Name: utilizing the antigen capsid-incorporation strategy for the development of adenovirus serotype 5-vectored vaccine approaches
Uploaded: 2015-05-06T14:00:00.000+00:00
Duration: 13 min 36 s
Description: Watch this Scientific Journal Video about Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches at JoVE.com

Questo lavoro è stato supportato in parte dal National Institutes of Health concede 5T32AI7493-20 e 5R01AI089337-03. I finanziatori avevano alcun ruolo nel disegno dello studio, la raccolta e l&#39;analisi dei dati, la decisione di pubblicare, o preparazione del manoscritto.

L&#39;Università di Alabama a Birmingham Istituzionale uso di animali e Comitato Cura ha approvato l&#39;uso di topi, come descritto qui sotto il numero di protocollo approvato 101.109.272. 1. genetica Costruzione di un plasmide modificato pAd5 / H5-HVR1-Kwas-HVR5-His 6 con la strategia Antigen Capside-Incorporation <ol><li> Costruzione del plasmide shuttle HVR1-Kwas-HVR5-I suoi 6 / pH5S <ol><li> Ordina un plasmide contenente la sequenza di DNA sintetizzato HVR1-Kwas tra i siti di enzimi di restrizione AGEI per ACCI di gene hexon5. </li><li> Digest 6 mg del frammento sintetizzato (HVR1-Kwas) con enzimi AGEI (6 unità) e ACCI (6 unità) per 3 ore a 37 ° C. Risolvere il frammento digerito in un gel di agarosio al 2% mediante elettroforesi, e purificare il frammento con un kit di estrazione DNA gel secondo il protocollo del produttore. </li><li> Sulla base del rapporto molare di inserto di vettore a 3: 1, utilizzare ligasi T4 DNA ligasi, bUffer per legare 12 ng del frammento (HVR1-Kwas) in 100 ng di plasmide shuttle precedentemente costruito HVR5-His 6 / pH5S 17 in un volume di 10 ml a temperatura ambiente per 2 ore, tramite i siti di AGEI e ACCI. </li><li> Transform 1 ml di 10 ml di prodotto legatura in 50 microlitri di cellule DH5α electrocompetent in elettroporatore (a 1800 V). Aggiungere 950 pl di mezzo SOC alle cellule trasformate DH5α e incubare la miscela per 1 ora a 37 ° C, con 300 rpm. Distribuire 100-200 microlitri della miscela di 1 ml sull&#39;agar Luria-Bertani (LB) contenente kanamicina e incubare O / N a 37 ° C. <ol><li> Per lo screening ~ 10 colonie mediante PCR rivolte frammento HVR1-Kwas, mescolare il primer in avanti (TATGTGTGTCATGTATGCGT), inversione di primer (GGAGGCCCACTTGTCCAGCTC) e una singola colonia DH5α in una soluzione master mix PCR (secondo il protocollo del produttore). Eseguire campioni su un termociclatore facendo riferimento al manuale fornito con la soluzione di PCR master mix. </li><li> Utilizzare il primer in avanti (TATGTGTGTCATGTATGCGT) per sequenziare il frammento HVR1-Kwas nei cloni proiettati nella sezione 1.1.4.1. </li></ol></li></ol></li><li> Costruzione del plasmide pAd5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Digest 6 mg di HVR1-Kwas-HVR5-Il suo 6 / pH5S con enzimi EcoRI (6 unità) e PMEI (6 unità) per 3 ore a 37 ° C, e purificare il frammento contenente armi ricombinazione omologa e il doppio gene hexon5 modificato, come indicato al punto 1.1.2. Linearizzare il plasmide dorsale pAd5 / ΔH5 (GL) 16 con Swai. </li><li> Co-transform 100 ng del frammento di destinazione dal plasmide shuttle e 100 ng del backbone linearizzato pAd5 / ΔH5 (GL) in 50 ml di cellule BJ5183 electrocompetent per la ricombinazione omologa in elettroporatore (a 1800 V). Aggiungere 950 pl di mezzo SOC alle cellule trasformate e incubare la miscela per 1 ora a 37 ° C, 300 rpm. Distribuire 100-200 microlitri della miscela di 1 mlsulla agar LB contenente kanamicina (finale 50 mg / ml) per O / N incubazione a 37 ° C. <ol><li> Raccogliere ~ 10 minuscole colonie in 3 ml di LB liquido contenente kanamicina (finale 50 mg / ml) per O / N incubazione a un agitatore (250 rpm, 37 ° C). Estrarre plasmidi della cultura. Utilizzare l&#39;analisi PCR per lo screening delle 10 colonie di mira il frammento HVR1-Kwas, come illustrato al punto 1.1.4.1. </li><li> Per schermare le stesse colonie di PCR mira il frammento pix del genoma spina dorsale, mescolare il primer in avanti (AGCTGTTGGATCTGCGCCAGCAGGTT), inversione di primer (CCAAACAGAGTCTGGTTTTTTATTTAT) e un singolo BJ5183 colonia in una soluzione master mix PCR (secondo il protocollo del produttore). Eseguire campioni su un termociclatore facendo riferimento al manuale fornito con la soluzione di master mix PCR. </li><li> Designare le colonie doppio positive PCR come pAd5 / H5-HVR1-Kwas-HVR5-His 6. </li></ol></li><li> Trasforma 100 ng del plasmide pAd5 / H5-HVR1-Kwas-HVR5-His 6 ina DH5α cellule, come illustrato al punto 1.1.4. <ol><li> Utilizzare l&#39;analisi PCR per lo screening ~ 10 colonie di mira il frammento HVR1-Kwas, come illustrato al punto 1.1.4.1. </li><li> Utilizzare l&#39;analisi PCR per schermare le stesse colonie di mira il frammento pix del genoma spina dorsale, come illustrato al punto 1.2.2.2. </li><li> Utilizzare il primer in avanti (TATGTGTGTCATGTATGCGT) per sequenziare il frammento HVR1-Kwas in pAd5 / H5-HVR1-Kwas-HVR5-His 6. </li></ol></li></ol></li></ol> 2. Preparazione di Modified Ad5 Viral Vector Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Costituiscono il mezzo completo con l&#39;aggiunta di FBS (finale il 10%), 100X non essenziali Aminoacidi (finale 0,1 mm), 200 mm L-glutammina (finale 2 mm) e la penicillina / streptomicina soluzione (finale 1%) in DMEM con alte concentrazioni di glucosio . Mantenere rene embrionale (HEK293), le cellule umane in terreno completo in un incubatore culturale (37 ° C e 5% di CO2 sotto l&#39;85% condizioni umidificati). </li><li> Salvataggio di virale vector Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Seed 3.0 x 10 6 cellule HEK293 in uno T-25 pallone contenente 5 ml di mezzo completo e coltura O / N per ottenere un monostrato con 80% di confluenza. </li><li> Linearizzare 15 mg di pAd5 / H5-HVR1-Kwas-HVR5-His 6 in un volume di 100 ml con enzima di restrizione Paci (15 unità) a 37 ° C per 3 ore. <ol><li> Estrarre linearizzato pAd5 / H5-HVR1-Kwas-HVR5-His 6 centrifugando reazione due volte (10.000 xg per 1 min) con un volume uguale di fenolo: cloroformio: alcool isoamilico (rapporto a 25: 24: 1) in una cappa aspirante , e per centrifugazione sequenziale (10.000 xg per 10 min) con una soluzione mista (300 ml di etanolo al 100% e 10 ml di acetato di sodio) e 700 ml di etanolo al 70%. Gettare il surnatante in ogni fase di centrifugazione. </li></ol></li><li> Risospendere il plasmide purificato in ~ 40 ml di acqua distillata o Tris-EDTA (TE) buffer. Quantificare il DNA plasmidico misurando la de otticansity (OD) a 260 nm. </li><li> Trasfettare 3 pg di plasmide linearizzato con commerciale reagente liposomiale trasfezione nel pallone T-25, in base al manuale del costruttore. Cambiare il medio trasfezione con terreno completo a 6 ore dopo la trasfezione e successiva incubazione nell&#39;incubatrice cultura. Mantenere cellule trasfettate sostituendo terreno completo ogni due o tre giorni, fino al singolo modello placche virali. </li><li> Quando placche sviluppano a pieno effetto citopatico (CPE), raschiare le rimanenti celle esterne matraccio in una cappa sterile, lisato cellulare raccolta mediante centrifugazione media a 300 xg per 10 min a 4 ° C. Sospendere il pellet cellulare in ~ 1 ml di terreno contenente 2% FBS, e rompere le cellule da congelamento-scongelamento quattro volte. Raccogliere il surnatante contenente virus in salvo dopo centrifugazione lisato a 10.000 xg per 10 minuti a 4 ° C. </li></ol></li><li> Propagazione su larga scala del vettore virale Ad5 / H5-HVR1-Kwas-HVR5-His 6 <ol><li> Propagazione the virus in un pallone T-75 contenenti cellule HEK293 nella cappa sterile infettando con 1/3 a pieno lisato dal pallone T-25. Lasciare pieno CPE per sviluppare entro due o tre giorni in incubatrice cultura. Raccogliere il surnatante lisato come indicato al punto 2.2.5. </li><li> Propagare il virus uno a tre T-175 palloni in cappa sterile infettando con 1/2 a pieno lisato dal pallone T-75, a seconda delle condizioni di propagazione del virus. Lasciare pieno CPE per sviluppare entro due o tre giorni in incubatrice cultura. Raccogliere il surnatante lisato come indicato al punto 2.2.5. </li><li> Propagare il virus in un dozzina o più T-175 palloni della cappa sterile infettando con 1/2 a pieno lisato dal pallone T-175 precedente (s). Determinare la quantità di utilizzo della boccetta sulla base delle condizioni di propagazione di virus e la quantità di virus nel bisogno. Raccogliere il surnatante lisato come indicato al punto 2.2.5 quando si verifica completa CPE entro due o tre giorni in incubatrice cultura. </li></ol></li><li> Purificazione di Ad5 / H5-HVR1-Kwas-HVR5-His 6 da cloruro di cesio <ol><li> Preparare due densità di soluzioni CsCl in 5 mM HEPES: 1,33 g / ml e 1,45 g / ml, evitando il contatto con CsCl. </li><li> Carico 4 ml di CsCl (1,33 g / ml) in una provetta sterile ultracentrifuga e caricare delicatamente 4 ml di CsCl (1,45 g / ml) contro fondo della provetta. Carico 4 ml di lisato surnatante lentamente sopra dei gradienti nella cappa sterile. </li><li> Centrifugare la provetta a 110.000 xg per 3 ore a 4 ° C per separare il gruppo di virus maturo / inferiore dalla fascia virus difettoso / alto. Raccogliere la banda inferiore utilizzando una siringa da 3 ml armato con un ago G 33 e diluire la fascia con 5 mM HEPES a un volume di 4 ml nella cappa sterile. </li><li> Caricare un altro tubo a due densità di soluzioni CsCl e la fascia diluita di virus come descritto al punto 2.4.2. Centrifugare la provetta a 110.000 xg O / N a 4 ° C. Raccogliere la band virale come descritto al punto 2.4.3. </li><li> Iniettare la soluzione virus raccolti in un dialysè cassette da una siringa da 3 ml armato di ago G 33 nella cappa sterile. </li><li> Posizionare la cassetta in 700 ml di tampone di dialisi 1x (1 L ricetta: 100 ml di PBS 10x, 100 ml del 100% glicerolo e 800 ml di acqua distillata, filtrare il buffer attraverso un filtro di 0,22 micron) e sostituire il tampone di dialisi ogni 3 ore per 4 volte. Aspirare fuori soluzione virus dializzato mediante siringa agugliato. </li></ol></li></ol> 3. La convalida del vettore virale Rescued <ol><li> Vettore virale titolazioni <ol><li> Per il virus titolo fisica, diluire sia virus e tampone di dialisi (controllo di sfondo) a 1: 10 e 1: 20 in tampone di lisi virus (10% SDS in Tris-EDTA) in tubetti, e incubare tutte le provette a 56 ° C per 10 min. </li><li> Accendere un BioPhotometer e impostare la modalità di assorbanza a OD 260 nm. Utilizzare il buffer di dialisi diluito (1: 10) per bilanciare il segnale di fondo cliccando il fondo &quot;vuoto&quot;. Tipo &quot;10 + 90&quot; nella scr BioPhotometereen, e leggere il segnale di virus diluito (1: 10). </li><li> Leggere il segnale di virus diluito (1: 20) seguendo il metodo in fase 3.1.2, ma invece digitare &quot;5 + 95&quot; nella schermata BioPhotometer. Moltiplicare due numeri lettura virus da 1.1x10 12 e calcolare il titolo medio con un apparecchio come VP / ml, in base ai due titoli individuali delle due diluizioni. </li><li> Per il titolo infettivo del virus (IP / ml), utilizzare il Karber TCID statistico 50 14 metodo per determinare la profondità infezione sulle cellule HEK293 a 10 giorni dopo l&#39;infezione (dpi) </li></ol></li><li> Valutazione della visualizzazione dell&#39;esposizione antigenica sul vettore virale <ol><li> Rivestire la vettore virale in una piastra ELISA e procedere con il resto dei passaggi in un metodo standard ELISA 14. Usa anti-gp41 (2F5) anticorpo umano monoclonale (mAb) e mouse anti-His mAb per la rilevazione di antigeni corrispondenti incorporati 14. </li><li> Risolvere il vettore virale in un denatuelettroforesi su gel di proteine ​​rosso (SDS-PAGE) e procedere con il resto dei passaggi in un metodo western-blot standard 14. Usa anti-gp41 (2F5) anticorpo umano monoclonale (mAb) e mouse anti-His mAb per la rilevazione di antigeni corrispondenti incorporati 14. </li></ol></li><li> Valutazione in vitro del vettore sulla capacità di bypassare sieri Ad5-positivo <ol><li> Mantenere cellule HeLa in terreno completo in incubatrice coltura (37 ° C e 5% di CO 2 in 85% condizioni umidificati). Costituiscono il mezzo completo aggiungendo FBS (finale 10%), 200 mM di L-glutammina (2 mM finale) e soluzione di penicillina / streptomicina (finale 1%) in Minimum Essential medio Eagle (MEME). </li><li> Seed cellule HeLa in piastre da 6 pozzetti a 1x10 6 cellule / pozzetto e incubare le piastre nell&#39;incubatore coltura (37 ° C e 5% CO 2 85% in condizioni umidificati) per 2 ore. Incubare sieri Ad5-positivi (0,1 ml o 0 ml) con 5 IP / cellula di vettore virale (Ad5 o Ad5 / H5-HVR1-Kwas-HVR5-His 6) in incubatrice coltura per 1 ora prima di aggiungere le miscele sulle 6-pozzetti contenenti cellule. </li><li> A 24 ore dopo l&#39;infezione (HPI), lavare le cellule una volta con PBS e le cellule Lisare in 0,5 ml di tampone di lisi. Centrifugare a 15.000 xg per 5 minuti e raccogliere il surnatante. Mescolare 20 ml di surnatante con 100 ml di substrato luciferasi per la lettura del segnale luciferasi, poiché virus contengono il gene della luciferasi. </li></ol></li></ol> 4. immunologico Valutazione del vettore virale Rescued <ol><li> Preparare due gruppi di immunizzazione: Ad5 e Ad5 / H5-HVR1-Kwas-HVR5-His 6. <ol><li> Iniettare topi (n = 8 / gruppo) per via intramuscolare con i virus a 1x10 10 VP / mouse, in un &quot;prime-boost&quot; regime di immunizzazione omologa, con un intervallo di 2 settimane. </li><li> A 2 settimane dopo ogni iniezione, sanguinare topi senza anestesia da guancia sanguinante con lancette animali (5 mm Lunghezza punta) araccogliere il sangue in provette da 1,5 ml. </li></ol></li><li> Mescolare il sangue nei tubi invertendo su e giù, e incubare il sangue a temperatura ambiente per 30 min. Spin le provette a 10.000 xg per 5 minuti a 4 ° C ed i sieri di trasferimento (strato superiore) a nuove provette da 1,5 ml. <ol><li> Spin i nuovi tubi a 10.000 xg per 5 minuti a 4 ° C e trasferimento sieri ora contrassegnati provette da 1,5 ml per la conservazione a -80 ° C. </li></ol></li><li> La valutazione di antigene-specifica immunità umorale dalla società Sera-ELISA <ol><li> Diluire suo peptide (azione a 1 mm) e HIV-1 peptide (azione a 1 mm) separatamente nel 100. </li><li> mM tampone carbonato (pH 9,5) per ottenere la concentrazione di rivestimento peptide a 10 mM. Rivestire le piastre ELISA con i peptidi diluiti separatamente con l&#39;aggiunta di 100 pl per pozzetto e incubare le piastre O / N a 4 ° C. </li><li> Lavare i piatti con PBST per quattro volte a 200 l / pozzetto e blocco per 1 ora a 5% di BSA in PBST. Applicare sieri topi per le piastre a diluizione 1: 100 nel BUF bloccofer, 100 l / pozzetto. Incubare per 2 ore di incubazione a RT. </li><li> Lavare le piastre con PBST per quattro volte. Bloccare le piastre incubando a temperatura ambiente per 30 min in tampone di bloccaggio a 100 microlitri / pozzetto. </li><li> Applicare capra anti-topo IgG-HRP (1: 5000 in tampone bloccante) a 100 ml / pozzetto per entrambe le piastre rivestite con il suo peptide e HIV-1 peptide singolarmente. Incubare per 2 ore a temperatura ambiente. Lavare i piatti con PBST. </li><li> Leggere le piastre a OD450 nm dopo incubazione con il substrato HRP per 30 min. </li></ol></li></ol>

<ol>
	<li>Cheng, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coexpression+of+the+simian+immunodeficiency+virus+Env+and+Rev+proteins+by+a+recombinant+human+adenovirus+host+range+mutant.">Coexpression of the simian immunodeficiency virus Env and Rev proteins by a recombinant human adenovirus host range mutant.</a> Journal of virology. 66, 6721-6727 (1992).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+antigen+incorporation+within+adenovirus+hexon+hypervariable+2+for+a+novel+HIV+vaccine+approach.">HIV antigen incorporation within adenovirus hexon hypervariable 2 for a novel HIV vaccine approach.</a> PloS one. 5, e11815 (2010).</li><li>DeMatteo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-lasting+adenovirus+transgene+expression+in+mice+through+neonatal+intrathymic+tolerance+induction+without+the+use+of+immunosuppression.">Long-lasting adenovirus transgene expression in mice through neonatal intrathymic tolerance induction without the use of immunosuppression.</a> Journal of virology. 71, 5330-5335 (1997).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+adenovirus-based+vector+elicits+a+specific+humoral+immune+response+against+the+V3+loop+of+HIV-1+gp120+in+mice+through+the+'Antigen+Capsid-Incorporation'+strategy.">A recombinant adenovirus-based vector elicits a specific humoral immune response against the V3 loop of HIV-1 gp120 in mice through the 'Antigen Capsid-Incorporation' strategy.</a> Virology journal. 11, 112 (2014).</li><li>Matthews, Q. L., Krendelchtchikov, A. L. G., Li, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vectors+for+Vaccine+Development.">Viral Vectors for Vaccine Development.</a> INTECH. , (2013).</li><li>Tang, D. C., Zhang, J., Toro, H., Shi, Z., Van Kampen, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+as+a+carrier+for+the+development+of+influenza+virus-free+avian+influenza+vaccines.">Adenovirus as a carrier for the development of influenza virus-free avian influenza vaccines.</a> Expert review of vaccines. 8, 469-481 (2009).</li><li>Flatt, J. W., Kim, R., Smith, J. G., Nemerow, G. R., Stewart, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+intrinsically+disordered+region+of+the+adenovirus+capsid+is+implicated+in+neutralization+by+human+alpha+defensin+5.">An intrinsically disordered region of the adenovirus capsid is implicated in neutralization by human alpha defensin 5.</a> PloS one. 8, e61571 (2013).</li><li>Bradley, R. R., Lynch, D. M., Iampietro, M. J., Borducchi, E. N., Barouch, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5+neutralizing+antibodies+target+both+hexon+and+fiber+following+vaccination+and+natural+infection.">Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection.</a> Journal of virology. 86, 625-629 (2012).</li><li>Zaiss, A. K., Machado, H. B., Herschman, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+influence+of+innate+and+pre-existing+immunity+on+adenovirus+therapy.">The influence of innate and pre-existing immunity on adenovirus therapy.</a> Journal of cellular biochemistry. 108, 778-790 (2009).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+and+CD8++T+lymphocytes+both+contribute+to+immunity+to+adenovirus+serotype+5+vaccine+vectors.">Neutralizing antibodies and CD8+ T lymphocytes both contribute to immunity to adenovirus serotype 5 vaccine vectors.</a> Journal of virology. 78, 2666-2673 (2004).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+to+adenovirus+serotype+5+vaccine+vectors+are+directed+primarily+against+the+adenovirus+hexon+protein.">Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein.</a> Journal of immunology. 174, 7179-7185 (2005).</li><li>Bradley, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5-specific+neutralizing+antibodies+target+multiple+hexon+hypervariable+regions.">Adenovirus serotype 5-specific neutralizing antibodies target multiple hexon hypervariable regions.</a> Journal of virology. 86, 1267-1272 (2012).</li><li>Gahery-Segard, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+response+to+recombinant+capsid+proteins+of+adenovirus+in+humans:+antifiber+and+anti-penton+base+antibodies+have+a+synergistic+effect+on+neutralizing+activity.">Immune response to recombinant capsid proteins of adenovirus in humans: antifiber and anti-penton base antibodies have a synergistic effect on neutralizing activity.</a> Journal of virology. 72, 2388-2397 (1998).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+multivalent+adenoviral+vectors+for+HIV+vaccination.">Using multivalent adenoviral vectors for HIV vaccination.</a> PloS one. 8, e60347 (2013).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+enterovirus+71+with+neutralizing+epitope+incorporation+within+adenovirus+type+3+hexon.">Protection against enterovirus 71 with neutralizing epitope incorporation within adenovirus type 3 hexon.</a> PloS one. 7, e41381 (2012).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+adenovirus+serotype+5+packaged+by+serotype+3+hexon.">Construction and characterization of adenovirus serotype 5 packaged by serotype 3 hexon.</a> Journal of virology. 76, 12775-12782 (2002).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+sites+in+adenovirus+hexon+for+foreign+peptide+incorporation.">Identification of sites in adenovirus hexon for foreign peptide incorporation.</a> Journal of virology. 79, 3382-3390 (2005).</li><li>Qiu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-specific+neutralizing+antibody+epitopes+of+human+adenovirus+type+3+(HAdV-3)+and+HAdV-7+reside+in+multiple+hexon+hypervariable+regions.">Serotype-specific neutralizing antibody epitopes of human adenovirus type 3 (HAdV-3) and HAdV-7 reside in multiple hexon hypervariable regions.</a> Journal of. 86, 7964-7975 (2012).</li><li>Parker, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+definition+of+the+epitope+on+the+gp41+glycoprotein+of+human+immunodeficiency+virus+type+1+for+the+neutralizing+monoclonal+antibody+2F5.">Fine definition of the epitope on the gp41 glycoprotein of human immunodeficiency virus type 1 for the neutralizing monoclonal antibody 2F5.</a> Journal of virology. 75, 10906-10911 (2001).</li><li>Farrow, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+with+Hexon+Modified+Adenoviral+Vectors+Integrated+with+gp83+Epitope+Provides+Protection+against+Trypanosoma+cruzi+Infection.">Immunization with Hexon Modified Adenoviral Vectors Integrated with gp83 Epitope Provides Protection against Trypanosoma cruzi Infection.</a> PLoS neglected tropical diseases. 8, e3089 (2014).</li><li>Krause, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitopes+expressed+in+different+adenovirus+capsid+proteins+induce+different+levels+of+epitope-specific+immunity.">Epitopes expressed in different adenovirus capsid proteins induce different levels of epitope-specific immunity.</a> Journal of virology. 80, 5523-5530 (2006).</li><li>Omori, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+a+fiber+protein+in+an+adenovirus+vector+improves+in+vitro+gene+transfer+efficiency+to+the+mouse+microglial+cell+line.">Modification of a fiber protein in an adenovirus vector improves in vitro gene transfer efficiency to the mouse microglial cell line.</a> Neuroscience letters. 324, 145-148 (2002).</li><li>Dmitriev, I. P., Kashentseva, E. A., Curiel, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+adenovirus+vectors+containing+heterologous+peptide+sequences+in+the+C+terminus+of+capsid+protein+IX.">Engineering of adenovirus vectors containing heterologous peptide sequences in the C terminus of capsid protein IX.</a> Journal of virology. 76, 6893-6899 (2002).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+a+recombinant+human+adenovirus+type+3+vector+containing+two+foreign+neutralizing+epitopes+in+hexon.">Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon.</a> Virus research. 183, 67-74 (2014).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+human+adenovirus+serotype+3+packaged+by+serotype+7+hexon.">Construction and characterization of human adenovirus serotype 3 packaged by serotype 7 hexon.</a> Virus research. 160, 214-220 (2011).</li><li>Kim, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenovirus+vector+incorporating+carbohydrate+binding+domains+utilizes+glycans+for+gene+transfer.">An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.</a> PloS one. 8, e55533 (2013).</li><li>Vasconcelos, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen-induced+proapoptotic+phenotype+and+high+CD95+(Fas)+expression+accompany+a+suboptimal+CD8++T-cell+response:+reversal+by+adenoviral+vaccine.">Pathogen-induced proapoptotic phenotype and high CD95 (Fas) expression accompany a suboptimal CD8+ T-cell response: reversal by adenoviral vaccine.</a> PLoS pathogens. 8, e1002699 (2012).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+incorporation+of+a+herpes+simplex+virus+type+1+thymidine+kinase+and+firefly+luciferase+fusion+into+the+adenovirus+protein+IX+for+functional+display+on+the+virion.">Genetic incorporation of a herpes simplex virus type 1 thymidine kinase and firefly luciferase fusion into the adenovirus protein IX for functional display on the virion.</a> Molecular imaging. 5, 510-519 (2006).</li></ol>

Gli autori non hanno nulla da rivelare.

L&#39;applicazione della strategia transgene tradizionale sulla modificazione Ad5 per lo sviluppo di vaccini è stata diminuita principalmente per il collo di bottiglia associato alla Ad5 PEI 4,6. Questo collo di bottiglia può essere parzialmente diminuito applicando il alternativa strategia capside-Incorporation (Figura 1A), poiché questa strategia può sfuggire neutralizzazione da Ad5 NAbs sostituendo neutralizzanti epitopi di Ad5 con antigeni-di interesse, e facilitare la generazione di ...

Adenovirus umano (Ad) è un virus senza involucro di medie dimensioni con un nucleocapside icosaedrica con un letto genoma DNA filamento. Ad appartiene alla famiglia Adenoviridae, con una classificazione in sette gruppi (da A a G). Ciascun gruppo contiene virus di diversi sierotipi. Di cui, adenovirus sierotipo 5 (Ad5) dal gruppo C è stato il più ampiamente studiato e il più ampiamente richiesto approcci Vectored come la terapia genica e le vaccinazioni. La strategia transgene tradizionale è stato sviluppato e applicato per modifiche Ad5, che si caratterizza per lo spostamento dei primi virus geni con un gene di interesse, e l&#39;espressione mirata del gene di interesse in un host. Esempi sono la costruzione di pENV9 / Ad5hrΔE3 sostituendo presto gene 3 (E3) con rev gene di Simian Immunodeficiency Virus 1, la costruzione di AdCMVGag sostituendo presto gene 1 (E1) con il gene gag di immunodeficienza umanaVirus (HIV) 2, e la costruzione di Ad lac Z sostituendo E1 con gene lac Z 3. L&#39;ampia applicazione della strategia transgene tradizionale Ad5 dipende dai seguenti vantaggi: l&#39;ampia gamma di ospiti per Ad5, dell&#39;ingegneria gene fattibile su virus e la propagazione del virus, la grande alloggio dell&#39;inserto gene estraneo e la sicurezza di Ad5 4,5. Tuttavia, i valori di efficacia ridotto di terapie cliniche Ad5-vettorizzate mediante l&#39;uso di questa strategia è stato un collo di bottiglia importante, che è stato mappato per essere associato principalmente Ad5 PEI, dato che Ad5 è così diffuso tra la maggior parte dei bambini e degli adulti 4,6. Per superare il principale collo di bottiglia Ad5, l&#39;obiettivo primario è quello di sviluppare una strategia alternativa aggirare Ad5 PEI. L&#39;immunità innata 7, immunità adattativa come anticorpi neutralizzanti (NABS) 8-10 e CD8 + T risposte delle cellule 10 contro Ad5 hanno dimostrato di collaborarentribute a Ad5 PEI, con Ad5 NAbs che sembra svolgere il ruolo dominante dei contributi per Ad5 PEI 10,11. Inoltre, Ad5 NAB epitopi beneficiarie situate in proteine ​​del capside, tra cui la principale hexon proteine, fibre e base Penton. Di cui, hexon è l&#39;obiettivo principale di Ad5 NAbs 8,11-13. Sulla base di questi risultati, è stato introdotto un innovativo strategia Antigen Capside-incorporazione. Questo romanzo strategia mette in evidenza la sostituzione o integrazione di proteine-di-interessi su proteine ​​del capside Ad5, che sposta o maschere epitopi Ad5 neutralizzanti, che porta alla diminuzione riconoscimento da parte NAbs ed efficienti le amministrazioni vettoriali Ad5. È interessante notare che questa strategia è competitivo, perché può anche aiutare gli host suscitano robusta immunità umorale e dell&#39;immunità cellulare potente da direttamente presentando antigeni di interessi per il sistema immunitario 4,14,15. Sulla base di questa strategia, la clonazione molecolare e ricombinante salvataggio annuncio vettore virale può essere strutturalmente divisoin quattro fasi principali: (a) la preparazione di frammento di gene di interessi da una reazione a catena della polimerasi (PCR) o sintesi; (B) la legatura del frammento di gene in un plasmide navetta che contiene il frammento di gene-di-interesse e braccia omologhe a una backbone adenovirus; (C) la ricombinazione omologa da co-trasformando il plasmide shuttle contenente il frammento di gene di interessi con la spina dorsale plasmide linearizzato pAd5 / ΔH5 (GL) 16; (D) la transfezione di linearizzato plasmide adenovirale ricombinante per salvare il vettore ricombinante annuncio integrato con gli antigeni-di-interessi. Il nostro gruppo e alcuni altri hanno esteso questa strategia incorporazione Annuncio alternativa per annuncio lo sviluppo di vaccini vectored contro diversi agenti patogeni infettivi. Abbiamo riportato la generazione di un annuncio vettore ricombinante Ad-HVR1-lgs-His 6 -v3 incorporando un His-tag HIV-1 antigene V3 nel locale HVR1 di Ad5 hexon (hexon5). Questo vettore generato innescato strong risposta immunitaria umorale specifica per il epitopo V3 4. Abbiamo anche segnalato lo sviluppo di Ad5 / HVR2-MPER-L15ΔE1 incorporando HIV-1 membrana regione ectodomain prossimale (MPER) nel locale HVR2 di hexon5 2. Inoltre, il gruppo del Dr. Zhou ha utilizzato i benefici di questa strategia Ad integrazione di sviluppare annuncio sierotipo 3 (Ad3) vaccini vettorizzate, vale a dire., La generazione di virus vettore R1SP70A3 incorporando un SP70 neutralizzante epitopo di Enterovirus 71 nella HVR1 di Ad3 hexon (hexon3). R1SP70A3 generato NAbs forti e produzione di IFN-γ specifici per la SP70 epitopo, che portano al alto tasso di protezione contro Enterovirus 71 sfida 15. Ai fini di riferimento tecnico, il nostro studio ha approfittato della strategia qualitativa Antigen Capside-incorporazione di concentrarsi sulla generazione di un bivalente Ad5 vettore Ad5 / H5-HVR1-Kwas-HVR5-His 6 incorporando un antigene HIV-1 in HVR1 unda sua tag nel HVR5 di hexon5. Il vettore virale generato è stato anche immunologicamente valutata. La strategia di Antigen Capside-Incorporation potrebbero essere utilizzati per lo sviluppo di approcci di vaccinazione Ad5-vettorizzate contro diverse malattie infettive.

<table><tbody><tr><td>1x DPBS</td><td>Thermo Scientific</td><td>SH30256.01</td><td>for cell spliting&amp;nbsp;</td></tr><tr><td>10x DPBS</td><td>Thermo Scientific</td><td>SH30378.02</td><td>for dialysis buffer preparation</td></tr><tr><td>glycerol</td><td>SIGMA</td><td>G5516-1L</td><td>for dialysis buffer preparation</td></tr><tr><td>SDS</td><td>BIO-RAD</td><td>161-0301</td><td>for virus lysis buffer preparation</td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Thermo Scientific</td><td>SH30910.03</td><td>component of culture medium</td></tr><tr><td>100x Non-Essential Amino Acids&amp;nbsp;</td><td>Thermo Scientific</td><td>SH30238.01</td><td>component of culture medium</td></tr><tr><td>200 mM L-glutamine</td><td>Cellgro</td><td>25-005-CI</td><td>component of culture medium</td></tr><tr><td>penicillin/streptomycin solution&amp;nbsp;</td><td>Cellgro</td><td>30-002-CI</td><td>component of culture medium</td></tr><tr><td>DMEM with high glucose</td><td>Thermo Scientific</td><td>SH30081.01</td><td>for HEK293 cell culture</td></tr><tr><td>Minimum Essential Medium Eagle</td><td>SIGMA</td><td>M5650</td><td>for HeLa cell culture</td></tr><tr><td>phenol:chloroform:isoamyl alcohol&amp;nbsp;</td><td>SIGMA</td><td>P3803-100ML</td><td>for large size of DNA purification</td></tr><tr><td>cesium chloride&amp;nbsp;</td><td>Research Products International Corp.</td><td>C68050</td><td>for virus purificiation</td></tr><tr><td>HEPES</td><td>Cellgro</td><td>25-060-CI</td><td>for CsCl solution preparation</td></tr><tr><td>HEK293</td><td>ATCC</td><td>51-0036</td><td>for virus rescue and upscale</td></tr><tr><td>HeLa</td><td>ATCC</td><td>CCL-2</td><td>for neutralization assay</td></tr><tr><td>T-25 flask</td><td>Thermo Scientific</td><td>156367</td><td>for cell culture&amp;nbsp;</td></tr><tr><td>T-75 flask</td><td>CORNING</td><td>430641</td><td>for cell culture&amp;nbsp;</td></tr><tr><td>T-175 flask</td><td>Thermo Scientific</td><td>159910</td><td>for cell culture&amp;nbsp;</td></tr><tr><td>Ultracentrifuge</td><td>BECKMAN</td><td>NA</td><td>for virus purification</td></tr><tr><td>Ultracentrifuge tube</td><td>BECKMAN</td><td>344059</td><td>for virus purification</td></tr><tr><td>dialysis cassette&amp;nbsp;</td><td>Thermo Scientific</td><td>66380</td><td>for virus dialysis</td></tr><tr><td>ELISA plate</td><td>Thermo Scientific</td><td>442404</td><td>for ELISA</td></tr><tr><td>human anti-gp41 (2F5) mAb</td><td>NIH AIDS Reagent Program</td><td>1475</td><td>for immunological assays</td></tr><tr><td>mouse anti-His tag mAb</td><td>GenScript</td><td>A00186</td><td>for immunological assays</td></tr><tr><td>SOC medium</td><td>CORNING</td><td>46-003-CR</td><td>for transformation</td></tr><tr><td>PCR master mix solution</td><td>QIAGEN</td><td>201445</td><td>for PCR</td></tr><tr><td>Animal lancet (point length at 5 mm)</td><td>MEDIpoint</td><td></td><td>for mice bleeding&amp;nbsp;</td></tr><tr><td>Biophotometer</td><td>Eppendorf</td><td></td><td>for virus physical titer titration</td></tr></tbody></table>

utilizing the antigen capsid-incorporation strategy for the development of adenovirus serotype 5-vectored vaccine approaches

Adenovirus sierotipo 5 (Ad5) è stato ampiamente modificato con metodi tradizionali transgene per lo sviluppo di vaccini. Le efficacies ridotte di questi vettori Ad5 tradizionalmente modificati negli studi clinici potrebbero essere correlati principalmente Ad5 immunità pre-esistente (PEI) tra la maggioranza della popolazione. Per promuovere lo sviluppo di vaccini Ad5 vettorizzate risolvendo la preoccupazione di Ad5 PEI, l&#39;innovativa strategia di Antigen Capside-Incorporation è stato impiegato. Per merito di questa strategia, Ad5 vettorizzate abbiamo costruito la navetta hexon plasmide HVR1-Kwas-HVR5-I suoi 6 / pH5S di subcloning regione ipervariabile (HVR) 1 di hexon in un plasmide shuttle precedentemente costruito HVR5-I suoi 6 / pH5S, che ha avuto il suo tag 6 incorporato nel HVR5. Questo frammento di DNA che contiene una HVR1 HIV epitopo ELDKWAS è stato sintetizzato. HVR1-Kwas-HVR5-I suoi 6 / pH5S era allora linearizzato e co-trasformato con linearizzato dorsale plasmide pAd5 / ΔH5 (GL),per ricombinazione omologa. Questo plasmide ricombinato pAd5 / H5-HVR1-Kwas-HVR5-His 6 è stato trasfettato in cellule per generare il vettore virale Ad5 / H5-HVR1-Kwas-HVR5-His 6. Questo vettore è stato validato per avere idoneità qualitativa indicato dal titolo virale fisico (VP / ml), titolo infettiva (IP / ml) e corrispondenti il ​​rapporto / IP VP. Sia l&#39;epitopo HIV e la sua etichetta 6 erano-superficie esposta sul capside Ad5, e trattenuti specifici epitopi antigenicità di loro. Un saggio di neutralizzazione indicava la capacità di questo bivalente vettore per aggirare la neutralizzazione da sieri Ad5 positivi in vitro. I topi di immunizzazione ha dimostrato la generazione di robusta immunità umorale specifica per l&#39;epitopo HIV e la sua 6. Questo studio di prova di principio suggerito che il protocollo associato alla strategia capside-Incorporation potrebbe essere fattivamente utilizzato per la generazione di vaccini Ad5-vettorizzate modificando diverse proteine ​​del capside. Questo protocollo potrebbe anche essere fn ulteriore modificato per la generazione di rare sierotipo vaccini adenovirus vettorizzate.

La strategia di Antigen Capside-Incorporation (Figura 1A) è stato utilizzato per generare il bivalente Ad5 vettore virale Ad5 / H5-HVR1-Kwas-HVR5-His 6. In primo luogo, la navetta plasmide HVR1-Kwas-HVR5-Il suo 6 / pH5S è stato costruito da subcloning HVR1-Kwas frammento nella precedente plasmide shuttle costruito HVR5-Il suo 6 / pH5S 17. In secondo luogo, il plasmide pAd5 / H5-HVR1-Kwas-HVR5-His 6 14 è stato costruito da una ricombina...

Watch this Scientific Journal Video about Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches at JoVE.com

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Qui, vi presentiamo un protocollo per generare una prova di principio di tipo bivalente adenovirus 5 (Ad5) vettore Ad5 / H5-HVR1-Kwas-HVR5-His 6 utilizzando la strategia di Antigen Capside-incorporazione. Questo vettore è stato dimostrato per esporre idoneità qualitativa, la capacità di sfuggire sieri Ad5-positivi in vitro, e l&#39;antigenicità e immunogenicità agli antigeni incorporati.

Utilizzando la strategia di Antigen Capside-Incorporation per lo sviluppo di approcci Adenovirus sierotipo 5 Vectored vaccino

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

utilizing-antigen-capsid-incorporation-strategy-for-development

Research

JoVE Journal

Immunology and Infection

10.3K Views.  University of Alabama at Birmingham.  Qui, vi presentiamo un protocollo per generare una prova di principio di tipo bivalente adenovirus 5 (Ad5) vettore Ad5 / H5-HVR1-Kwas-HVR5-His 6 utilizzando la strategia di Antigen Capside-incorporazione. Questo vettore è stato dimostrato per esporre idoneità qualitativa, la capacità di sfuggire sieri Ad5-positivi in vitro, e l'antigenicità e immunogenicità agli antigeni incorporati. 

Video: Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Engineering and Evolution of Synthetic Adeno-Associated Virus (AAV) Gene Therapy Vectors via DNA Family Shuffling

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique combination of beneficial properties1. These include the apathogenicity of the underlying wildtype viruses and the highly advanced methodologies for production of high-titer, high-purity and clinical-grade recombinant vectors2. A further particular advantage of the AAV system over other viruses is the availability of a wealth of naturally occurring serotypes which differ in essential properties yet can all be easily engineered as vectors using a common protocol1,2. Moreover, a number of groups including our own have recently devised strategies to use these natural viruses as templates for the creation of synthetic vectors which either combine the assets of multiple input serotypes, or which enhance the properties of a single isolate. The respective technologies to achieve these goals are either DNA family shuffling3, i.e. fragmentation of various AAV capsid genes followed by their re-assembly based on partial homologies (typically &gt;80% for most AAV serotypes), or peptide display4,5, i.e. insertion of usually seven amino acids into an exposed loop of the viral capsid where the peptide ideally mediates re-targeting to a desired cell type. For maximum success, both methods are applied in a high-throughput fashion whereby the protocols are up-scaled to yield libraries of around one million distinct capsid variants. Each clone is then comprised of a unique combination of numerous parental viruses (DNA shuffling approach) or contains a distinctive peptide within the same viral backbone (peptide display approach). The subsequent final step is iterative selection of such a library on target cells in order to enrich for individual capsids fulfilling most or ideally all requirements of the selection process. The latter preferably combines positive pressure, such as growth on a certain cell type of interest, with negative selection, for instance elimination of all capsids reacting with anti-AAV antibodies. This combination increases chances that synthetic capsids surviving the selection match the needs of the given application in a manner that would probably not have been found in any naturally occurring AAV isolate. Here, we focus on the DNA family shuffling method as the theoretically and experimentally more challenging of the two technologies. We describe and demonstrate all essential steps for the generation and selection of shuffled AAV libraries (Fig. 1), and then discuss the pitfalls and critical aspects of the protocols that one needs to be aware of in order to succeed with molecular AAV evolution.

Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling

We demonstrate the basic technique to molecularly engineer and evolve synthetic Adeno-associated viral (AAV) gene therapy vectors via DNA family shuffling. Moreover, we provide general guidelines and representative examples for selection and analysis of individual chimeric capsids with enhanced properties on target cells in culture or in mice.

Ingegneria ed evoluzione del sintetico virus adeno-associato (AAV) Vettori Terapia genica attraverso la famiglia Shuffling DNA

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique ...

Ricerca

Immunologia e infezioni

Production and Purification of Non Replicative Canine Adenovirus Type 2 Derived Vectors

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 1010 infectious particles per ml and can be directly administrated in vivo.

These past 15 years, canine adenovirus type 2 (CAV2)-derived vectors have proven their efficiency to transduce cells in vitro&#160;and in vivo and are widely used for vaccination and gene therapy. Here, we describe a procedure to construct, produce and purify CAV2 vectors, giving rise to high-titer viral suspensions.

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the ...

Cloning and Large-Scale Production of High-Capacity Adenoviral Vectors Based on the Human Adenovirus Type 5

High-capacity adenoviral vectors (HCAdV) devoid of all viral coding sequences represent one of the most advanced gene delivery vectors due to their high packaging capacity (up to 35 kb), low immunogenicity, and low toxicity. However, for many laboratories the use of HCAdV is hampered by the complicated procedure for vector genome construction and virus production. Here, a detailed protocol for efficient cloning and production of HCAdV based on the plasmid pAdFTC containing the HCAdV genome is described. The construction of HCAdV genomes is based on a cloning vector system utilizing homing endonucleases (I-CeuI and PI-SceI). Any gene of interest of up to 14 kb can be subcloned into the shuttle vector pHM5, which contains a multiple cloning site flanked by I-CeuI and PI-SceI. After I-CeuI and PI-SceI-mediated release of the transgene from the shuttle vector the transgene can be inserted into the HCAdV cloning vector pAdFTC. Because of the large size of the pAdFTC plasmid and the long recognition sites of the used enzymes associated with strong DNA binding, careful handling of the cloning fragments is needed. For virus production, the HCAdV genome is released by NotI digest and transfected into a HEK293 based producer cell line stably expressing Cre recombinase. To provide all adenoviral genes for adenovirus amplification, co-infection with a helper virus containing a packing signal flanked by loxP sites is required. Pre-amplification of the vector is performed in producer cells grown on surfaces and large-scale amplification of the vector is conducted in spinner flasks with producer cells grown in suspension. For virus purification, two ultracentrifugation steps based on cesium chloride gradients are performed followed by dialysis. Here tips, tricks, and shortcuts developed over the past years working with this HCAdV vector system are presented.

A protocol for generation of high-capacity adenoviral vectors lacking all viral coding sequences is presented. Cloning of transgenes contained in the vector genome is based on homing endonucleases. Virus amplification in producer cells grown as adherent cells and in suspension relies on a helper virus providing viral genes in trans.

Clonazione e produzione su larga scala di ad alta capacità vettori adenovirali in base al tipo Adenovirus umano 5

High-capacity adenoviral vectors (HCAdV) devoid of all viral coding sequences represent one of the most advanced gene delivery vectors due to their high ...

Bioingegneria

An Efficient Method for Adenovirus Production

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types and organs. However, recombinant adenoviral technology is laborious, time-consuming, and expensive. Here, we present an improved protocol using the pAdEasy system to obtain purified adenoviral particles that can induce a strong green fluorescent protein (GFP) expression in transduced cells. The advantages of this improved method are faster preparation and decreased production cost compared to the original method developed by Bert Vogelstein. The main steps of the adenoviral technology are: (1) the recombination of pAdTrack-GFP with the pAdEasy-1 plasmid in BJ5183 bacteria; (2) the packaging of the adenoviral particles; (3) the amplification of the adenovirus in AD293 cells; (4) the purification of the adenoviral particles from cell lysate and culture medium; and (5) the viral titration and functional testing of the adenovirus. The improvements to the original method consist of (i) the recombination in BJ5183-containing pAdEasy-1 by chemical transformation of bacteria; (ii) the selection of recombinant clones by &#8220;negative&#8221; and &#8220;positive&#8221; PCR; (iii) the transfection of AD293 cells using the K2 transfection system for adenoviral packaging; (iv) the precipitation with ammonium sulfate of the viral particles released by AD293 cells in cell culture medium; and (v) the purification of the virus by one-step cesium chloride discontinuous gradient ultracentrifugation. A strong expression of the gene of interest (in this case, GFP) was obtained in different types of transduced cells (such as hepatocytes, endothelial cells) from various sources (human, bovine, murine). Adenoviral-mediated gene transfer represents one of the main tools for developing modern gene therapies.

Here, we present a protocol for adenovirus production using the pAdEasy system. The technology includes the recombination of the pAdTrack and pAdEasy-1 plasmids, the adenovirus packaging and amplification, the purification of the adenoviral particles from cell lysate and culture medium, the viral titration, and the functional testing of the adenovirus.

Un metodo efficiente per la produzione di adenovirus

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types ...

Production, Purification, and Quality Control for Adeno-associated Virus-based Vectors

Gene delivery tools based on adeno-associated viruses (AAVs) are a popular choice for the delivery of transgenes to the central nervous system (CNS), including gene therapy applications. AAV vectors are non-replicating, able to infect both dividing and non-dividing cells&#160;and provide long-term transgene expression. Importantly, some serotypes, such as the newly described PHP.B, can cross the blood-brain-barrier (BBB) in animal models, following systemic delivery. AAV vectors can be efficiently produced in the laboratory. However, robust and reproducible protocols are required to obtain AAV vectors with sufficient purity levels and titer values high enough for in vivo applications. This protocol describes an efficient and reproducible strategy for AAV vector production, based on an iodixanol gradient purification strategy. The iodixanol purification method is suitable for obtaining batches of high-titer AAV vectors of high purity, when compared to other purification methods. Furthermore, the protocol is generally faster than other methods currently described. In addition, a quantitative polymerase chain reaction (qPCR)-based strategy is described for a fast and accurate determination of the vector titer, as well as a silver staining method to determine the purity of the vector batch. Finally, representative results of gene delivery to the CNS, following systemic administration of AAV-PHP.B, are presented. Such results should be possible in all labs using the protocols described in this article.

Here, we describe an efficient and reproducible strategy to produce, titer, and quality-control batches of adeno-associated virus vectors. It allows the user to obtain a vector preparation with high-titer&#160;(&#8805;1 x 1013 vector genomes/mL) and a high purity, ready for in vitro or in vivo use.

Produzione, purificazione e controllo di qualità per i vettori basati su Virus Adeno-associato

Gene delivery tools based on adeno-associated viruses (AAVs) are a popular choice for the delivery of transgenes to the central nervous system (CNS), ...

Neuroscienze

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus (AAV) Capsid Variants

Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by encouraging clinical data and the approval of several AAV gene therapies. Two major reasons for the success of AAV vectors are (i) the prior isolation of various naturally occurring viral serotypes with distinct properties, and (ii) the subsequent establishment of powerful technologies for their molecular engineering and repurposing in high throughput. Further boosting the potential of these techniques are recently implemented strategies for barcoding selected AAV capsids on the DNA and RNA level, permitting their comprehensive and parallel in vivo stratification in all major organs and cell types in a single animal. Here, we present a basic pipeline encompassing this set of complementary avenues, using AAV peptide display to represent the diverse arsenal of available capsid engineering technologies. Accordingly, we first describe the pivotal steps for the generation of an AAV peptide display library for the in vivo selection of candidates with desired properties, followed by a demonstration of how to barcode the most interesting capsid variants for secondary in vivo screening. Next, we exemplify the methodology for the creation of libraries for next-generation sequencing (NGS), including barcode amplification and adaptor ligation, before concluding with an overview of the most critical steps during NGS data analysis. As the protocols reported here are versatile and adaptable, researchers can easily harness them to enrich the optimal AAV capsid variants in their favorite disease model and for gene therapy applications.

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants

AAV peptide display library generation and subsequent validation through the barcoding of candidates with novel properties for the creation of next-generation AAVs.

Isolamento dei vettori di terapia genica di prossima generazione attraverso l'ingegneria, il codice a barre e lo screening delle varianti del capside del virus adeno-associato (AAV)

Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by ...

Detection of Neutralization-sensitive Epitopes in Antigens Displayed on Virus-Like Particle (VLP)-Based Vaccines Using a Capture Assay

The virus-like particle (VLP) capture assay is an immunoprecipitation method, commonly known as a &#39;pull-down assay&#39; used to purify and isolate antigen-displaying VLPs. Surface antigen-specific antibodies are coupled to, and thus immobilized on a solid and insoluble matrix such as beads. Due to their high affinity to the target antigen, these antibodies can capture VLPs decorated with the cognate antigen anchored in the membrane envelope of the VLPs. This protocol describes the binding of antigen-specific antibodies to protein A- or G-conjugated magnetic beads. In our study, human immunodeficiency virus (HIV)-derived VLPs formed by the group-specific antigen (Gag) viral core precursor protein p55 Gag and displaying the envelope glycoproteins (Env) of HIV are examined. The VLPs are captured utilizing broadly neutralizing antibodies (bNAbs) directed against neutralization-sensitive epitopes in Env. The VLP capture assay outlined here represents a sensitive and easy-to-perform method to demonstrate that (i) the VLPs are decorated with the respective target antigen, (ii) the surface antigen retained its structural integrity as demonstrated by the epitope-specific binding of bNAbs used in the assay and (iii) the structural integrity of the VLPs revealed by the detection of Gag proteins in a subsequent Western blot-analysis. Consequently, the utilization of bNAbs for immunoprecipitation facilitates a prediction of whether VLP vaccines will be able to elicit a neutralizing B cell response in vaccinated humans. We anticipate that this protocol will furnish other researchers with a valuable and straightforward experimental approach to examine potential VLP-based vaccines.

Detection of Neutralization-sensitive Epitopes in Antigens Displayed on Virus-Like Particle VLP-Based Vaccines Using a Capture Assay

Here, we present a protocol to detect neutralization epitopes on antigen-displaying virus-like particles (VLPs). Immunoprecipitation of the human immunodeficiency virus (HIV)-derived VLPs is performed using envelope glycoproteins-specific monoclonal antibodies coupled to protein G-conjugated magnetic beads. Captured VLPs are subsequently subjected to SDS-PAGE and Western blot-analysis employing viral core protein Gag-specific antibodies.

Rilevamento di epitopi sensibili alla neutralizzazione in antigeni visualizzati su vaccini basati su particelle simili a virus (VLP) utilizzando un test di cattura

The virus-like particle (VLP) capture assay is an immunoprecipitation method, commonly known as a &#39;pull-down assay&#39; used to purify and isolate ...

Construction of Adenoviral Vectors using DNA Assembly Technology

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an adenoviral vector by manipulating the genomic DNA of wild-type HAdV-7 by using a DNA assembly method. First, an infectious clone of HAdV-7, pKan-Ad7, was generated by fusing the viral genomic DNA with a PCR product from plasmid backbone, comprising of the kanamycin-resistant gene and the origin of replication (Kan-Ori), through DNA assembly. This was done by designing a pair of PCR primers, that contained ~25 nucleotides of the terminal sequence of HAdV-7 inverted terminal repeat (ITR) at the 5' end, a non-cutter restriction enzyme site for HAdV-7 genome in the middle, and a template-specific sequence for PCR priming at the 3' end. Second, an intermediate plasmid-based strategy was employed to replace the E3 region with transgene-expressing elements in the infectious clone to generate an adenoviral vector. Briefly, pKan-Ad7 was digested with dual-cutter restriction enzyme Hpa I, and the fragment containing the E3 region was ligated to another PCR product of plasmid backbone by Gibson assembly to construct an intermediate plasmid pKan-Ad7HpaI. For convenience, restriction-assembly was used to designate the plasmid cloning method of combined restriction digestion and assembly. Using restriction-assembly, the E3 genes in pKan-Ad7HpaI was replaced with a green fluorescent protein (GFP) expression cassette, and the modified E3 region was released from the intermediate plasmid and restored to the infectious clone to generate an adenoviral plasmid pKAd7-E3GFP. Finally, pKAd7-E3GFP was linearized by Pme I digestion and used to transfect HEK293 packaging cells to rescue recombinant HAdV-7 virus. To conclude, a DNA assembly-based strategy was introduced here for constructing adenoviral vectors in general laboratories of molecular biology without the need of specialized materials and instruments.

<meta charset="utf8"></head><body>Costruzione di vettori adenovirali utilizzando la tecnologia di assemblaggio del DNA

In this study, an infectious clone of human adenovirus type 7 (HAdV-7) was constructed, and an E3-deleted HAdV-7 vector system was established by modifying the infectious clone. This strategy used here can be generalized to make gene transfer vectors from other wild-type adenoviruses.

Costruzione di vettori adenovirali utilizzando la tecnologia di assemblaggio del DNA

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an ...

Purificazione di vettori AAV mediante cromatografia di affinità con eparina a passaggio singolo

Isolation of Adeno-Associated Viral Vectors Through a Single-Step and Semi-Automated Heparin Affinity Chromatography Protocol

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. However, the commonly used methods to purify AAVs make use of cesium chloride or iodixanol density gradient ultracentrifugation. Despite their advantages, these methods are time-consuming, have limited scalability, and often result in vectors with low purity. To overcome these constraints, researchers are turning their attention to chromatography techniques. Here, we present an optimized heparin-based affinity chromatography protocol that serves as a universal capture step for the purification of AAVs.
This method relies on the intrinsic affinity of AAV serotype 2 (AAV2) for heparan sulfate proteoglycans. Specifically, the protocol entails the co-transfection of plasmids encoding the desired AAV capsid proteins with those of AAV2, yielding mosaic AAV vectors that combine the properties of both parental serotypes. Briefly, after the lysis of producer cells, a mixture containing AAV particles is directly purified following an optimized single-step heparin affinity chromatography protocol using a standard fast protein liquid chromatography (FPLC) system. Purified AAV particles are subsequently concentrated and subjected to comprehensive characterization in terms of purity and biological activity. This protocol offers a simplified and scalable approach that can be performed without the need for ultracentrifugation and gradients, yielding clean and high viral titers.

Autore in primo piano: Metodo migliorato per la produzione e la purificazione di vettori virali adeno-associati

This manuscript describes a detailed protocol for the generation and purification of adeno-associated viral vectors using an optimized heparin-based affinity chromatography method. It presents a simple, scalable, and cost-effective approach, eliminating the need for ultracentrifugation. The resulting vectors exhibit high purity and biological activity, proving their value in preclinical studies.

Isolamento di vettori virali adeno-associati attraverso un protocollo cromatografico di affinità con eparina a passaggio singolo e semiautomatico

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. ...

Utilizzando la strategia di Antigen Capside-Incorporation per lo sviluppo di approcci Adenovirus sierotipo 5 Vectored vaccino

Riepilogo

Esplora Altri Video

PLAYLIST