Wir sind dankbar, dass Gianni Scimone für hervorragende Unterstützung mit Video machen.

Behandlung von HIV-infizierten Blutproben erfordert einige wichtige Empfehlungen. Alle Proben von Blut muss in robuster auslaufsicheren Behältern transportiert werden. Vorsicht beim Sammeln der Proben eine Kontamination des Containers Außen-und einer begleitenden Unterlagen der Probe zu vermeiden. Alle Personen, die Verarbeitung infiziertes Blut muss Handschuhe tragen. Handschuhe müssen geändert werden und die Hände gewaschen nach Abschluss der Verarbeitung von Proben. Die Verarbeitung von HIV-infizierten Blutprobe muss in einer Klasse II Biohazard Kabinett Haube getan werden. Mechanische Pipettierhilfen verwendet werden sollte. Verwendung von Nadeln oder andere spitze oder scharfe Gegenstände (einschließlich Glas z. B. Pipetten oder Kapillaren) auf Situationen, in denen es keine Alternative zu beschränken. Laboratory Flächen müssen mit einem geeigneten chemischen Desinfektionsmittel nach einem Austritt von Blut dekontaminiert werden und wenn Tätigkeiten abgeschlossen sind. Verunreinigte Materialien müssen vor der Wiederverwendung dekontaminiert werden oder müssen korrekt entsorgt werden über die klinische Abfälle Route. Jeder Vorfall von beruflicher Exposition gegenüber potenziell infektiösem Blut oder Flüssigkeiten (dh diejenigen, erfordert universelle Vorsichtsmaßnahmen) sollte als medizinischer Notfall behandelt werden, da Interventionen zeitnah eingeleitet werden muss, um wirksam zu sein. Das Protokoll benötigt 5 Tage für seine Vollendung. Der Zeitrahmen ist in Abbildung 1 dargestellt sind. Bakterienarten identifiziert werden mit den Methoden in Abbildung 2 beschrieben. 1. Probengewinnung <ol><li> 9 ml Vollblut in EDTA enthaltenden Röhrchen gezogen. </li><li> Die Rohre werden bei 2000 rpm für 10 Minuten bei RT zentrifugiert, um Plasma zu erhalten. </li><li> Plasma wird in einer sterilen 2 ml Eppendorf-Röhrchen gesammelt. </li></ol> 2. DNA-Extraktion aus Plasmaproben <ol><li> Ausreichend desinfizieren Kapuze, Pipetten und Material für das Experiment nötig, um die Sterilität zu gewährleisten. </li><li> Position aller Materialien unter UV-Licht für mindestens 30 Minuten. </li><li> Wischen Sie Handschuhe mit einem Desinfektionsmittel. </li><li> Tränken Sie ein paar Papiertücher in Ethanol und legen Sie sie unter der Haube. Jedes Mal, wenn ein Trinkgeld wird verworfen wischen Sie die Pipette auf die nasse Papiertücher. </li></ol> DNA extrahiert Verwendung eines kommerziellen Kits nach den Anweisungen des Herstellers (Easy-DNA Kit, Invitrogen, Carlsbad CA, USA). <ol start="5"><li> 350 ul Plasma in ein steriles 2 ml Eppendorf-Röhrchen gegeben. </li><li> 350 ul gefiltert Reinstwasser als negative Kontrolle verwendet. </li><li> Add 10 l Lysozym (1mg/ml) zu den Proben. </li><li> Inkubieren für 30 Minuten bei 37 ° C. </li><li> Add 500 ul von Lysis Solution und vorsichtig mischen, um die Proben. </li><li> Inkubieren für 7 Minuten bei 65 ° C. </li><li> Add 900 ul Chloroform zu den Proben. </li><li> Vortex kräftig, bis die Proben gleichmäßig viskos sind. </li><li> Geben Sie 200 ul des Niederschlags-Lösung und kräftig vortexen. </li><li> Centrifuge Proben bei 10500 rpm für 10 Minuten bei RT zur Trennung der Phasen und bilden die Schnittstelle. </li><li> Übertragen Sie die obere wässrige Phase in ein frisches Reaktionsgefäß mit 1 ml Ethanol 100%. </li><li> Centrifuge Proben bei 10500 rpm für 10 Minuten bei 4 ° C. </li><li> Ethanol entfernen. </li><li> Add 1 ml Ethanol 70%. </li><li> Centrifuge Proben bei maximaler Geschwindigkeit für 10 Minuten bei 4 ° C. </li><li> Ethanol entfernen. Die restliche Ethanol sollte mit einem pipettator entfernt werden. </li><li> Das Pellet in 50 ul von Reinstwasser. </li><li> Lesen DNA-Konzentration mit einem Spektralphotometer. </li></ol> 3. 16S rRNA Gene PCR PCR-Amplifikation wird wie zuvor beschrieben 9 durchgeführt. <ol><li> Amplify DNA in einem 100 ul Reaktionsansatz, bestehend aus 10 ul 10x PCR-Puffer, 5 ul 25 mM MgCl2, 5 pl 2 mM insgesamt dNTPs, 1 ul 50 uM Primer RW01 (AACTGGAGGAAGGTGGGGAT), 1 ul 50 uM Primer DG74 (AGGAGGTGATCCAACCGCA), 34 ul H20 und 0,5 ul Taq-Polymerase (AmpliTaq Gold, Applied Biosystem, Foster City, CA, USA). </li><li> Transfer der PCR-Mischung Filter, um eine mögliche Kontamination durch bakterielle Taq-Polymerase zu vermeiden. </li><li> Centrifuge Filter (Microcon, Millipore, Billerica, MA, USA) für 30 Minuten bei 500 rcf bei 4 ° C. </li><li> Aliquot der PCR-Mix nach der Anzahl der Proben, die verstärkt (positive und negative PCR Kontrollen, Proben und extrahiert Wasser) werden müssen. </li><li> Verwenden Sie die folgenden Thermocycler Bedingungen: 94 ° C für 10 Minuten; 40-mal für je 1 Minute Zeit bei 94 ° C, 55 ° C und 72 ° C und 10 min bei 72 ° C. </li><li> Visualisieren Sie die PCR-Produkt auf einem 2% Agarosegel. Verwenden Sie 100 bp DNA-Leiter. PCR-Produkt beträgt ca. 360 bp (Abbildung 3). </li></ol> 4. PCR Produkt Purification Nur PCR-positiven Proben sollten gereinigt werden. Die Reinigung erfolgt mit Hilfeeines kommerziellen Kits nach den Anweisungen des Herstellers (PureLink PCR microkit, Invitrogen, Carlsbad CA, USA). <ol><li> Add 4 Volumen Binding Buffer mit Isopropanol pro 1 Volumen PCR-Produkt. </li><li> Transfer-PCR-Produkt mit Binding Buffer, um eine Spalte. </li><li> Zentrifuge für 1 Minute bei 10000 rcf bei RT. </li><li> Wash-Säule mit Waschpuffer mit Ethanol. </li><li> Zentrifuge für 1 Minute bei 10000 rcf bei RT. </li><li> Zentrifuge bei maximaler Geschwindigkeit für 1 Minute bei RT auf die Silica-Membran trocknen und entfernen Sie alle verbleibenden Waschpuffer mit Ethanol. </li><li> Add 10 l Reinstwasser. </li><li> Inkubation für 1 Minute bei RT. </li><li> Zentrifuge bei maximaler Geschwindigkeit für 2 Minuten bei RT auf die gereinigte DNA zu sammeln. </li></ol> 5. Cloning Lysogenie Broth (LB) Platte Vorbereitung <ol><li> Lösen Sie 25 g LB-Mix in ca. 800 ml Wasser. </li><li> Bringen Sie das Endvolumen auf 1 L. </li><li> Add 15 gr von Bactoagar. </li><li> Autoklaven für 20 Minuten. </li><li> Nach dem Autoklavieren kräftig Schwenken Sie die Lösung in die Flasche zu mischen geschmolzenem Agar. </li><li> Die Lösung wird auf 50 ° C. </li><li> Add Ampicillin (50 ug / ml) und schwenken, bis sie sich auflöst. </li><li> Platten gießen bis zu einer Tiefe von ca. 3mm. </li><li> Verlassen Sie die Platten bei Raumtemperatur. </li><li> Spread-X-Gal (40mg/ml) und IPTG (100 mM) auf jeder LB-Platte und bei 37 ° C bis zur Verwendung. </li></ol> Kompetente Zellen Transformation Transformation wird unter Verwendung eines kommerziellen Kits nach den Anweisungen des Herstellers (Topo TA Cloning Kit, Invitrogen, Carlsbad CA, USA). <ol><li> Bereiten Sie die Klonierungsreaktion Mix (1-4 ml frisches PCR-Produkt, 1 ul Salz-Lösung, 1 ul der Vektor-und Wasser, wenn nötig). </li><li> Mix Reaktion vorsichtig und inkubieren für 5-10 Minuten bei RT. </li><li> Legen Sie die Reaktion auf Eis. </li><li> Add 2 ul des Klonens Reaktion in ein Fläschchen mit kompetenten Zellen und vorsichtig mischen. </li><li> Inkubieren auf Eis für 30 Minuten. </li><li> Heat-Schock die Zellen für 30 Sekunden bei 42 ° C. </li><li> Sofort überweisen Sie den Schlauch in Eis. </li><li> Add 250 ul Medium. </li><li> Cap der Röhre fest sitzen und schütteln die Röhre horizontal bei 37 ° C für 1 Stunde. </li><li> Verbreiten Sie 50 ul von jeder Transformation auf eine vorgewärmte Platte selektive. </li><li> Inkubieren über Nacht bei 37 ° C. </li></ol> Nach der Inkubation zu entwickeln weiß und blaue Kolonien auf den Platten. Weiße Kolonien sind für PCR-Produkt Einsetzen positive und blaue Kolonien sind für PCR-Produkt Einsetzen negativ. 6. Sequencing Analysis Sequenzierreaktion <ol><li> Eine Mischung wird unter Verwendung dieser Reagenzien: 2,5 ul DNA, 1 ul Primer (5pmol / ul) 1,1 ul BigDye (Applied Biosystem, Foster City, CA, USA). </li><li> Thermal Cycler Bedingungen: 96 ° C für 1 Minute, 25 Mal für 96 ° C für 10 sec, 55 ° C für 15 sec und 60 ° C für 4 min. </li></ol> Säulenreinigung <ol><li> Für jede Reaktion der Vorbereitung, MicroSpin Column (Qiagen,, Mailand, Italien). </li><li> Invert Spalte und Wirbel um Harz zu mischen. </li><li> Snap off Sumpf der Kolonne, lösen Deckel ¼ Drehung, und legen Spalte in einem Reaktionsgefäß. </li><li> Zentrifuge 3200 rpm für 1 Minute. </li><li> Transfer-Spalte, um eine saubere Mikrozentrifugenröhrchen. </li><li> Sorgfältig Pipette das gesamte PCR-Sequenzierung Reaktion in der Mitte der Säule. </li><li> Zentrifuge 3200 rpm für 1 Minute. </li><li> Gereinigte DNA wird in das Rohr (20 ul von Reinstwasser) eluite. </li></ol> Sequencing Analysis <ol><li> Laden Sie die gereinigte Probe (20 ul) in 96-Multiwellplatte. </li><li> Legen Sie die Platte in den Sequenzer. Automatisierte DNA Sequencer erzeugen ein Vier-Farben-Chromatogramm, das die Ergebnisse der Sequenzierung laufen. </li><li> Geben Sie die Nukleotidsequenz wie eine Abfrage der öffentlichen Sequenz-Datenbanken. Die Suche basiert auf der NCBI-Datenbanken und-Servern ausgeführt, mit Basic Local Alignment Search Tool (BLAST). </li><li> Betrachten Sie nur Bakterien, die mit 98-100% Homologien. </li></ol> 7. Repräsentative Ergebnisse <img src="/files/ftp_upload/2830/2830fig1.jpg" alt="Abbildung 1" /> Abbildung 1. Timeline des Verfahrens. <img src="/files/ftp_upload/2830/2830fig2.jpg" alt="Abbildung 2" /> Abbildung 2. Flussdiagramme des gesamten Identifizierung von Bakterien Verfahren. <img src="/files/ftp_upload/2830/2830fig3.jpg" alt="Abbildung 3" /> Abbildung 3. 2% Agarosegel zeigt breites Spektrum 16S rRNA-Gen PCR-Produkte. Spur 1 enthält eine 100bp DNA-Leiter, Bahn 2 die PCR positive Kontrolle enthält, zeigt Spur 3 die negative PCR-Kontrolle. Lane 4 zeigt Proben aus einem HIV-positiven Patienten, und Spur 5 enthält Wasser. Spur 6 shows Proben von gesunden Menschen und einem negativen PCR-Reaktion, Spur 7 enthält Wasser. Nur HIV-positiven Patienten zeigt eine positive PCR-Amplifikation. Reinstwasser als negative Kontrolle während der Extraktion verwendet, bedeutet, dass keine Kontamination stattgefunden. <img src="/files/ftp_upload/2830/2830fig4.jpg" alt="Abbildung 4" /> Abbildung 4. 0,7% Agarosegel zeigt Plasmid mit Miniprep-Verfahren extrahiert. Spur 1 enthält eine 1 Kilobasen DNA-Leiter, enthält Spur 2 die blaue Kontroll-Kolonie, Bahnen 3 bis 12 enthalten weiße Kolonien. Das Plasmid aus dem blauen Kolonie enthält nicht die PCR-Produkt einfügen. Alle 10 weißen Kolonien enthalten Plasmid mit dem richtigen einfügen. <img src="/files/ftp_upload/2830/2830fig5.jpg" alt="Abbildung 5" /> Abbildung 5. Zeigt ein Beispiel der bakteriellen Sequenzierung im Plasma von einem HIV-positiven Menschen. Unsere Ergebnisse zeigen, dass mikrobielle Translokation in HIV Krankheit eine polimicrobic Flora, die nicht in HIV-negativen Patienten ist zu sehen, was darauf hindeutet erheblichen Ausfall von gut Immunität in die Kontrolle der Bakterien Translokation betrifft.

<ol>
	<li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota.">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li><li>Macpherson, A. J., Harris, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+commensal+intestinal+bacteria+and+the+immune+system.">Interactions between commensal intestinal bacteria and the immune system.</a> Nat Rev Immunol. 4, 478-485 (2004).</li><li>Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+intestinal+flora+in+the+treatment+of+inflammatory+bowel+disease.">Modification of intestinal flora in the treatment of inflammatory bowel disease.</a> Curr Pharm Des. 9, 333-346 (2003).</li><li>Brenchley, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+a+cause+of+systemic+immune+activation+in+chronic+HIV+infection.">Microbial translocation is a cause of systemic immune activation in chronic HIV infection.</a> Nat Med. 12, 1365-1371 (2006).</li><li>Brenchley, J. M., Price, D. A., Douek, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+disease:+fallout+from+a+mucosal+catastrophe.">HIV disease: fallout from a mucosal catastrophe.</a> Nat Immunol. 7, 235-239 (2006).</li><li>Jiang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+levels+of+bacterial+DNA+correlate+with+immune+activation+and+the+magnitude+of+immune+restoration+in+persons+with+antiretroviral-treated+HIV+infection.">Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.</a> J Infect Dis. 199, 1177-1185 (2009).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+associated+with+sustained+failure+in+CD4++T-cell+reconstitution+in+HIV-infected+patients+on+long-term+highly+active+antiretroviral+therapy.">Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.</a> AIDS. 22, 2035-2038 (2008).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Microbial+Translocation+and+Immune+Hyperactivation+in+Disease+Progression+of+HIV++Patients+with+Preserved+CD4+Count+in+the+Absence+of+ART.">Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART.</a> , (2010).</li><li>Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+primers+and+probes+for+the+16S+rRNA+gene+of+most+species+of+pathogenic+bacteria,+including+bacteria+found+in+cerebrospinal+fluid.">PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.</a> J Clin Microbiol. 32, 335-351 (1994).</li></ol>

<p class="jove_content"&gt; Hiermit zeigen ein PCR / Sequenzierung Protokoll, um die Translokation von Bakterien im peripheren Blut von HIV-infizierten Personen zu charakterisieren.</p&gt;<p class="jove_content"&gt; Die meisten zuverlässige Ergebnisse werden erzielt, wenn mittels Plasma in EDTA-haltige Röhrchen gesammelt. Nach der Blutentnahme sollte Plasma durch Zentrifugation in 2 / 3 Stunden auseinander liegen, um Hämolyse und DNA-Fragment Abbau zu vermeiden. Die Proben werden zunächst bei -20 ° C für ca. 5 Tage und dann bei -80 ° C g...

<table border="1"><tbody><tr><th> Name des Reagenz </th><th> Firma </th><th> Katalog-Nummer </th><th> Kommentare (optional) </th></tr><tr><td> Easty-DNA Kit </td><td> Invitrogen </td><td> K 180001 </td><td></td></tr><tr><td> Chloroform </td><td> Sigma-Aldrich </td><td> C2432 </td><td></td></tr><tr><td> Ethanol </td><td> Sigma-Aldrich </td><td> E7203 </td><td></td><tr/><tr><td> UltraPure Waer </td><td> Invitrogen </td><td> 10977049 </td><td></td></tr><tr><td> Lysozym </td><td> Fluka </td><td> 62970 </td><td> 10 ug / ml in destilliertem Wasser </td></tr><tr><td> AmpliTaq Gold </td><td> Applied Biosystem </td><td> 26478701 </td><td></td></tr><tr><td> Microcon 100 </td><td> Millipore </td><td> 42413 </td><td></td></tr><tr><td> PCR-Primer </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Agarose </td><td> Eppendorf </td><td> C1343 </td><td></td></tr><tr><td> DNA-Leiter </td><td> Invitrogen </td><td> 15628019 </td><td></td></tr><tr><td> Purelink PCR Mikro-Kit </td><td> Invitrogen </td><td> K310050 </td><td></td></tr><tr><td> LB-Agar, Pulver </td><td> Invitrogen </td><td> 22700025 </td><td></td></tr><tr><td> Bactoagar </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Ampicillin </td><td> Invitrogen </td><td> 11593027 </td><td> 10 mg / mL in destilliertes Wasser </td></tr><tr><td> X-gal </td><td> Invitrogen </td><td> 15520034 </td><td> 40mg/mL in DMF </td></tr><tr><td> IPTG </td><td> Invitrogen </td><td> 15529019 </td><td> 100 mM in destilliertes Wasser </td></tr><tr><td> Topo TA Cloning Kit </td><td> Invitrogen </td><td> K450002 </td><td></td></tr><tr><td> Purelink Schnelle Plasmid Miniprep Kit </td><td> Invitrogen </td><td> K210010 </td><td></td></tr><tr><td> Big Farbstoff </td><td> Applied Biosystem </td><td> 4337455 </td><td></td></tr><tr><td> DyeEx 2,0 Spin Kit </td><td> Qiagen </td><td> 63204 </td><td></td></tr></tbody></table>

sequencing of bacterial microflora in peripheral blood: our experience with hiv-infected patients

Der gesunde Magen-Darm-Trakt ist physiologisch kolonisierten durch eine Vielzahl von kommensalen Mikroben, die die Entwicklung der humoralen und zellulären mukosalen Immunsystems 1,2 beeinflussen. Microbiota vom Immunsystem über eine starke Schleimhaut-Barriere abgeschirmt. Infektionen und Antibiotika sind dafür bekannt, sowohl die normale Magen-Darm-Schranke und die Zusammensetzung der ansässigen Bakterien, die in möglichst immun Anomalien Ergebnis 3. Mai zu ändern. HIV verursacht einen Bruch in der Magen-Darm-Barriere mit progressiven Versagen der Schleimhaut-Immunität und Leckagen in die systemische Zirkulation von bakteriellen Bioprodukte, wie Lipopolysaccharid und bakterielle DNA-Fragmente, die zu systemischen Immunaktivierung 4-7 beitragen. Mikrobielle Translokation ist in HIV / AIDS-Immunpathogenese und Ansprechen auf die Therapie 4,8 gebracht. Unser Ziel war die Zusammensetzung der Bakterien translozierenden im peripheren Blut von HIV-infizierten Patienten zu charakterisieren. Um zu verfolgen unser Ziel wir eine PCR-Reaktion für die panbacteric 16S ribosomial Gen durch eine Sequenzanalyse gefolgt. Kurz gesagt, ist Vollblut sowohl HIV-infizierten und gesunden Probanden verwendet. Da die gesunden Individuen normalen intestinalen Homöostase derzeit keine Translokation der Mikroflora wird bei diesen Patienten zu erwarten. Nach Vollblutspende durch Venenpunktion und Plasma-Trennung wird die DNA aus dem Plasma extrahiert und verwendet werden, um eine breite Palette PCR-Reaktion für die panbacteric 16S ribosomial Gen 9 Führen. Nach PCR-Produkt Reinigung, Klonierung und Sequenzierung Analysen durchgeführt.

Watch this Scientific Journal Video about Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients at JoVE.com

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Unser Experiment zeigt, wie eine Sequenzierung von bakteriellen Spezies translozierenden im peripheren Blut von HIV-positiven Patienten.

Die Sequenzierung der bakteriellen Mikroflora im peripheren Blut: Unsere Erfahrung mit HIV-infizierten Patienten

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral ...

sequencing-bacterial-microflora-peripheral-blood-our-experience-with

Research

JoVE Journal

Medicine

12.2K Aufrufe.  San Paolo Hospital University of Milan, Italy. Unser Experiment zeigt, wie eine Sequenzierung von bakteriellen Spezies translozierenden im peripheren Blut von HIV-positiven Patienten.

Serie: Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Comprehensive &amp; Cost Effective Laboratory Monitoring of HIV/AIDS: an African Role Model

We present the video about assisting anti-retroviral therapy (ART) by an apt laboratory service - representing a South-African role model for economical large scale diagnostic testing. In the low-income countries inexpensive ART has transformed the prospects for the survival of HIV seropositive patients but there are doubts whether there is a need for the laboratory monitoring of ART and at what costs - in situations when the overall quality of pathology services can still be very low. The appropriate answer is to establish economically sound services with better coordination and stricter internal quality assessment than seen in western countries. This video, photographed at location in the National Health Laboratory Services (NHLS-SA) at the Witwatersrand University, Johannesburg, South Africa, provides such a coordinated scheme expanding the original 2-color CD4-CD45 PanLeucoGating strategy (PLG). Thus the six modules of the video presentation reveal the simplicity of a 4-color flow cytometric assay to combine haematological, immunological and virology-related tests in a single tube. These video modules are: (i) the set-up of instruments; (ii) sample preparations; (iii) testing absolute counts and monitoring quality for each sample by bead-count-rate; (iv) the heamatological CD45 test for white cell counts and differentials; (v) the CD4 counts, and (vi) the activation of CD8+ T cells measured by CD38 display, a viral load related parameter. The potential cost-savings are remarkable. This arrangement is a prime example for the feasibility of performing &gt; 800-1000 tests per day with a stricter quality control than that applied in western laboratories, and also with a transfer of technology to other laboratories within a NHLS-SA network. Expert advisors, laboratory managers and policy makers who carry the duty of making decisions about introducing modern medical technology are frequently not in a position to see the latest technical details as carried out in the large regional laboratories with huge burdens of workload. Hence this video shows details of these new developments.

Comprehensive & Cost Effective Laboratory Monitoring of HIV/AIDS: an African Role Model

Anti-retroviral therapy to treat HIV/AIDS is monitored in South Africa on a large scale. Flow cytometry is combined for haematology (CD45), immunology (CD4) and viral-load linked CD38 assay. Recorded at NHLS-SA laboratories, Johannesburg, these modern methods are cost-efficient with heightened local internal quality control, serving as role-models for resource-limited diagnostics.

Umfassende &amp; Kostengünstig Laboratory Überwachung von HIV / AIDS: eine afrikanische Role Model

We present the video about assisting anti-retroviral therapy (ART) by an apt laboratory service - representing a South-African role model for economical ...

Forschung

Immunologie und Infektion

Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below 50-75 copies/ml) is necessary to gain insight to viral dynamics and virus host interactions in patients who naturally control the infection and those who are on combination antiretroviral therapy (cART). 
Here we describe how to amplify viral genomes by single genome sequencing (the SGS protocol) 13, 19 and how to accurately quantify HIV-1 RNA in patients with low viral loads (the single-copy assay (SCA) protocol) 12, 20. 
The single-copy assay is a real-time PCR assay with sensitivity depending on the volume of plasma being assayed. If a single virus genome is detected in 7 ml of plasma, then the RNA copy number is reported to be 0.3 copies/ml. The assay has an internal control testing for the efficiency of RNA extraction, and controls for possible amplification from DNA or contamination. Patient samples are measured in triplicate.
The single-genome sequencing assay (SGS), now widely used and considered to be non-labor intensive 3, 7, 12, 14, 15,is a limiting dilution assay, in which endpoint diluted cDNA product is spread over a 96-well plate. According to a Poisson distribution, when less than 1/3 of the wells give product, there is an 80% chance of the PCR product being resultant of amplification from a single cDNA molecule. SGS has the advantage over cloning of not being subjected to resampling and not being biased by PCR-introduced recombination 19. However, the amplification success of SCA and SGS depend on primer design. Both assays were developed for HIV-1 subtype B, but can be adapted for other subtypes and other regions of the genome by changing primers, probes, and standards.

Quantifying levels of HIV-1 RNA in plasma and sequencing single HIV-1 genomes from individuals with viral loads below the limit of detection (50-75 copies/ml) is difficult. Here we describe how to extract and quantify plasma viral RNA using a real time PCR assay that reliably measures HIV-1 RNA down to 0.3 copies/ml and how to amplify viral genomes by single genome sequencing, from samples with very low viral loads.

Verstärkung und Quantifizierung von HIV-1 RNA in HIV-infizierten Personen mit Viruslast unter der Nachweisgrenze von Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near full-length (intact and defective), HIV-1 proviruses. FLIPS allows determination of the genetic composition of integrated HIV-1 within a cell population. Through identifying defects within HIV-1 proviral sequences that arise during reverse transcription, such as large internal deletions, deleterious stop codons/hypermutation, frameshift mutations, and mutations/deletions in cis acting elements required for virion maturation, FLIPS can identify integrated proviruses incapable of replication. The FLIPS assay can be utilized to identify HIV-1 proviruses that lack these defects and are&#160;therefore potentially replication-competent. The FLIPS protocol involves: lysis of HIV-1 infected cells, nested PCR of near full-length HIV-1 proviruses (using primers targeted to the HIV-1 5&#39; and 3&#39; LTR), DNA purification and quantification, library preparation for Next-generation Sequencing (NGS), NGS, de novo assembly of proviral contigs, and a simple process of elimination for identifying replication-competent proviruses. FLIPS provides advantages over traditional methods designed to sequence integrated HIV-1 proviruses, such as single-proviral sequencing. FLIPS amplifies and sequences near full-length proviruses enabling replication competency to be determined, and also uses fewer amplification primers, preventing the consequences of primer mismatches. FLIPS is a useful tool for understanding the genetic landscape of integrated HIV-1 proviruses, especially within the latent reservoir, however, its utilization can extend to any application in which the genetic composition of integrated HIV-1 is required.

Full-length individual proviral sequencing (FLIPS) provides an efficient and high-throughput method for the amplification and sequencing of single, near full-length (intact and defective) HIV-1 proviruses and allows for determination of their potential replication-competency. FLIPS overcomes limitations of previous assays designed to sequence the latent HIV-1 reservoir.

Verstärkung des in der Nähe von Full-Length HIV-1 Proviruses für Next Generation Sequencing

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

Genetik

Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR

In retroviruses, antisense transcription has been described in both human immunodeficiency virus type 1 (HIV-1) and human T-lymphotropic virus 1 (HTLV-1). In HIV-1, the antisense protein ASP gene is located on the negative strand of env, in the reading frame -2, spanning the junction gp120/gp41. In the sense orientation, the 3&#39; end of the ASP open reading frame overlaps with gp120 hypervariable regions V4 and V5. The study of ASP RNA has been thwarted by a phenomenon known as RT-self-priming, whereby RNA secondary structures have the ability to prime RT in absence of the specific primer, generating non-specific cDNAs. The combined use of high RNA denaturation with biotinylated reverse primers in the RT reaction, together with affinity purification of the cDNA onto streptavidin-coated magnetic beads, has allowed us to selectively amplify ASP RNA in CD4+ T cells derived from individuals infected with HIV-1. Our method is relatively low-cost, simple to perform, highly reliable, and easily reproducible. In this respect, it represents a powerful tool for the study of antisense transcription not only in HIV-1 but also in other biological systems.

Detection of Human Immunodeficiency Virus Type 1 HIV-1 Antisense Protein ASP RNA Transcripts in Patients by Strand-Specific RT-PCR

RNA hairpins and loops can function as primers for reverse transcription (RT) in absence of sequence-specific primers, interfering with the study of overlapping antisense transcripts. We have developed a technique able to identify strand-specific RNA, and we have used it to study HIV-1 antisense protein ASP.

Nachweis von Human Immunodeficiency Virus Typ 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts bei Patienten durch Strand-spezifische RT-PCR

In retroviruses, antisense transcription has been described in both human immunodeficiency virus type 1 (HIV-1) and human T-lymphotropic virus 1 (HTLV-1). ...

An In Vitro Model for Measuring Immune Responses to Malaria in the Context of HIV Co-infection

Malaria and HIV co-infection is a growing health priority. However, most research on malaria or HIV currently focuses on each infection individually. Although understanding the disease dynamics for each of these pathogens independently is vital, it is also important that the interactions between these pathogens are investigated and understood. 
We have developed a versatile in vitro model of HIV-malaria co-infection to study host immune responses to malaria in the context of HIV infection. Our model allows the study of secreted factors in cellular supernatants, cell surface and intracellular protein markers, as well as RNA expression levels. The experimental design and methods used limit variability and promote data reliability and reproducibility. 
All pathogens used in this model are natural human pathogens (Plasmodium falciparum and HIV-1), and all infected cells are naturally infected and used fresh. We use human erythrocytes parasitized with P. falciparum and maintained in continuous in vitro culture. We obtain freshly isolated peripheral blood mononuclear cells from chronically HIV-infected volunteers. Every condition used has an appropriate control (P. falciparum parasitized vs. normal erythrocytes), and every HIV-infected donor has an HIV uninfected control, from which cells are harvested on the same day. This model provides a realistic environment to study the interactions between malaria parasites and human immune cells in the context of HIV infection.

An In Vitro Model for Measuring Immune Responses to Malaria in the Context of HIV Co-infection

Human co-infection is difficult to replicate in vitro. However, human malaria parasites can readily be cultured in vitro, as can freshly isolated human peripheral blood mononuclear cells naturally infected with HIV. This provides an excellent model for studying early immune responses to malaria parasites in the context of HIV co-infection.

Ein<em&gt; In-vitro-</em&gt; Modell zur Messung der Immunantwort auf Malaria im Kontext der HIV-Koinfektion

Malaria and HIV co-infection is a growing health priority. However, most research on malaria or HIV currently focuses on each infection individually. ...

Collection, Isolation, and Flow Cytometric Analysis of Human Endocervical Samples

Despite the public health importance of mucosal pathogens (including HIV), relatively little is known about mucosal immunity, particularly at the female genital tract (FGT). Because heterosexual transmission now represents the dominant mechanism of HIV transmission, and given the continual spread of sexually transmitted infections (STIs), it is critical to understand the interplay between host and pathogen at the genital mucosa. The substantial gaps in knowledge around FGT immunity are partially due to the difficulty in successfully collecting and processing mucosal samples. In order to facilitate studies with sufficient sample size, collection techniques must be minimally invasive and efficient. To this end, a protocol for the collection of cervical cytobrush samples and subsequent isolation of cervical mononuclear cells (CMC) has been optimized. Using ex vivo flow cytometry-based immunophenotyping, it is possible to accurately and reliably quantify CMC lymphocyte/monocyte population frequencies and phenotypes. This technique can be coupled with the collection of cervical-vaginal lavage (CVL), which contains soluble immune mediators including cytokines, chemokines and anti-proteases, all of which can be used to determine the anti- or pro-inflammatory environment in the vagina.

The use of cytobrush sampling to collect lymphocytes and monocytes from the endocervix is a minimally invasive technique that provides samples for analysis of female genital tract immunity. In this protocol, we describe the collection of cytobrush samples and immune cell isolation for flow cytometry assays.

Sammlung, Isolierung, und Durchflusszytometrische Analyse der Menschen Endozervikale Proben

Despite the public health importance of mucosal pathogens (including HIV), relatively little is known about mucosal immunity, particularly at the female ...

Medizin

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

Isolierung der Exosomen aus dem Plasma von HIV-1-positiven Individuen

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Processing of Bronchoalveolar Lavage Fluid and Matched Blood for Alveolar Macrophage and CD4+ T-cell Immunophenotyping and HIV Reservoir Assessment

Bronchoscopy is a medical procedure whereby normal saline is injected into the lungs via a bronchoscope and then suction is applied, removing bronchoalveolar lavage (BAL) fluid. The BAL fluid is rich in cells and can thus provide a 'snapshot' of the pulmonary immune milieu. CD4 T cells are the best characterized HIV reservoirs, while there is strong evidence to suggest that tissue macrophages, including alveolar macrophages (AMs), also serve as viral reservoirs. However, much is still unknown about the role of AMs in the context of HIV reservoir establishment and maintenance. Therefore, developing a protocol for processing BAL fluid to obtain cells that may be used in virological and immunological assays to characterize and evaluate the cell populations and subsets within the lung is relevant for understanding the role of the lungs as HIV reservoirs. Herein, we describe such a protocol, employing standard techniques such as simple centrifugation and flow cytometry. The CD4 T cells and AMs may then be used for subsequent applications, including immunophenotyping and HIV DNA and RNA quantification.

Processing of Bronchoalveolar Lavage Fluid and Matched Blood for Alveolar Macrophage and CD4+ T-cell Immunophenotyping and HIV Reservoir Assessment

We describe a method for processing bronchoalveolar lavage fluid and matched peripheral blood from chronically HIV-infected individuals on antiretroviral therapy to assess pulmonary HIV reservoirs. These methods result in the acquisition of highly pure CD4 T cells and alveolar macrophages that may subsequently be used for immunophenotyping and HIV DNA/RNA quantifications by ultrasensitive polymerase chain reaction.

Verarbeitung von Bronchoalveolar Lavage Fluid und Matched Blood für Alveolar Macrophage und CD4+ T-Zell Immunophenotypisierung und HIV Reservoir Assessment

Bronchoscopy is a medical procedure whereby normal saline is injected into the lungs via a bronchoscope and then suction is applied, removing ...

Isolation, Transfection, and Culture of Primary Human Monocytes

Human immunodeficiency virus (HIV) remains a major health concern despite the introduction of combined antiretroviral therapy (cART) in the mid-1990s. While antiretroviral therapy efficiently lowers systemic viral load and restores normal CD4+ T cell counts, it does not reconstitute a completely functional immune system. A dysfunctional immune system in HIV-infected individuals undergoing cART may be characterized by immune activation, early aging of immune cells, or persistent inflammation. These conditions, along with comorbid factors associated with HIV infection, add complexity to the disease, which cannot be easily reproduced in cellular and animal models. To investigate the molecular events underlying immune dysfunction in these patients, a system to culture and manipulate human primary monocytes in vitro is presented here. Specifically, the protocol allows for the culture and transfection of primary CD14+ monocytes obtained from HIV-infected individuals undergoing cART as well as from HIV-negative controls. The method involves isolation, culture, and transfection of monocytes and monocyte-derived macrophages. While commercially available kits and reagents are employed, the protocol provides important tips and optimized conditions for successful adherence and transfection of monocytes with miRNA mimics and inhibitors as well as with siRNAs.

Presented here is an optimized protocol for isolating, culturing, transfecting, and differentiating human primary monocytes from HIV-infected individuals and healthy controls.

Isolation, Transfektion und Kultur der primären menschlichen Monozyten

Human immunodeficiency virus (HIV) remains a major health concern despite the introduction of combined antiretroviral therapy (cART) in the mid-1990s. ...

Purifying the Impure: Sequencing Metagenomes and Metatranscriptomes from Complex Animal-associated Samples

The accessibility of high-throughput sequencing has revolutionized many fields of biology. In order to better understand host-associated viral and microbial communities, a comprehensive workflow for DNA and RNA extraction was developed. The workflow concurrently generates viral and microbial metagenomes, as well as metatranscriptomes, from a single sample for next-generation sequencing. The coupling of these approaches provides an overview of both the taxonomical characteristics and the community encoded functions. The presented methods use Cystic Fibrosis (CF) sputum, a problematic sample type, because it is exceptionally viscous and contains high amount of mucins, free neutrophil DNA, and other unknown contaminants. The protocols described here target these problems and successfully recover viral and microbial DNA with minimal human DNA contamination. To complement the metagenomics studies, a metatranscriptomics protocol was optimized to recover both microbial and host mRNA that contains relatively few ribosomal RNA (rRNA) sequences. An overview of the data characteristics is presented to serve as a reference for assessing the success of the methods. Additional CF sputum samples were also collected to (i) evaluate the consistency of the microbiome profiles across seven consecutive days within a single patient, and (ii) compare the consistency of metagenomic approach to a 16S ribosomal RNA gene-based sequencing. The results showed that daily fluctuation of microbial profiles without antibiotic perturbation was minimal and the taxonomy profiles of the common CF-associated bacteria were highly similar between the 16S rDNA libraries and metagenomes generated from the hypotonic lysis (HL)-derived DNA. However, the differences between 16S rDNA taxonomical profiles generated from total DNA and HL-derived DNA suggest that hypotonic lysis and the washing steps benefit in not only removing the human-derived DNA, but also microbial-derived extracellular DNA that may misrepresent the actual microbial profiles.

Using the cystic fibrosis airway as an example, the manuscript presents a comprehensive workflow comprising a combination of metagenomic and metatranscriptomic approaches to characterize the microbial and viral communities in animal-associated samples.

Die Sequenzierung der bakteriellen Mikroflora im peripheren Blut: Unsere Erfahrung mit HIV-infizierten Patienten

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Umfassende & Kostengünstig Laboratory Überwachung von HIV / AIDS: eine afrikanische Role Model