Name: high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots
Uploaded: 2016-04-30T14:00:00.000+00:00
Duration: 12 min 59 s
Description: Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

이 연구는 국립 과학 재단 (National Science Foundation) 부여 IOS-1025642 (GBM)에 의해 지원되었다. 우리는 ARqua1 균주를 제공하는 마리아 해리슨 감사합니다.

1. 가이드 RNA 설계 및 벡터 건설 <ol><li> 관심있는 유전자에 대한 표적 서열을 확인합니다. 이 단계 (13, 14)에 적합한 온라인 CRISPR 대상-찾는 다양한 프로그램이 있습니다. 참고 : 여기에 우리는 GN 20 GG 대상 모티브를 사용하지만, 다른 디자인을 사용하는 응용 프로그램이나 벡터 시스템에 따라 적합 할 수있다. </li><li> 디자인 60 메르 gRNA 올리고는 DNA 조립에 필요한 5 측면 대상 주제 &#39;및 3&#39;20 NT 시퀀스의 GN (19) 부분을 포함한다. 마지막 60 메르 주제는 다음과 같습니다 5&#39;-TCAAGCGAACCAGTAGGCTT-GN 19 -GTTTTAGAGCTAGAAATAGC-3 &#39;. 참고 : 표준, 탈염 프라이머가 잘 작동합니다. </li><li> 조립을위한 네 개의 DNA를 (그림 1)을 준비합니다. DNA 서열에 대한 추가 파일을 참조하십시오. <ol><li> 2 시간 동안 37 ℃에서 1X 버퍼 (4)의 제한 효소와 I SPE Cas9 10 플라스미드 p201N 5 μg의 1 - 다이제스트. 는 다이제스트 열은-정화제조업체의 지침에 ccording. ~ 10 mM 트리스 - 염산 15 μl를에 재현 탁하고, UV 분광 광도법에 의해 정량화. </li><li> 제 2 시간 동안 25 ℃에서 1X 버퍼 3.1 제한 효소 I SWA와 다이제스트 수행한다. 완전한 분해를 확인하기 위해 0.8 % 아가 로스 겔상에서 ng를 200-100를 확인한다. 참고 : 제대로 소화 플라스미드 14,313 BP에 하나의 밴드를해야합니다. 참고 : 효소와 탈 인산화의 열 불 활성화가 필요하지 않습니다. 분해 된 플라스미드를 -20 ℃에서 저장 될 수있다. </li><li> PCR은 프라이머 SWA I_MtU6F / MtU6R 각각 ScaffoldF / SPE I_ScaffoldR를 사용하여는 pUC gRNA 셔틀 (10) 플라스미드에서 Medicago의 truncatula (마) U6 프로모터 및 발판 DNA를 증폭. 상기 증폭 된 PCR 조건을 가진 고성능 폴리머 사용하여 3 분 동안 95 ° C 단계; 31주기 (20 초 98 ° C, 15 초 동안 60 ° C, 30 초 72 ° C); 5 분 동안 72 ° C. <ol><li> PCR 홍보의 ~ 3 μL 씩 시각화1 % 아가 로스 겔상에서 oducts의 증폭을 확인한다. MtU6 앰플 리콘은 377 BP하고 비계 앰플 리콘은 106 bp의입니다. , 제조업체의 지시에 따라 PCR 나머지 제품을 칼럼 - 정제 -20 ℃에서 UV 분광 광도법에 의해 정량화하고 저장. </li></ol></li><li> 실험실 수준의 물에 100 μM에 gRNA 올리고의 전체 튜브를 재현 탁. 1X 버퍼 2.1 500 ㎕를 100 μM 올리고 1 μl를 추가합니다. 잘 섞다. 여러 올리고 풀링 경우, 1 배 버퍼 2.1 튜브에 각각 100 μM 올리고 1 μl를 추가합니다. 희석 올리고는 -20 ° C에서 저장 될 수있다. </li></ol></li><li> 가열 된 리드를 사용하여, 50 ° C에서 유지하도록 열 순환기 프로그램. 의 부피로 선형화 된 벡터 묽은 gRNA 올리고 (들) 및 물 MtU6 프로모터 지지체의 12 NG (0.2 pmol의), 1 μL (0.2 pmol의)의 50 NG (0.2 pmol의)의 100 NG (0.011 pmol의)을 겸용 5 μL. 2 배 높은 충실도 DNA 어셈블리 마스터 믹스 5 μl를 추가 잘 혼합 스핀 다운. 에서 60 분 동안 반응을 품어50 ° C 열 순환기. 그런 다음 얼음에 반응을 놓습니다. 주의 : 반응 볼륨이 낮은 DNA 수율을 수용하기 위해 증가 될 수있다. </li><li> 관할 E.으로 반응 2 μl를 변환 50 mg을 L -1 카나마이신 (칸 50)로 보충 LB에 표준 기술과 플레이트를 이용하여 대장균 세포. 하룻밤 37 ℃에서 도금 세포를 성장. -20 ° C에서 남아있는 DNA 어셈블리 반응을 저장합니다. </li><li> 프라이머의 StUbi3P218R 및 ISceIR를 사용하여 PCR에 의한 식민지 화면. 물 (1)과 나머지 DNA 조립체 반응의 분취 액을 희석 : 5이다. 노 삽입 제어와 같은 Cas9 플라스미드 : 긍정적 인 식민지의 화면 제어 및 원형 p201N 1 NG로 1 μl를 사용합니다. <ol><li> PCR은 조건을 증폭; 3 분 95 ° C; 31주기 (30 초 95 ° C, 30 초 동안 58 ° C, 30 초 72 ° C); 5 분 동안 72 ° C에서. 1 % 아가 로즈 겔상에서 PCR 생성물을 가시화. 정확한 삽입이 725 BP와 벡터 기지에서 밴드가 있는지 확인(예를 들어, 포경 벡터) 심 삽입은 310 bp의 밴드를해야합니다. </li></ol></li><li> 37 ° C에서 50 액체 배양 밤새 LB 칸에 긍정적 인 식민지를 성장하고 제조업체의 지침에 따라 플라스미드를 정제. 생거 순서는 StUbi3P218R 프라이머로 플라스미드 및 오류가 복제 동안 소개되지 않았다 보장하기 위해 MtU6 프로모터, 대상 및 발판 시퀀스에 크로마토 그램을 맞 춥니 다. </li><li> 진단은 에코 RV 및 촌 I.와 플라스미드 ~ 1 μg의 소화에 의해 소화 수행 0.8 % 아가 로스 젤에 시각화합니다. (BP)에 조각은 다음과 같습니다 : 4192, 2001, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, 174. </li><li> 여러 gRNAs와 벡터를 구성하는 DNA 어셈블리를 사용합니다. <ol><li> 두 gRNA 카세트를 갖는 벡터를 구성하기 위해 PCR은 각각 각각의 1 NG의 프라이머 UNS1_MtU6F / SPE I_ScaffoldR와 프라이머 SWA I_MtU6F / UNS1_ScaffoldR 및 제 gRNA 위치와 제 1 위치 gRNA 증폭1.8 - 플라스미드 단계 1.1으로 구성. 단계 1.3.3에서 PCR 조건을 사용합니다. 증폭을 확인하기 위해, 1 % 아가 로즈 겔상에서 PCR 제품 ~ 3 μL 씩 시각화. 증폭는 ~ 500 BP 있습니다. </li><li> 합하여 200 μL 튜브 않은 정제 PCR 제품의 대략 동일한 양을 혼합 (일반적으로 3 - 각 4 μL). 어셈블리를 들어, PCR 제품 조합 1 μL, SWA I의 50 NG를 추가하고 SPE 나는 p201N을 선형화 : Cas9, 실험실 수준의 물을 2.5 μL와 배 높은 충실도 DNA 어셈블리 마스터 믹스의 2.5 μL에. 15 분 동안 50 ° C 열 순환기 인큐베이션. 주 : DNA 조립 매뉴얼 2 15 분 배양 권장합니다 - 3 조각. </li><li> 관할 E.으로 2 μL 1 - 변환 LB 칸 (50)에 대장균 세포와 판. 하룻밤 37 ° C에서 도금 세포를 성장. -20 ° C에서 나머지 반응을 저장합니다. </li><li> 단계 1.6과 동일한 조건으로 프라이머 StUbi3P218R 및 ISceIR와 PCR에 의한 식민지 화면. 올바른 Clones는 1200 bp의 증폭 물을 것입니다. LB 칸에 긍정적 인 식민지를 50 액체 배양 하룻밤 성장 및 플라스미드를 정제. </li><li> 프라이머의 StUbi3P218R와 생거 시퀀스 플라스미드 (제 1 위치 gRNA을 포함) 및 p201R은 (두 번째 위치 gRNA을 포함). MtU6 프로모터, 대상 및 발판 시퀀스에 크로마토 그램을 맞 춥니 다. 진단은 에코 RV 다이제스트와의 Sty 나는 (BP)에 다음과 같은 단편 발생합니다 : 4192은, 2476은, 1743은, 1544은, 1381는, 995, 831, 702, 460, 423, 318, 174 굵게 조각 두 번째 gRNA이 포함되어 있습니다. </li></ol></li><li> 아그로 박테 리움이 변형 ARqua1 15 rhizogenes에 모든 품질 관리의 기대를 충족 한 후, 플라스미드를 변환. 설정으로 1mm 큐벳에 electrocompetent 세포와 electroporate 50 μL에 플라스미드 준비 1 μl를 추가 : 2.4 kV의 25 μF, 200 Ω을. SOC의 ~ 500 μL의 세포를 복구하고 2 시간 동안 28 ° C에서 흔들. LB 칸 50 g에 플레이트2 일 동안 28 ° C에서 행. 1.3.3와 동일한 프라이머 및 PCR 조건을 사용하여 콜로니 화면을 수행한다. 긍정적 인 클론에서 글리세롤 주식을합니다. </li></ol> 2. 털이 루트 변환 <ol><li> 일정하게 혼합하여, 15 분 동안 20 %의 가정용 표백제 토마토 종자를 소독. 층류 후드에서, 표백제를 제거하고 무균 실험실 등급 물에 세 번 세척 하였다. </li><li> ½ MS 미디어 (2.22 g의 L -1 MS 염 + 갬 보그 비타민, 10g의 L -1 자당 3 g L -1 젤란 검, 산도 5.8)를 포함하는 GA-7 상자 판 (30) 씨. 어둠 속에서 2 ~위한 일을 발아 후 빛에 GA-7 상자를 이동합니다. 빛 ~ 4 일 이상 모종을 재배한다. </li><li> 변환 전날, 연속 아웃 A. 고체 LB 칸 (50)에 문화를 rhizogenes 하룻밤 28 ° C에서 성장한다. </li><li> 변환 일이 층류 후드에서 멸균 재료를 조립 : 12 ml의 배양 관, 50 ㎖ 원뿔형 튜브, ½ MS 액체 (더 젤란 g 없다음), 200 μM의 시린, 여과지, 배양 접시, 집게와 메스, 피펫과 피펫 팁. ½ MS의 50ml로 시린의 25 μl를 추가하고 각 문화 튜브에 ~ 6 ml에 붓는다. </li><li> A.을 긁어 구부러진 200 μl의 팁을 사용하여 ½ MS 액의 6 용액에 접시와에 resuspend에서 rhizogenes 세포. 와류 튜브 완전 세포를 재현 탁한다. 각 벡터로 세포를 재현 탁 후에, 600 nm의 고정 된 파장에서 셀 1 (M1)의 광학 밀도 (OD)를 측정한다. OD가 0.2과 0.4 사이에 있는지 확인; 희석 또는 필요에 따라 더 많은 세포를 추가합니다. 각 구조에 대해 반복합니다. </li><li> 살균 필터 종이와 페트리 접시에 ½ MS 액체 ~ 2 ML을 추가합니다. 가습 필터 종이에 묘목과 장소에서 소비세 자엽. 일단 모든 자엽이 수집 한 두 컷 끝 떡잎 조각의 결과로, 자엽의 오프 말단 ~ 1cm를 잘라. A.에 외식 추가 rhizogenes 솔루션은 혼합하고, 20 분 동안 품어가끔 반전에. 참고 : 구조 당 약 12 외식가 일상적으로 사용되며, 많은 80 외식이 A의 6 ㎖에 접종되고 있지만 rhizogenes 솔루션입니다. </li><li> A. 동안 rhizogenes의 배양은 배양 접시에 종이 필터를 추가, 하나의 당 구조가 변형. 또한 건조 층류 후드, ½ MS 고체 배지, 아니 항생제를 설정합니다. </li><li> A.에서 자엽 특종 건조 여과지에 멸균 집게와 장소 rhizogenes 솔루션을 제공합니다. 다음 변환을 진행하면서 건조하지 않는 조직을 보장하기 위해 페트리 뚜껑 커버. 여과지 및 전송, 배축면이 위로에 오 자엽은 MS의 미디어를 ½합니다. 외과 용 테이프로 감싸 판을 실온에서 2 일 동안 어둠 속에서 공동 - 배양. </li><li> 최대 공 배양, 전사 자엽, 배축 측 후, MS 매체 (300 mg을 L -1 ticarcillin / 클라 불란 산 팀 300 보충 1/2 잔유의 성장을 방지 할연간 A. rhizogenes) 및 공장 선택에 대한 칸 50 () 및 수술 테이프로 포장. 16 시간 광주와 실온에서 형광등 불빛 아래에서 문화를 유지한다. </li><li> 길이가 2 주 뿌리 적어도 2cm 멸균 집게와 메스를 사용하여 자엽에서 절제와 MS 칸 50 팀 (300) 미디어를 1/2 전송 - ~ 1.5 후. 하나의 판에 10 ~ 15 뿌리를 전송합니다. 마커와 뿌리 끝의 위치를​​ 표시 외과 테이프로 포장, 문화 방에서 유지한다. </li><li> 일주 후, 형질 전환 뿌리는 선택적 미디어에 성장 볼 수 있습니다. 바람직한 DNA 추출 방법을 이용하여 DNA 추출을 위해 변환 된 뿌리의 표본 수확. 참고 : 자엽과 플레이트가 2 유지 될 수 - 뿌리가 얽힌 엉망으로 성장 지적과 분리하기 어려운 후 3 주간 수확. 비 수확 루트 조직 무한히 유지할 수있다. 분석의 다양한 단리 된 DNA 시료에서 수행 될 수있다들 DNA 돌연변이의 빈도와 유형을 확인합니다. 몇 이러한 분석 결과는 아래에 설명되어 있습니다. </li></ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+plant+genomes+with+CRISPR/Cas9.">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+of+sweet+orange+using+Cas9/sgRNA.">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li><li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat.">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li><li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model.">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li><li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modifications+in+soybean+with+CRISPR/Cas9.">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li><li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate:CoA+ligase+specificity+and+redundancy.">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li><li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CCTop:+An+Intuitive,+Flexible+and+Reliable+CRISPR/Cas9+Target+Prediction+Tool.">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li><li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-P:+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants.">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li><li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES.">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li><li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR/Cas9+system.">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genome+editing+made+easy:+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR/Cas+system.">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9.">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li><li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications.">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li><li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multiplicity+of+hairy+root+cultures:+Prolific+possibilities.">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li><li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.:+sexual+transmission+of+the+transformed+genotype+and+phenotype.">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li><li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misexpression+of+miR482,+miR1512,+and+miR1515+Increases+Soybean+Nodulation.">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li><li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations.">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li><li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vitro.+composite+plants:+an+inexpensive,+rapid+method+for+root+biology.">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li></ol>

저자는 공개 아무것도 없어.

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,...

CRISPR와 표적 DNA의 변형을 생성 할 수있는 능력은 / Cas9는 기능 유전체학 연구에 큰 잠재력을 가지고있다. CRISPR / Cas9 시스템의 두 가지 구성 요소가 있습니다; 황색 포도상 구균 화농 및 대상 DNA 사이트 (들) 1 Cas9을 지시 약 100 NT 가이드 RNA (gRNA) 분자에서 파생 된 Cas9 클레아. 표적 인식은 상기 제에 의해 부여된다 ~ 타겟팅 벡터 2,3- 높은 처리량 제조 허용 gRNA의 20 NT. 설계 할 수 있습니다 대부분의 생물은 이미 CRISPR / Cas9 기술 4,5로왔다. 식물 예는 CaMV 35S 프로모터와 같은 구성 성 프로모터에서, 일반적 Cas9 클레아 (6)의 발현을 유도하기 위해 사용된다. gRNAs는 gRNA의 제 1베이스를 제한하는 RNA 중합 효소 III U6 또는 U3 프로모터를 사용하여 표현에 중 하나 G, 효율적인 전사 U3에 대한 U6, 또는 A,합니다. 그러나 RNA 중합 효소 II의 댄스 파티이러한 제한의 무료 oters는 또한 7, 8을 사용하고있다. 다른 gRNAs 다른 효율성과 DNA 돌연변이를 유도하고, 그래서 먼저 전체 공장의 변환에 투자 또는 광범위한 표현형 화면을 설정하기 전에 CRISPR 경로를 확인하는 것이 중요 할 수 있습니다. CRISPR 과도 발현이 곤란 돌연변이와 같은 방식으로 비실용적 표현형 어 세이의 검출을 안정 설비 (6)에 비해 일반적으로 DNA 개질 저주파 결과, 예를 들면 agroinfiltration을 사용하여, 식물 구성한다. 소위 모상근 안정적인 식물 개월 반대로 독립 안정적으로 형질 전환 물질 다수, 주 내에서 발생 될 수 있기 때문에 편리 대체 시스템이다. CRISPR 벡터는 털이 뿌리 9,10에서 DNA 돌연변이를 유도에 매우 효과적이다. DNA 조립 방법은 효율적 overl 함유 DNA 단편을 결찰apping 11을 종료합니다. 일부 DNA 조립 방법의 주요 장점은 조립 된 제품에 ssDNA를 (즉, 올리고)를 통합 할 수있는 능력이다. gRNAs 만 ~ 20 NT 긴 새로운 타겟 합성 올리고 만들어 질 수 있기 때문에, 이러한 DNA 조립 방법 CRISPR 복제에 적합하다. 여기에 설명 된 프로토콜이 성공적으로 대두 10, 포플라 (12)에 사용 된 현재 토마토 CRISPR 벡터의 P201 시리즈에 기초한다. 제시 복제 절차는 현재의 클로닝 방법 (10)에 비해 몇 가지 장점을 제공한다. 즉, 완전히 기능 벡터는 하루에 단일 클로닝 반응에서 생성 될 수있다. 벡터 건설은 더 손에 시간과 재료 비용을 절감, 병렬로 여러 CRISPR 벡터를 생성하기 위해 풀링 할 수 있습니다. 또한 표적 유전자 결실 유전자 물질을 제조하기위한 효율적인 방법으로 토마토 모상근의 생성을위한 프로토콜을 제시한다. 털이 뿌리는 유효한하는 데 사용됩니다CRISPR 벡터를 먹고 이후의 실험 자료를 제공한다.

<table><tbody><tr><td>NEBuilder&amp;reg; (HiFi DNA assembly mix)</td><td>New England Biolabs</td><td>E5520</td><td></td></tr><tr><td>p201N:Cas9</td><td>Addgene</td><td>59175</td><td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td></tr><tr><td>pUC gRNA Shuttle</td><td>Addgene</td><td>47024</td><td></td></tr><tr><td>&lt;em&gt;Swa&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0604S</td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0133S</td><td></td></tr><tr><td>Zymo clean and concentrator-5 column purification</td><td>Zymo Research</td><td>D4003</td><td></td></tr><tr><td>NEB Buffer 2.1</td><td>New England Biolabs</td><td>B7202S</td><td></td></tr><tr><td>NEB CutSmart (Buffer 4)</td><td>New England Biolabs</td><td>B7204S</td><td></td></tr><tr><td>NEB Buffer 3.1</td><td>New England Biolabs</td><td>B7203S</td><td></td></tr><tr><td>EconoSpin Mini Spin Column (plasmid prep)</td><td>Epoch Life Sciences</td><td>1910-050/250</td><td></td></tr><tr><td>EcoRV-HF&amp;reg;</td><td>New England Biolabs</td><td>R3195S</td><td></td></tr><tr><td>StyI-HF&amp;reg;</td><td>New England Biolabs</td><td>R3500S</td><td></td></tr><tr><td>MS Salts + Gamborg Vitamins</td><td>Phytotechnology Laboratories</td><td>M404</td><td></td></tr><tr><td>Phytagel&amp;trade; (gellan gum)</td><td>Sigma Aldrich</td><td>P8169</td><td></td></tr><tr><td>GA-7 Boxes</td><td>Sigma Aldrich</td><td>V8505</td><td></td></tr><tr><td>Micropore&amp;trade; surgical tape</td><td>3M</td><td>1535-0</td><td></td></tr><tr><td>Timentin&amp;reg; (Ticarcillin/Clavulanic acid)</td><td>Various</td><td>0029-6571-26</td><td></td></tr><tr><td>Primers 5&#039; &amp;#8594; 3&#039;</td><td></td><td></td><td></td></tr><tr><td>SwaI_MtU6F&amp;nbsp;</td><td>&lt;strong&gt;GATATTAATCTCTTCGATGA&lt;br/&gt;AATTT&lt;/strong&gt;ATGCCTATCTTATAT&lt;br/&gt;GATCAATGAGG</td><td></td><td></td></tr><tr><td>MtU6R&amp;nbsp;&amp;nbsp;</td><td>AAGCCTACTGGTTCGCTTG&lt;br/&gt;AAG</td><td></td><td></td></tr><tr><td>ScaffoldF&amp;nbsp;</td><td>GTTTTAGAGCTAGAAATAGC&lt;br/&gt;AAGTT</td><td></td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I_Scaffold R</td><td>&lt;strong&gt;GTCATGAATTGTAATACGACTC&lt;br/&gt;A&lt;/strong&gt;AAAAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>StUbi3P218R&amp;nbsp;</td><td>ACATGCACCTAATTTCACTA&lt;br/&gt;GATGT</td><td></td><td></td></tr><tr><td>ISceIR</td><td>GTGATCGATTACCCTGTTAT&lt;br/&gt;CCCTAG</td><td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td><td></td></tr><tr><td>UNS1_Scaffold R&amp;nbsp;</td><td>GAGAATGGATGCGAGTAATGAA&lt;br/&gt;AAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>UNS1_MtU6 F&amp;nbsp;&amp;nbsp;</td><td>CATTACTCGCATCCATTCTCAT&lt;br/&gt;GCCTATCTTATATGATCAATGAGG</td><td></td><td></td></tr><tr><td>p201R&amp;nbsp;</td><td>CGCGCCGAATTCTAGTGATCG</td><td></td><td></td></tr><tr><td>Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td><td></td><td></td><td></td></tr></tbody></table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

DNA 어셈블리 CRISPR 벡터 구조는 일반적으로 독립적 인 클론의 수백 수십를 생성합니다. PCR에 의한 식민지 심사 쉽게 올바른 클론을 식별하고와 문제 해결에 유용 삽입 (그림 2A)없이 플라스미드를 구별 할 수 있습니다. 일반적으로, 클론의 모든 인서트를 포함하고 사용자가 완전히 식민지 심사 단계를 건너 뛰도록 선택할 수 있습니다. 진단 다이제스트 (?...

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

토마토 털이 뿌리의 생성에 의한 높은 처리량 CRISPR 벡터 건설 및 DNA 수정의 특성

DNA 조립체를 사용하여, 여러 CRISPR 벡터가 CRISPR 다수의 구성을 하나 복제 반응에 병렬로 구성 될 수있는 간단한 작업 벡터. 토마토 털이 뿌리는 CRISPR 경로를 확인하고 돌연변이 물질을 생성 할 수있는 훌륭한 모델 시스템입니다.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

high-throughput-crispr-vector-construction-characterization-dna

Research

JoVE Journal

Biology

17.9K 조회수.  Boyce Thompson Institute for Plant Research.  DNA 조립체를 사용하여, 여러 CRISPR 벡터가 CRISPR 다수의 구성을 하나 복제 반응에 병렬로 구성 될 수있는 간단한 작업 벡터. 토마토 털이 뿌리는 CRISPR 경로를 확인하고 돌연변이 물질을 생성 할 수있는 훌륭한 모델 시스템입니다. 

비디오: High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to possess medicinally relevant biological activity. However, thus far this potential has not translated into a plethora of triterpene-derived drugs in the clinic. This is arguably (at least partially) a consequence of limited practical synthetic access to this class of compound, a problem that can stifle the exploration of structure-activity relationships and development of lead candidates by traditional medicinal chemistry workflows. Despite their immense diversity, triterpenes are all derived from a single linear precursor, 2,3-oxidosqualene. Transient heterologous expression of biosynthetic enzymes in N. benthamiana can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products that are not naturally produced by this host. Agro-infiltration is an efficient and simple means of achieving transient expression in N. benthamiana. The process involves infiltration of plant leaves with a suspension of Agrobacterium tumefaciens carrying the expression construct(s) of interest. Co-infiltration of an additional A. tumefaciens strain carrying an expression construct encoding an enzyme that boosts precursor supply significantly increases yields. After a period of five days, the infiltrated leaf material can be harvested and processed to extract and isolate the resulting triterpene product(s). This is a process that is linearly and reliably scalable, simply by increasing the number of plants used in the experiment. Herein is described a protocol for rapid preparative-scale production of triterpenes utilizing this plant-based platform. The protocol utilizes an easily replicable vacuum infiltration apparatus, which allows the simultaneous infiltration of up to four plants, enabling batch-wise infiltration of hundreds of plants in a short period of time.

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

Transient heterologous expression of biosynthetic enzymes in Nicotiana benthamiana leaves can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products. Herein is described a detailed protocol for rapid (5 days) preparative-scale production of triterpenes and analogs utilizing this powerful plant-based platform.

Nicotiana Benthamiana 에 과도 식 보관 생산 대리점 규모에 대 한 나뭇잎

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to ...

연구

생화학

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to agriculture. However, the Ralstonia model is considerably underexplored in comparison to other models involving bacterial plant pathogens, such as Pseudomonas syringae in Arabidopsis. Research targeted to understanding the interaction between Ralstonia and crop plants is essential to develop sustainable solutions to fight against bacterial wilt disease but is currently hindered by the lack of straightforward experimental assays to characterize the different components of the interaction in native host plants. In this scenario, we have developed a method to perform genetic analysis of Ralstonia infection of tomato, a natural host of Ralstonia. This method is based on Agrobacterium rhizogenes-mediated transformation of tomato roots, followed by Ralstonia soil-drenching inoculation of the resulting plants, containing transformed roots expressing the construct of interest. The versatility of the root transformation assay allows performing either gene overexpression or gene silencing mediated by RNAi. As a proof of concept, we used this method to show that RNAi-mediated silencing of SlCESA6 in tomato roots conferred resistance to Ralstonia. Here, we describe this method in detail, enabling genetic approaches to understand bacterial wilt disease in a relatively short time and with small requirements of equipment and plant growth space.

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Here, we present a versatile method for tomato root transformation followed by inoculation with Ralstonia solanacearum to perform straightforward genetic analysis for the study of bacterial wilt disease.

세균성 윌트 질병의 간단한 유전 분석을 위한 랄스토니아 솔라나세아룸에 의한 접종에 이어 토마토 뿌리 변환

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to ...

유전학

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat (Fagopyrum tataricum)

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant secondary metabolites such as flavonoids, especially rutin. Agrobacterium rhizogenes have been gradually used worldwide to induce hairy roots in medicinal plants to investigate gene functions and increase the yield of secondary metabolites. In this study, we have described a detailed method to generate A. rhizogenes-mediated hairy roots in TB. Cotyledons and hypocotyledonary axis at 7&#8211;10 days were selected as explants and infected with A. rhizogenes carrying a binary vector, which induced adventitious hairy roots that appeared after 1 week. The generated hairy root transformation was identified based on morphology, resistance selection (kanamycin), and reporter gene expression (green fluorescent protein). Subsequently, the transformed hairy roots were self-propagated as required. Meanwhile, a myeloblastosis (MYB) transcription factor, FtMYB116, was transformed into the TB genome using the A. rhizogenes-mediated hairy roots to verify the role of FtMYB116 in synthesizing flavonoids. The results showed that the expression of flavonoid-related genes and the yield of flavonoid compounds (rutin and quercetin) were significantly (p &#60; 0.01) promoted by FtMYB116, indicating that A. rhizogenes-mediated hairy roots can be used as an effective alternative tool to investigate gene functions and the production of secondary metabolites. The detailed step-by-step protocol described in this study for generating hairy roots can be adopted for any genetic transformation or other medicinal plants after adjustment.

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat Fagopyrum tataricum

We describe a method of inducing hairy roots by Agrobacterium rhizogenes-mediated transformation in Tartary buckwheat (Fagopyrum tataricum). This can be used to investigate gene functions and production of secondary metabolites in Tartary buckwheat, be adopted for any genetic transformation, or used for other medicinal plants after improvement.

아그로박테리움 뿌리줄기에의한 털이 많은 뿌리 유도 -타르타르 메밀의 매개 변형(파고피룸 타타리쿰)

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant ...

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an Agrobacterium rhizogenes mediated transformation system on pigeon pea. The stem is infected with A. rhizogenes carrying a binary vector, which induced callus after 7 days and adventitious roots 14 days later. The generated transgenic hairy root was identified by morphological analysis and a GFP reporter gene.To further illustrate the application range of this system, CcCIPK14 (Calcineurin B-like protein-interacting protein kinases) was transformed into pigeon pea using this transformation method. The transgenic plants were treated with jasmonic acid (JA) and abscisic acid (ABA), respectively, for the purpose of testing whether CcCIPK14 responds to those hormones. The results demonstrated that (1) exogenous hormones could significantly upregulate the expression levelof CcCIPK14, especially in CcCIPK14 over-expression (OE) plants; (2) the content of Genistein in CcCIPK14-OE lines was significantly higher than the control; (3) the expression level of two downstream key flavonoid synthase genes, CcHIDH1 and CcHIDH2, were up-regulated in the CcCIPK14-OE lines; and (4) the hairy root transgenic system can be used to study metabolically functional genes in non-model plants.

<meta charset="utf8"></head><body>효율적인 뿌리 형질전환 시스템을 조명하기 위한 CcCIPK14 유전자 기능 분석

Here we present an efficient and stable transformation system for the functional analysis of the CcCIPK14 gene as an example, providing a technical basis for studying the metabolism of non-model plants.

CCCIP14 효율적인 뿌리 형질전환 시스템을 조명하기 위한 유전자 기능 분석

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an ...

CRISPRmass를 사용한 고처리량 UAS-cDNA/ORF 플라스미드 라이브러리 구축

CRISPR-Based Modular Assembly for High-Throughput Construction of a UAS-cDNA/ORF Plasmid Library

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. Conventional approaches for plasmid library construction are time-consuming and laborious. Therefore, we recently developed a simple and efficient method, CRISPR-based modular assembly (CRISPRmass), for high-throughput construction of a genome-wide upstream activating sequence-complementary DNA/open reading frame (UAS-cDNA/ORF) plasmid library. Here, we present a protocol for CRISPRmass, taking as an example the construction of a GAL4/UAS-based UAS-cDNA/ORF plasmid library. The protocol includes massively parallel two-step test tube reactions followed by bacterial transformation. The first step is to linearize the existing complementary DNA (cDNA) or open reading frame (ORF) cDNA or ORF library plasmids by cutting the shared upstream vector sequences adjacent to the 5&#39; end of cDNAs or ORFs using CRISPR/Cas9 together with single guide RNA (sgRNA), and the second step is to insert a UAS module into the linearized cDNA or ORF plasmids using a single step reaction. CRISPRmass allows the simple, fast, efficient, and cost-effective construction of various plasmid libraries. The UAS-cDNA/ORF plasmid library can be utilized for gain-of-function screening in cultured cells and for constructing a genome-wide transgenic UAS-cDNA/ORF library in Drosophila.&#160;

저자 스포트라이트: Simplifying Genome-Wide Plasmid Library Construction Using CRISPRmass

We present a protocol for CRISPR-based modular assembly (CRISPRmass), a method for high-throughput construction of UAS-cDNA/ORF plasmid library in Drosophila using publicly available cDNA/ORF resources. CRISPRmass can be applied to editing various plasmid libraries.

UAS-cDNA/ORF Plasmid Library의 고처리량 구축을 위한 CRISPR-based Modular Assembly

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. ...

Gene Digital Circuits Based on CRISPR-Cas Systems and Anti-CRISPR Proteins

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the CRISPR-Cas systems and their natural inhibitors-the anti-CRISPR proteins (Acrs)-provides a new tool to design and implement in vivo gene digital circuits. Here, we describe a protocol that follows the idea of the "Design-Build-Test-Learn" biological engineering cycle and makes use of dCas9/dCas12a together with their corresponding Acrs to establish small transcriptional networks, some of which behave like Boolean gates, in Saccharomyces cerevisiae. These results point out the properties of dCas9/dCas12a as transcription factors. In particular, to achieve maximal activation of gene expression, dSpCas9 needs to interact with an engineered scaffold RNA that collects multiple copies of the VP64 activation domain (AD). In contrast, dCas12a shall be fused, at the C terminus, with the strong VP64-p65-Rta (VPR) AD. Furthermore, the activity of both Cas proteins is not enhanced by increasing the amount of sgRNA/crRNA in the cell. This article also explains how to build Boolean gates based on the CRISPR-dCas-Acr interaction. The AcrIIA4 fused hormone-binding domain of the human estrogen receptor is the core of a NOT gate responsive to &#946;-estradiol, whereas AcrVAs synthesized by the inducible GAL1 promoter permits to mimic both YES and NOT gates with galactose as an input. In the latter circuits, AcrVA5, together with dLbCas12a, showed the best logic behavior.

CRISPR-Cas systems and anti-CRISPR proteins were integrated into the scheme of Boolean gates in Saccharomyces cerevisiae. The new small logic circuits showed good performance and deepened the understanding of both dCas9/dCas12a-based transcription factors and the properties of anti-CRISPR proteins.

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the ...

생체공학

형질전환 대두 털 뿌리의 고효율 생산

Soybean Hairy Root Transformation for the Analysis of Gene Function

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with soil-borne microbes that form symbiosis to fix nitrogen and pathogens, which makes research involving soybean root genetics of prime importance to improve its agricultural production. The genetic transformation of soybean hairy roots (HRs) is mediated by the Agrobacterium rhizogenes strain NCPPB2659 (K599) and is an efficient tool for studying gene function in soybean roots, taking only 2 months from start to finish. Here, we provide a detailed protocol that outlines the method for overexpressing and silencing a gene of interest in soybean HRs. This methodology includes soybean seed sterilization, infection of cotyledons with K599, and the selection and harvesting of genetically transformed HRs for RNA isolation and, if warranted, metabolite analyses. The throughput of the approach is sufficient to simultaneously study several genes or networks and could determine the optimal engineering strategies prior to committing to long-term stable transformation approaches.

저자 스포트라이트: 유전자 기능 분석을 위한 대두 털 뿌리 형질전환  

Here, we present a protocol for the high-efficiency production of transgenic soybean hairy roots.

유전자 기능 분석을 위한 콩 털이 뿌리 형질전환

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with ...

토마토 털이 뿌리의 생성에 의한 높은 처리량 CRISPR 벡터 건설 및 DNA 수정의 특성

요약

더 많은 비디오 탐색

이 비디오의 챕터

Nicotiana Benthamiana 에 과도 식 보관 생산 대리점 규모에 대 한 나뭇잎

세균성 윌트 질병의 간단한 유전 분석을 위한 랄스토니아 솔라나세아룸에 의한 접종에 이어 토마토 뿌리 변환

아그로박테리움 뿌리줄기에의한 털이 많은 뿌리 유도 -타르타르 메밀의 매개 변형(파고피룸 타타리쿰)

CCCIP14 효율적인 뿌리 형질전환 시스템을 조명하기 위한 유전자 기능 분석

CCCIP14 효율적인 뿌리 형질전환 시스템을 조명하기 위한 유전자 기능 분석

UAS-cDNA/ORF Plasmid Library의 고처리량 구축을 위한 CRISPR-based Modular Assembly

UAS-cDNA/ORF Plasmid Library의 고처리량 구축을 위한 CRISPR-based Modular Assembly

UAS-cDNA/ORF Plasmid Library의 고처리량 구축을 위한 CRISPR-based Modular Assembly

Gene Digital Circuits Based on CRISPR-Cas Systems and Anti-CRISPR Proteins

유전자 기능 분석을 위한 콩 털이 뿌리 형질전환