We thank T. Ito, K. Hiramatsu, R. Daum, H. de Lencastre, and D. Coleman for the kind gift of some reference strains used in this study. This work was in part supported financially by the Centre for Antimicrobial Resistance (CAR), Alberta Health Services-Calgary/Calgary Laboratory Services/University of Calgary.

Queste procedure devono essere effettuate in un laboratorio certificato di livello 2 di biosicurezza. Adeguati dispositivi di protezione individuale, come guanti e camici da laboratorio deve essere utilizzato in ogni momento. 1. Preparazione del campione <ol><li> Sono tenuti fresche durante la notte culture piastra di MRSA. Il giorno prima della PCR deve essere fatto, selezionare una singola colonia di MRSA con una cultura bastoncino sterile e preparare una pesante striscia di batteri su una piastra di Tryptic Soy Agar (TSA). Campioni multipli possono essere strisciati su un singolo piatto. Incubare per una notte a 37

<ol>
	<li>IWG-SCC. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Classification+of+staphylococcal+cassette+chromosome+mec+(SCCmec):+guidelines+for+reporting+novel+SCCmec+elements.">Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements.</a> Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).</li><li>Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+for+Reporting+Novel+mecA+Gene+Homologues.">Guidelines for Reporting Novel mecA Gene Homologues.</a> Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).</li><li>Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissemination+of+new+methicillin-resistant+Staphylococcus+aureus+clones+in+the+community.">Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community.</a> Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).</li><li>Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combination+of+multiplex+PCRs+for+staphylococcal+cassette+chromosome+mec+type+assignment:+rapid+identification+system+for+mec,+ccr,+and+major+differences+in+junkyard+regions.">Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions.</a> Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).</li><li>Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+strategy+for+rapid+identification+of+structural+types+and+variants+of+the+mec+element+in+methicillin-resistant+Staphylococcus+aureus.">Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).</li><li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Update+to+the+multiplex+PCR+strategy+for+assignment+of+mec+element+types+in+Staphylococcus+aureus.">Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).</li><li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+strategy+for+subtyping+the+staphylococcal+cassette+chromosome+mec+type+IV+in+methicillin-resistant+Staphylococcus+aureus:+'SCCmec+IV+multiplex'.">Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'.</a> Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).</li><li>Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+multiplex+PCR+assay+for+characterization+and+concomitant+subtyping+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus.">Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).</li><li>Zhang, K., McClure, J. A., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+multiplex+PCR+assay+for+typing+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus.">Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Molecular and Cellular Probes. 26 (5), 218-221 (2012).</li><li>de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one-step+microbial+DNA+extraction+method+using+"Chelex+100"+suitable+for+gene+amplification.">A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification.</a> Research in Microbiology. 143 (8), 785-790 (1992).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J. Vis. Exp. (62), e3923 (2012).</li><li>McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+assay+to+facilitate+identification+of+the+recently+described+Staphylococcal+cassette+chromosome+mec+type+VIII.">Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII.</a> Molecular and Cellular Probes. 24 (4), 229-232 (2010).</li><li>Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+staphylococcal+cassette+chromosome+mec+type,+tentatively+designated+type+VIII,+harboring+class+A+mec+and+type+4+ccr+gene+complexes+in+a+Canadian+epidemic+strain+of+methicillin-resistant+Staphylococcus+aureus.">Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).</li></ol>

No conflicts of interest declared.

The multiplex PCR assay described here provides a simple, reliable method for classifying types and major subtypes of SCCmec I-V in Staphylococci, with simultaneous discrimination of MRSA from MSSA. The assay is robust, conveniently done in a single PCR reaction and results are easy to interpret. The assay does have limitations in that it targets individual loci within each SCCmec type, but does not offer comprehensive ccr and mec complex typing, and therefore cannot be considered a go...

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.
In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:
TTCTCATTGATGCTGAAGCC
To:
GAAACTAGTTATTTCCAACGG

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.

Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Staphylococcus aureus meticillino-resistente (MRSA) ha acquisito e integrato nel suo genoma di un elemento genetico mobile 21-67-kb, definito il stafilococco cassetta cromosoma mec (SCC mec) che ospita la resistenza alla meticillina (mecA) gene e altri fattori determinanti di resistenza agli antibiotici 1 . SCC mec

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent</td>
			<td>Company</td>
			<td>Catalogue Number</td>
		 </tr>
		 <tr>
			<td>Tryptic Soy Agar</td>
			<td>Fisher (BD)</td>
			<td>CA90002-700 (236920)</td>
		 </tr>
		 <tr>
			<td>Sterile distilled water</td>
			<td>Life Technologies</td>
			<td>10977-015</td>
		 </tr>
		 <tr>
			<td>Platinum Taq: including 10x PCR buffer and 50 mM MgCl2</td>
			<td>Life Technologies</td>
			<td>10966-034</td>
		 </tr>
		 <tr>
			<td>100 mM dNTP</td>
			<td>Life Technologies</td>
			<td>10297-018</td>
		 </tr>
		 <tr>
			<td>Tris base</td>
			<td>Sigma-Aldrich</td>
			<td>T6066</td>
		 </tr>
		 <tr>
			<td>Boric acid</td>
			<td>Sigma-Aldrich</td>
			<td>B7901</td>
		 </tr>
		 <tr>
			<td>EDTA</td>
			<td>Life Technologies</td>
			<td>15576-028</td>
		 </tr>
		 <tr>
			<td>Agarose</td>
			<td>Life Technologies</td>
			<td>16500-500</td>
		 </tr>
		 <tr>
			<td>Glycerol</td>
			<td>Life Technologies</td>
			<td>15514-011</td>
		 </tr>
		 <tr>
			<td>Bromophenol blue</td>
			<td>Sigma-Aldrich</td>
			<td>B8026</td>
		 </tr>
		 <tr>
			<td>1Kb+ DNA ladder</td>
			<td>Life Technologies</td>
			<td>10787-026</td>
		 </tr>
		 <tr>
			<td>Ethidium bromide</td>
			<td>Sigma-Aldrich</td>
			<td>E7637</td>
		 </tr>
		 <tr>
			<td>1.5ml Microcentrifuge tubes </td>
			<td>VWR (Axygen Scientific)</td>
			<td>10011-700 </td>
		 </tr>
		 <tr>
			<td>Culture sticks</td>
			<td>VWR</td>
			<td>CA10805-018</td>
		 </tr>
		 <tr>
			<td>PCR tubes</td>
			<td>Diamed</td>
			<td>AD0210-FCN (new #: DIATEC420-1250)</td>
		 </tr>
		 <tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5417c</td>
		 </tr>
		 <tr>
			<td>Heat block</td>
			<td>VWR</td>
			<td>13259-030 / 13259-286 </td>
		 </tr>
		 <tr>
			<td>Thermalcycler</td>
			<td>Applied Biosystems (2720)</td>
			<td>4359659 </td>
		 </tr>
		 <tr>
			<td>Horizontal, submersible gel electrophoresis chamber with gel mold</td>
			<td>BioRad</td>
			<td>170-4469</td>
		 </tr>
		 <tr>
			<td>Power supply</td>
			<td>BioRad</td>
			<td>164-5050</td>
		 </tr>
		 <tr>
			<td>Rocker shaker</td>
			<td>VWR</td>
			<td>40000-300 </td>
		 </tr>
		 <tr>
			<td>Molecular Imager Gel Doc System</td>
			<td>BioRad</td>
			<td>1708170 </td>
		 </tr>
		</tbody>
 </table>

multiplex pcr assay for typing of staphylococcal cassette chromosome mec types i to v in methicillin-resistant staphylococcus aureus

Stafilococco Cassette Cromosoma mec (SCC mec) tipizzazione molecolare

This updated M-PCR is able to determine (classify) SCCmec types I-V, as well major subtypes of SCCmec IV. The assay targets unique and specific loci of SCCmec I, II, III, IVa, IVb, IVc, IVd, IVE and V, with concomitant mecA gene detection. Tentative identification of SCCmec VI and VIII is also possible, but would require further testing to confirm. Figure 3 illustrates representative SCCmec I-VI and VIII and the locations of each target within the ele...

Watch this Scientific Journal Video about Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus at JoVE.com

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.

Multiplex PCR per la tipizzazione di stafilococco cassette cromosomiche Mec Tipi I a V, resistente alla meticillina<em&gt; Staphylococcus aureus</em

Staphylococcal Cassette Chromosome mec (SCCmec) typing  is a very important molecular tool for understanding the epidemiology and  clonal strain ...

multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec

Research

JoVE Journal

Immunology and Infection

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

11.7K Views.  Alberta Health Services / Calgary Laboratory Services / University of Calgary. We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.