible GAL1 promoter permits to mimic both YES and NOT gates with galactose as an input. In the latter circuits, AcrVA5, together with dLbCas12a, showed the best logic behavior.

CRISPR-Cas systems and anti-CRISPR proteins were integrated into the scheme of Boolean gates in Saccharomyces cerevisiae. The new small logic circuits showed good performance and deepened the understanding of both dCas9/dCas12a-based transcription factors and the properties of anti-CRISPR proteins.

מעגלים דיגיטליים גנטיים המבוססים על מערכות CRISPR-Cas וחלבונים אנטי-קריספר

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the ...

Bioengineering

ייצור יעיל של שורשים שעירים מהונדסים, פולי סויה

Soybean Hairy Root Transformation for the Analysis of Gene Function

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with soil-borne microbes that form symbiosis to fix nitrogen and pathogens, which makes research involving soybean root genetics of prime importance to improve its agricultural production. The genetic transformation of soybean hairy roots (HRs) is mediated by the Agrobacterium rhizogenes strain NCPPB2659 (K599) and is an efficient tool for studying gene function in soybean roots, taking only 2 months from start to finish. Here, we provide a detailed protocol that outlines the method for overexpressing and silencing a gene of interest in soybean HRs. This methodology includes soybean seed sterilization, infection of cotyledons with K599, and the selection and harvesting of genetically transformed HRs for RNA isolation and, if warranted, metabolite analyses. The throughput of the approach is sufficient to simultaneously study several genes or networks and could determine the optimal engineering strategies prior to committing to long-term stable transformation approaches.

מחבר זרקור: טרנספורמציה של שורש סויה שעיר לניתוח תפקוד גנים  

Here, we present a protocol for the high-efficiency production of transgenic soybean hairy roots.

טרנספורמציה של שורש סויה שעיר לניתוח תפקוד גנים

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with ...

CRISPR וקטור בינוי אפיון תפוקה גבוהה של שינויי DNA על ידי דור של שורשי עגבניות שעירים

Summary

Explore More Videos

ארעי ביטוי טבק Benthamiana משאיר לייצור טריטרפן בקנה מידה מפוח

שורש עגבניות המרה ואחריו חיסונים עם Ralstonia Solanacearum ניתוח גנטי פשוט של מחלת וילט חיידקי

שורש שעירים על ידי Agrobacterium ריזוגנים-שינוי מתווך בתוך הטאררי כוסמת (Fagopyrum טאטארנום)

CcCIPK14 ניתוח תפקוד גנים כדי להאיר את המערכת הטרנסגנית היעילה של השורשים

CcCIPK14 ניתוח תפקוד גנים כדי להאיר את המערכת הטרנסגנית היעילה של השורשים

הרכבה מודולרית מבוססת CRISPR לבניית ספריית פלסמיד UAS-cDNA/ORF

הרכבה מודולרית מבוססת CRISPR לבניית ספריית פלסמיד UAS-cDNA/ORF

הרכבה מודולרית מבוססת CRISPR לבניית ספריית פלסמיד UAS-cDNA/ORF

מעגלים דיגיטליים גנטיים המבוססים על מערכות CRISPR-Cas וחלבונים אנטי-קריספר

טרנספורמציה של שורש סויה שעיר לניתוח תפקוד גנים