Siamo grati a Gianni Scimone di assistenza eccellente, con fare video.

La manipolazione dei campioni di sangue con infezione da HIV richiede alcune importanti raccomandazioni. Tutti i campioni di sangue devono essere trasportati in robusto perfetta tenuta. Si deve prestare attenzione al momento del ritiro del campione per evitare la contaminazione esterna del contenitore e di qualsiasi documentazione che accompagna il campione. Tutte le persone che trasformano sangue infetto devono indossare guanti. I guanti devono essere cambiati e lavati le mani dopo il completamento del trattamento del campione. Trattamento di infezione da HIV campioni di sangue deve essere fatto in un armadio di classe II cofano rischio biologico. Ausili meccanici pipettaggio dovrebbero essere usati. L&#39;uso di aghi o altri oggetti da taglio (tra cui ad esempio pipette in vetro o tubi capillari) deve essere limitato alle situazioni in cui non c&#39;è alternativa. Laboratorio superfici devono essere decontaminati con un disinfettante chimico; dopo una fuoriuscita di sangue e quando le attività lavorative sono stati completati. Materiali contaminati utilizzati devono essere decontaminati prima di riutilizzare o devono essere smaltiti correttamente i rifiuti attraverso il percorso clinico. Ogni caso di esposizione professionale a sangue o fluidi potenzialmente infetti (ad esempio, quelli che richiedono precauzioni universali) devono essere trattati come emergenza medica, gli interventi devono essere avviate tempestivamente per essere efficace. Il protocollo prevede 5 giorni per il suo completamento. Il calendario è illustrato dalla Figura 1. Specie batteriche sono identificate con le modalità descritte nella Figura 2. 1. Raccolta dei campioni <ol><li> 9 ml di sangue intero è disegnato in provette contenenti EDTA. </li><li> Tubi vengono centrifugati a 2000 rpm per 10 minuti a temperatura ambiente per ottenere il plasma. </li><li> Plasma viene raccolto in una sterile 2 ml Eppendorf-tubo. </li></ol> 2. Estrazione di DNA da campioni di plasma <ol><li> Disinfettare adeguatamente cappuccio, pipette e materiali necessarie per l&#39;esperimento in modo da garantire la sterilità. </li><li> Posizione di tutti i materiali sotto le luci UV per almeno 30 minuti. </li><li> Pulire i guanti con un disinfettante. </li><li> Immergere un paio di asciugamani di carta in etanolo e metterli sotto il cofano. Ogni volta che un suggerimento è stato scartato pulire la pipetta sulla carta assorbente bagnata. </li></ol> Il DNA è estratto utilizzando un kit commerciale seguendo le istruzioni del produttore (Easy-DNA Kit, Invitrogen, Carlsbad CA, USA). <ol start="5"><li> 350 ml di plasma sono inseriti in un tubo di 2 ml Eppendorf sterile. </li><li> 350 ml di acqua ultrapura filtrata sono utilizzati come controllo negativo. </li><li> Aggiungere 10 ml di lisozima (1mg/ml) per i campioni. </li><li> Incubare per 30 minuti a 37 ° C. </li><li> Aggiungere 500 ml di Lysis Solution e mescolare delicatamente per i campioni. </li><li> Incubare per 7 minuti a 65 ° C. </li><li> Aggiungere 900 ml di cloroformio ai campioni. </li><li> Energicamente fino a quando i campioni sono presenti una viscosità uniforme. </li><li> Aggiungere 200 ml di soluzione precipitazioni e miscelare vigorosamente. </li><li> Centrifugare i campioni a 10500 rpm per 10 minuti a temperatura ambiente per separare le fasi e formare l&#39;interfaccia. </li><li> Trasferire la fase superiore acquosa ad una provetta fresco contenente 1 ml di etanolo al 100%. </li><li> Centrifugare i campioni a 10500 rpm per 10 minuti a 4 ° C. </li><li> Eliminare l&#39;etanolo. </li><li> Aggiungere 1 ml di etanolo al 70%. </li><li> Centrifugare i campioni alla massima velocità per 10 minuti a 4 ° C. </li><li> Eliminare l&#39;etanolo. L&#39;etanolo residuo deve essere rimosso con un pipettator. </li><li> Risospendere il pellet in 50 ml di acqua ultrapura. </li><li> Leggi concentrazione di DNA con uno spettrofotometro. </li></ol> 3. Gene rRNA 16S PCR PCR viene eseguita come descritto in precedenza 9. <ol><li> Amplificare il DNA in una miscela di reazione 100 microlitri costituito da 10 ml di tampone 10X PCR, 5 ml di 25 mM MgCl2, 5 ml di 2 mM dNTPs totale, 1 ml di 50 mM fondo RW01 (AACTGGAGGAAGGTGGGGAT), 1 ml di 50 mM fondo DG74 (AGGAGGTGATCCAACCGCA), 34 ml di H20 e 0,5 l di Taq polimerasi (AmpliTaq Oro, Applied Biosystems, Foster City, CA, USA). </li><li> Trasferire il mix di PCR nei filtri in modo da evitare eventuali contaminazioni da batteri Taq polimerasi. </li><li> Filtri di centrifuga (microcontrollore, Millipore, Billerica, MA, USA) per 30 minuti a 500 rcf a 4 ° C. </li><li> Aliquota del mix PCR in base al numero di campioni che devono essere amplificato (positivi e negativi controlli PCR, campioni e acqua estratta). </li><li> Utilizzare le seguenti condizioni termociclatore: 94 ° C per 10 minuti, 40 volte per 1 minuto ogni volta che a 94 ° C, 55 ° C e 72 ° C, ea 10 minuti a 72 ° C. </li><li> Visualizza il prodotto di PCR su un gel di agarosio al 2%. Utilizzare il 100 bp DNA ladder. Dimensione del prodotto PCR è di circa 360 bp (Figura 3). </li></ol> 4. Purificazione dei prodotti PCR Solo i campioni positivi alla PCR deve essere purificato. La purificazione viene eseguita utilizzandouno spot produttore seguendo le istruzioni del kit (PureLink PCR microkit, Invitrogen, Carlsbad CA, USA). <ol><li> Aggiungere 4 volumi di Binding Buffer contenente isopropanolo per 1 volume di prodotto della PCR. </li><li> Trasferimento del prodotto PCR con Binding Buffer a una colonna. </li><li> Centrifugare per 1 minuto a 10000 rcf a temperatura ambiente. </li><li> Lavare la colonna con tampone di lavaggio contenenti etanolo. </li><li> Centrifugare per 1 minuto a 10000 rcf a temperatura ambiente. </li><li> Centrifugare alla massima velocità per 1 minuto a temperatura ambiente per asciugare la membrana di silice e rimuovere eventuali residui di tampone di lavaggio con etanolo. </li><li> Aggiungere 10 ml di acqua ultrapura. </li><li> Incubare per 1 minuto a temperatura ambiente. </li><li> Centrifugare alla massima velocità per 2 minuti a temperatura ambiente per raccogliere il DNA purificato. </li></ol> 5. Clonazione Lisogenia Broth (LB) Preparazione Piastra <ol><li> Sciogliere 25 gr di mix LB in circa 800 ml di acqua. </li><li> Portare il volume finale a 1 L. </li><li> Aggiungere 15 gr di Bactoagar. </li><li> Autoclave per 20 minuti. </li><li> Dopo la sterilizzazione in autoclave, agitare vigorosamente la soluzione nel pallone di mescolare agar fuso. </li><li> Raffreddare la soluzione a 50 ° C. </li><li> Aggiungi ampicillina (50 mg / ml) e agitare fino a completa dissoluzione. </li><li> Versare nelle piastre ad una profondità di circa 3 mm. </li><li> Lasciare le piastre a temperatura ambiente. </li><li> Diffusione X-Gal (40mg/ml) e IPTG (100 mm) su ogni piatto LB ed incubare a 37 ° C fino al momento dell&#39;utilizzo. </li></ol> Cellule competenti Trasformazione La trasformazione è effettuata utilizzando le istruzioni di un produttore commerciale seguenti kit (Topo TA clonazione kit, Invitrogen, Carlsbad CA, USA). <ol><li> Preparare la miscela di reazione clonazione (1-4 ml di prodotto fresco PCR, 1 ml di soluzione di sale, 1 l di vettore e di acqua se necessario). </li><li> Mix di reazione delicatamente e incubare per 5-10 minuti a temperatura ambiente. </li><li> Posizionare la reazione sul ghiaccio. </li><li> Aggiungere 2 l di reazione clonazione in un flaconcino di cellule competenti e mescolare delicatamente. </li><li> Incubare in ghiaccio per 30 minuti. </li><li> Heat-shock le cellule per 30 secondi a 42 ° C. </li><li> Trasferire immediatamente il tubo in ghiaccio. </li><li> Aggiungere 250 l di media. </li><li> Chiudere la provetta tighly e agitare il tubo in posizione orizzontale a 37 ° C per 1 ora. </li><li> Stendere 50 microlitri di ogni trasformazione su un piatto preriscaldata selettiva. </li><li> Incubare per una notte a 37 ° C. </li></ol> Fase di incubazione, colonie bianche e blu si sviluppano su piastre. Colonie bianche sono positivi per l&#39;inserimento dei prodotti PCR e colonie blu sono negativi per l&#39;inserimento dei prodotti PCR. 6. Analisi di sequenziamento Reazione di sequenziamento <ol><li> Un mix è fatto uso di questi reagenti: 2,5 microlitri di DNA, 1 fondo microlitri (5pmol / mL) 1,1 BigDye microlitri (Applied Biosystems, Foster City, CA, USA). </li><li> Condizioni termiche cycler: 96 ° C per 1 minuto, 25 volte per 96 ° C per 10 sec, 55 ° C per 15 sec e 60 ° C per 4 min. </li></ol> Colonna di purificazione <ol><li> Per ogni reazione, preparare una colonna MicroSpin (Qiagen, Milano, Italia). </li><li> Invertire colonna e vortice di miscela di resina. </li><li> Snap dal fondo della colonna, allentare il coperchio ¼ di giro, e la colonna posto in una provetta. </li><li> Centrifuga 3200 rpm per 1 minuto. </li><li> Trasferimento colonna a una provetta pulita. </li><li> Con attenzione l&#39;intera pipetta reazione di sequenziamento della PCR al centro della colonna. </li><li> Centrifuga 3200 rpm per 1 minuto. </li><li> DNA purificato saranno eluite nel tubo (20 ml di acqua ultrapura). </li></ol> Analisi di sequenziamento <ol><li> Caricare il campione purificato (20 l) in 96-pozzetti della piastra. </li><li> Caricare la piastra nel sequencer. Sequencer DNA automatizzato generare una a quattro colori cromatogramma mostra i risultati della corsa di sequenziamento. </li><li> Ingresso la sequenza nucleotidica come una query sul database di sequenze pubblico. La ricerca viene effettuata sui database NCBI e server, con Basic strumento di ricerca locale di allineamento (BLAST). </li><li> Considerare i batteri solo con 98-100% omologie. </li></ol> 7. Rappresentante Risultati <img src="/files/ftp_upload/2830/2830fig1.jpg" alt="Figura 1" /> Figura 1. Temporale della procedura. <img src="/files/ftp_upload/2830/2830fig2.jpg" alt="Figura 2" /> Figura 2. Diagrammi di flusso di tutta la procedura di identificazione batterica. <img src="/files/ftp_upload/2830/2830fig3.jpg" alt="Figura 3" /> Figura 3. Gel di agarosio 2% mostrando un&#39;ampia gamma rRNA 16S PCR gene prodotti. Corsia 1 contiene una scala di 100bp DNA, corsia 2 contiene il controllo PCR positivo, corsia 3 mostra il controllo negativo PCR. Corsia 4 mostra i campioni da una paziente sieropositiva, e corsia 5 contiene acqua. Corsia 6 shcampioni OWS da un individuo sano e una reazione negativa PCR; corsia 7 contiene acqua. Solo i pazienti sieropositivi mostra una amplificazione PCR positivo. Acqua ultrapura utilizzata come controllo negativo durante la fase di estrazione, indica l&#39;assenza di contaminazione si è verificato. <img src="/files/ftp_upload/2830/2830fig4.jpg" alt="Figura 4" /> Figura 4. Gel di agarosio 0,7% mostrando plasmide estratto con procedura miniprep. Corsia 1 contiene un DNA 1 kilobase scaletta, corsia 2 contiene la colonia azzurra di controllo, corsie da 3 a 12 contengono colonie bianche. Il plasmide dalla colonia blu non contiene l&#39;inserto PCR prodotto. Tutte le 10 colonie bianche contengono plasmide con l&#39;inserto corretta. <img src="/files/ftp_upload/2830/2830fig5.jpg" alt="Figura 5" /> Figura 5. Mostra un esempio di analisi di sequenziamento batterico nel plasma da un individuo sieropositivo. I nostri risultati dimostrano che la traslocazione microbica in malattia da HIV comporta una flora polimicrobic, che non si vede in soggetti HIV-negativi, suggerendo sostanziale fallimento di immunità intestinale nel controllo traslocazione dei batteri.

<ol>
	<li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota.">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li><li>Macpherson, A. J., Harris, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+commensal+intestinal+bacteria+and+the+immune+system.">Interactions between commensal intestinal bacteria and the immune system.</a> Nat Rev Immunol. 4, 478-485 (2004).</li><li>Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+intestinal+flora+in+the+treatment+of+inflammatory+bowel+disease.">Modification of intestinal flora in the treatment of inflammatory bowel disease.</a> Curr Pharm Des. 9, 333-346 (2003).</li><li>Brenchley, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+a+cause+of+systemic+immune+activation+in+chronic+HIV+infection.">Microbial translocation is a cause of systemic immune activation in chronic HIV infection.</a> Nat Med. 12, 1365-1371 (2006).</li><li>Brenchley, J. M., Price, D. A., Douek, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+disease:+fallout+from+a+mucosal+catastrophe.">HIV disease: fallout from a mucosal catastrophe.</a> Nat Immunol. 7, 235-239 (2006).</li><li>Jiang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+levels+of+bacterial+DNA+correlate+with+immune+activation+and+the+magnitude+of+immune+restoration+in+persons+with+antiretroviral-treated+HIV+infection.">Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.</a> J Infect Dis. 199, 1177-1185 (2009).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+associated+with+sustained+failure+in+CD4++T-cell+reconstitution+in+HIV-infected+patients+on+long-term+highly+active+antiretroviral+therapy.">Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.</a> AIDS. 22, 2035-2038 (2008).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Microbial+Translocation+and+Immune+Hyperactivation+in+Disease+Progression+of+HIV++Patients+with+Preserved+CD4+Count+in+the+Absence+of+ART.">Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART.</a> , (2010).</li><li>Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+primers+and+probes+for+the+16S+rRNA+gene+of+most+species+of+pathogenic+bacteria,+including+bacteria+found+in+cerebrospinal+fluid.">PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.</a> J Clin Microbiol. 32, 335-351 (1994).</li></ol>

Nessun conflitto di interessi dichiarati.

<p class="jove_content"&gt; Con la presente mostra una PCR / sequenziamento del protocollo per caratterizzare la traslocazione di batteri nel sangue periferico di individui affetti da HIV.</p&gt;<p class="jove_content"Risultati&gt; I più affidabili si ottengono quando si usa plasma raccolto in EDTA contenenti tubi. Dopo il prelievo di sangue, plasma devono essere separati per centrifugazione entro 2 / 3 ore, per evitare emolisi e frammento di degradazione del DNA. I campioni vengono conservati prima a -20 ° C per circa 5 giorni e poi a -80 °...

<table border="1"><tbody><tr><th> Nome del reagente </th><th> Azienda </th><th> Numero di catalogo </th><th> Commenti (opzionale) </th></tr><tr><td> Easty-DNA Kit </td><td> Invitrogen </td><td> K 180001 </td><td></td></tr><tr><td> Cloroformio </td><td> Sigma-Aldrich </td><td> C2432 </td><td></td></tr><tr><td> Etanolo </td><td> Sigma-Aldrich </td><td> E7203 </td><td></td><tr/><tr><td> Ultrapura Waer </td><td> Invitrogen </td><td> 10977049 </td><td></td></tr><tr><td> Lisozima </td><td> Fluka </td><td> 62970 </td><td> 10 mg / ml in acqua distillata </td></tr><tr><td> AmpliTaq Gold </td><td> Applied Biosystems </td><td> 26478701 </td><td></td></tr><tr><td> Microcontrollore 100 </td><td> Millipore </td><td> 42413 </td><td></td></tr><tr><td> PCR primer </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Agarosio </td><td> Eppendorf </td><td> C1343 </td><td></td></tr><tr><td> DNA ladder </td><td> Invitrogen </td><td> 15628019 </td><td></td></tr><tr><td> Purelink PCR micro kit </td><td> Invitrogen </td><td> K310050 </td><td></td></tr><tr><td> Agar LB, polvere </td><td> Invitrogen </td><td> 22700025 </td><td></td></tr><tr><td> Bactoagar </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Ampicillina </td><td> Invitrogen </td><td> 11593027 </td><td> 10 mg / ml in acqua distillata </td></tr><tr><td> X-gal </td><td> Invitrogen </td><td> 15520034 </td><td> 40mg/mL in DMF </td></tr><tr><td> IPTG </td><td> Invitrogen </td><td> 15529019 </td><td> 100mM in acqua distillata </td></tr><tr><td> Topo TA clonazione kit </td><td> Invitrogen </td><td> K450002 </td><td></td></tr><tr><td> Purelink rapida kit Miniprep plasmidi </td><td> Invitrogen </td><td> K210010 </td><td></td></tr><tr><td> Big colorante </td><td> Applied Biosystems </td><td> 4337455 </td><td></td></tr><tr><td> DyeEx 2,0 rotazione kit </td><td> Qiagen </td><td> 63204 </td><td></td></tr></tbody></table>

sequencing of bacterial microflora in peripheral blood: our experience with hiv-infected patients

La salute del tratto gastrointestinale è fisiologicamente colonizzate da una grande varietà di microbi commensali che influenzano lo sviluppo del umorale e cellulare 1,2 mucose del sistema immunitario. Microbiota è protetta dal sistema immunitario attraverso una forte barriera mucosale. Infezioni e antibiotici sono noti per alterare la barriera sia normale tratto gastrointestinale e la composizione dei batteri residenti, che può causare possibili anomalie immunitarie 3. HIV provoca una breccia nella barriera gastrointestinale con insufficienza progressiva di immunità mucosale e perdite nella circolazione sistemica di bioprodotti batteriche, come lipopolisaccaride e frammenti di DNA batterico, che contribuiscono ad attivazione immunitaria sistemica 4-7. Traslocazione microbica è implicato in HIV / AIDS immunopatogenesi e risposta alla terapia 4,8. Abbiamo voluto caratterizzare la composizione dei batteri translocating nel sangue periferico di pazienti affetti da HIV. Per perseguire il nostro scopo abbiamo istituito una reazione di PCR per il gene 16S ribosomiale panbacteric seguita da una analisi di sequenziamento. In breve, il sangue intero da entrambi i soggetti con infezione da HIV e sano viene usato. Dato che gli individui sani presentano normale omeostasi intestinale non traslocazione della microflora è atteso in questi pazienti. Dopo il prelievo di sangue intero da prelievo venoso e la separazione del plasma, il DNA è estratto dal plasma e utilizzato per eseguire una vasta gamma di reazioni PCR per il gene 16S ribosomiale panbacteric 9. Seguenti analisi purificazione PCR prodotto, la clonazione e il sequenziamento vengono eseguite.

Watch this Scientific Journal Video about Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients at JoVE.com

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Il nostro esperimento mostra come eseguire una analisi di sequenziamento di specie batteriche translocating nel sangue periferico di pazienti HIV positivi.

Sequenziamento di microflora batterica nel sangue periferico: la nostra esperienza con pazienti affetti da HIV

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral ...

sequencing-bacterial-microflora-peripheral-blood-our-experience-with

Research

JoVE Journal

Medicine

12.2K Views.  San Paolo Hospital University of Milan, Italy. Il nostro esperimento mostra come eseguire una analisi di sequenziamento di specie batteriche translocating nel sangue periferico di pazienti HIV positivi.

Video: Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Modeling Intracerebral Hemorrhage in Mice: Injection of Autologous Blood or Bacterial Collagenase

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related hospitalizations and for which no effective treatments are available to date1,2. Because of the heterogeneity of ICH in humans, various preclinical models are needed to thoroughly explore prospective therapeutic strategies3. Experimental ICH is commonly induced in rodents by intraparenchymal injection of either autologous blood or bacterial collagenase4. The appropriate model is selected based on the pathophysiology of hemorrhage induction and injury progression. The blood injection model mimics a rapidly progressing hemorrhage. Alternatively, bacterial collagenase enzymatically disrupts the basal lamina of brain capillaries, causing an active bleed that generally evolves over several hours5. Resultant perihematomal edema and neurofunctional deficits can be quantified from both models. In this study, we described and evaluated a modified double injection model of autologous whole blood6 as well as an ICH injection model of bacterial collagenase7, both of which target the basal ganglia (corpus striatum) of male CD-1 mice. We assessed neurofunctional deficits and brain edema at 24 and 72 hr after ICH induction. Intrastriatal injection of autologous blood (30 &mu;l) or bacterial collagenase (0.075U) caused reproducible neurofunctional deficits in mice and significantly increased brain edema at 24 and 72 hr after surgery (p&lt;0.05). In conclusion, both models yield consistent hemorrhagic infarcts and represent basic methods for preclinical ICH research.

Clinically relevant animal models of intracerebral hemorrhage (ICH) are needed to extend our knowledge of hemorrhagic stroke and to examine novel therapeutic strategies. In this study, we describe and evaluate two ICH models that implement unilateral injections of either autologous whole blood or bacterial collagenase into the basal ganglia (corpus striatum) of mice.

Modellazione emorragia intracerebrale in Mouse: iniezione di sangue autologo o collagenasi batterica

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related ...

Ricerca

Medicina

Measuring Frailty in HIV-infected Individuals. Identification of Frail Patients is the First Step to Amelioration and Reversal of Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased reserve and resistance to stressors increases in incidence with increasing age. In the elderly, frailty may pursue a step-wise loss of function from non-frail to pre-frail to frail. We studied frailty in HIV-infected patients and found that ~20% are frail using the Fried phenotype using stringent criteria developed for the elderly1,2. In HIV infection the syndrome occurs at a younger age.
HIV patients were checked for 1) unintentional weight loss; 2) slowness as determined by walking speed; 3) weakness as measured by a grip dynamometer; 4) exhaustion by responses to a depression scale; and 5) low physical activity was determined by assessing kilocalories expended in a week's time. Pre-frailty was present with any two of five criteria and frailty was present if any three of the five criteria were abnormal.
The tests take approximately 10-15 min to complete and they can be performed by medical assistants during routine clinic visits. Test results are scored by referring to standard tables. Understanding which of the five components contribute to frailty in an individual patient can allow the clinician to address relevant underlying problems, many of which are not evident in routine HIV clinic visits.

Frailty syndrome is commonly seen in the aged and reflects multi-system physiological change. However, with reduced functional reserve and resilience frailty is also known to be common in the HIV infected population. This study outlined an easily administered screening test to identify HIV patients with frailty. When significant components of frailty are identified, clinicians will be able to focus on amelioration of the problem and promote reversion to the pre-frail state.

Frailty in soggetti con infezione da HIV di misura. Identificazione dei pazienti fragili è il primo passo per la selezione e la Storno Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased ...

Computerized Dynamic Posturography for Postural Control Assessment in Patients with Intermittent Claudication

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic conditions. As part of a diagnostic assessment, the early detection of postural deficits is important so that appropriate and targeted interventions can be prescribed. The Sensory Organization Test (SOT) on the EquiTest determines an individual&#39;s use of the sensory systems (somatosensory, visual, and vestibular) that are responsible for postural control. Somatosensory and visual input are altered by the calibrated sway-referenced support surface and visual surround, which move in the anterior-posterior direction in response to the individual&#39;s postural sway. This creates a conflicting sensory experience. The Motor Control Test (MCT) challenges postural control by creating unexpected postural disturbances in the form of backwards and forwards translations. The translations are graded in magnitude and the time to recover from the perturbation is computed.
Intermittent claudication, the most common symptom of peripheral arterial disease, is characterized by a cramping pain in the lower limbs and caused by muscle ischemia secondary to reduced blood flow to working muscles during physical exertion. Claudicants often display poor balance, making them susceptible to falls and activity avoidance. The Ankle Brachial Pressure Index (ABPI) is a noninvasive method for indicating the presence of peripheral arterial disease and intermittent claudication, a common symptom in the lower extremities. ABPI is measured as the highest systolic pressure from either the dorsalis pedis or posterior tibial artery divided by the highest brachial artery systolic pressure from either arm. This paper will focus on the use of computerized dynamic posturography in the assessment of balance in claudicants.

Individuals with intermittent claudication exhibit poor balance compared to healthy controls. Computerized dynamic posturography is an objective method for measuring an individual's postural responses to balance disturbances. This provides an objective reflection of the person&#x2019;s ability to respond to situations under which sensory stimuli are altered and unexpected perturbations occur.

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic ...

Assessment of Vascular Function in Patients With Chronic Kidney Disease

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this is only partially explained by traditional CVD risk factors. Vascular dysfunction is an important non-traditional risk factor, characterized by vascular endothelial dysfunction (most commonly assessed as impaired endothelium-dependent dilation [EDD]) and stiffening of the large elastic arteries. While various techniques exist to assess EDD and large elastic artery stiffness, the most commonly used are brachial artery flow-mediated dilation (FMDBA) and aortic pulse-wave velocity (aPWV), respectively. Both of these noninvasive measures of vascular dysfunction are independent predictors of future cardiovascular events in patients with and without kidney disease. Patients with CKD demonstrate both impaired FMDBA, and increased aPWV. While the exact mechanisms by which vascular dysfunction develops in CKD are incompletely understood, increased oxidative stress and a subsequent reduction in nitric oxide (NO) bioavailability are important contributors. Cellular changes in oxidative stress can be assessed by collecting vascular endothelial cells from the antecubital vein and measuring protein expression of markers of oxidative stress using immunofluorescence. We provide here a discussion of these methods to measure FMDBA, aPWV, and vascular endothelial cell protein expression.

The degree of vascular dysfunction and contributing physiological mechanisms can be assessed in patients with chronic kidney disease by measuring brachial artery flow-mediated dilation, aortic pulse-wave velocity, and vascular endothelial cell protein expression.

Valutazione della funzione vascolare nei pazienti con malattia renale cronica

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

Ortotopico impianto e periferico immunitario monitoraggio cellulare nel Modello II-45 Singenico Rat mesotelioma

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Endotoxin Activity Assay for the Detection of Whole Blood Endotoxemia in Critically Ill Patients

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis and septic shock. The early identification of an infectious process that is rapidly evolving to a critical illness might prompt a quicker and more intensive treatment, thereby potentially leading to better patient outcomes. The Endotoxin Activity (EA) assay can be used at the bedside as a reliable biomarker of systemic endotoxemia. The detection of elevated endotoxin activity levels has been repeatedly shown to be associated with an increased disease severity in patients with sepsis and septic shock. The assay is quick and easy to perform. Briefly, after sampling, an aliquot of whole blood is mixed with an anti-endotoxin antibody and with added LPS. Endotoxin activity is measured as the relative oxidative burst of primed neutrophils as detected by chemioluminescence. The assay&#39;s output is expressed on a scale from 0 (absent) to 1 (maximal) and categorized as &#8220;low&#8221; (&#60;0.4 units), &#8220;intermediate&#8221; (0.4&#8211;0.59 units), or &#8220;high&#8221; (&#8805;0.6 units). The detailed methodology and rationale for the implementation of the EA assay are reported in this manuscript.

We hereby present a protocol to measure at the bedside the endotoxin activity of human whole blood samples. The Endotoxin Activity assay is a simple test to perform and may be a useful biomarker in critically ill patients with sepsis.

Analisi dell'attività dell'endotossina per il rilevamento dell'endotossiamia del sangue intero nei pazienti in malattia critica

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis ...

Semi-quantitative Assessment Using [18F]FDG Tracer in Patients with Severe Brain Injury

Patients with severe traumatic brain injury (sTBI) have difficulty knowing whether they are accurately expressing their thoughts and emotions because of disorders of consciousness, disrupted higher brain function, and verbal disturbances. As a consequence of an insufficient ability to communicate, objective evaluations are needed from family members, medical staff, and caregivers. One such evaluation is the assessment of functioning brain areas. Recently, multimodal brain imaging has been used to explore the function of damaged brain areas. [18F]-fluorodeoxyglucose positron emission tomography-computed tomography ([18F]FDG-PET/CT) is a successful tool for examining brain function. However, the assessment of brain glucose metabolism based on [18F]FDG-PET/CT is not standardized and depends on several varying parameters, as well as the patient&#39;s condition. Here, we describe a series of semiquantitative assessment protocols for a region-of-interest (ROI) image analysis using self-produced [18F]FDG tracers in patients with sTBI. The protocol focuses on screening the participants, preparing the [18F]FDG tracer in the hot lab, scheduling the acquisition of [18F]FDG-PET/CT brain images, and measuring glucose metabolism using the ROI analysis from a targeted brain area.

Semi-quantitative Assessment Using [18F]FDG Tracer in Patients with Severe Brain Injury

[18F]-fluorodeoxyglucose (FDG) positron emission tomography-computed tomography is useful for studying glucose metabolism related to brain function. Here, we present a protocol for an [18F]FDG tracer set-up and semiquantitative assessment of the region-of-interest analysis for targeted brain areas associated with clinical manifestations in patients with severe traumatic brain injury.

Valutazione semi-quantitativa utilizzando [18F] FDG Tracer in pazienti con trauma cranico severo

Patients with severe traumatic brain injury (sTBI) have difficulty knowing whether they are accurately expressing their thoughts and emotions because of ...

Integration of Brain Tissue Saturation Monitoring in Cardiopulmonary Exercise Testing in Patients with Heart Failure

Cerebral hypo-oxygenation during rest or exercise negatively impacts the exercise capacity of patients with heart failure with reduced ejection fraction (HF). However, in clinical cardiopulmonary exercise testing (CPET), cerebral hemodynamics is not assessed. NIRS is used to measure cerebral tissue oxygen saturation (SctO2) in the frontal lobe. This method is reliable and valid and has been utilized in several studies. SctO2 is lower during both rest and peak exercise in patients with HF than in healthy controls (66.3 &#177; 13.3% and 63.4 &#177; 13.8% vs. 73.1 &#177; 2.8% and 72 &#177; 3.2%). SctO2 at rest is significantly linearly correlated with peak VO2 (r = 0.602), oxygen uptake efficiency slope (r = 0.501), and brain natriuretic peptide (r = -0.492), all of which are recognized prognostic and disease severity markers, indicating its potential prognostic value. SctO2 is determined mainly by end-tidal CO2 pressure, mean arterial pressure, and hemoglobin in the HF population. This article demonstrates a protocol that integrates SctO2 using NIRS into incremental CPET on a calibrated bicycle ergometer.

This protocol integrated near-infrared spectroscopy into conventional cardiopulmonary exercise testing to identify the involvement of the cerebral hemodynamic response in exercise intolerance in patients with heart failure.

Integrazione del monitoraggio della saturazione dei tessuti cerebrali nei test di esercizio cardiopolmonare in pazienti con insufficienza cardiaca

Cerebral hypo-oxygenation during rest or exercise negatively impacts the exercise capacity of patients with heart failure with reduced ejection fraction ...

Real-Time Monitoring of Neurocritical Patients with Diffuse Optical Spectroscopies

Neurophysiological monitoring is an important goal in the treatment of neurocritical patients, as it may prevent secondary damage and directly impact morbidity and mortality rates. However, there is currently a lack of suitable non-invasive, real-time technologies for continuous monitoring of cerebral physiology at the bedside. Diffuse optical techniques have been proposed as a potential tool for bedside measurements of cerebral blood flow and cerebral oxygenation in case of neurocritical patients. Diffuse optical spectroscopies have been previously explored to monitor patients in several clinical scenarios ranging from neonatal monitoring to cerebrovascular interventions in adults. However, the feasibility of the technique to aid clinicians by providing real-time information at the bedside remains largely unaddressed. Here, we report the translation of a diffuse optical system for continuous real-time monitoring of cerebral blood flow, cerebral oxygenation, and cerebral oxygen metabolism during intensive care. The real-time feature of the instrument could enable treatment strategies based on patient-specific cerebral physiology rather than relying on surrogate metrics, such as arterial blood pressure. By providing real-time information on the cerebral circulation at different time scales with relatively cheap and portable instrumentation, this approach may be especially useful in low-budget hospitals, in remote areas and for&#160;monitoring in open fields (e.g., defense and sports).

Presented here is a protocol for non-invasively monitoring cerebral hemodynamics of neurocritical patients in real-time and at the bedside using diffuse optics. Specifically, the proposed protocol uses a hybrid diffuse optical systems to detect and display real-time information on cerebral oxygenation, cerebral blood flow and cerebral metabolism.

Monitoraggio in tempo reale di pazienti neurocritici con spettroscopie ottiche diffuse

Neurophysiological monitoring is an important goal in the treatment of neurocritical patients, as it may prevent secondary damage and directly impact ...

Digital Handwriting Analysis of Characters in Chinese Patients with Mild Cognitive Impairment

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) can manifest fine motor disorders of the upper extremities. Handwriting is a complex and unique human activity involving both motor and cognitive coordination. Researchers from western countries have discovered that patients with MCI have abnormal handwriting features. However, no relevant studies have been conducted in the Chinese population. Owing to the cross-culture phenomenon of handwriting, the aim of this study is to find new handwriting tasks to demonstrate the differences in handwriting features between elderly patients with MCI and age-matched healthy individuals.

This study proposed a digital handwriting analysis of characters in individuals with mild cognitive impairment to find more information than is revealed by traditional pencil&#8211;paper handwriting analysis.

Analisi digitale della grafia dei caratteri nei pazienti cinesi con lieve deficit cognitivo

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) ...