Method Article
The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.
The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.
대규모 병렬 리포터 분석 실험은 (MPRA)는 DNA 서열 1 (7)을 수천 수백 수천의 전사 규제 활동의 다중 측정을 할 수 있습니다. 자신의 가장 일반적인 실시 예에서, 다중화는 오픈 리딩 프레임의 하류 서열 식별 태그가 포함되어 합성 리포터 유전자를 관심있는 각각의 시퀀스를 연결함으로써 달성된다 (ORF를,도 1). 형질 감염, RNA 분리 및 리포터 유전자 전 사체의 3 '말단의 깊이 순서화에 따라, 결합 된 서열의 상대적인 활동은 식별 태그의 상대적인 풍부로부터 추론 될 수있다.
MPRA의 그림 1 개요. MPRA 기자의 라이브러리는 합성으로 추정 조절 서열을 결합하여 구성되어 구축서열 식별 태그 뒤에 (예로서 루시페라아제 또는 GFP) "불활성"ORF로 구성 리포터 유전자. 도서관은 배양 된 세포의 인구에 대거 형질 전환하고, 전사 리포터 mRNA를 연속적으로 회수한다. 깊은 순서는 기자의 mRNA와 형질 전환 된 플라스미드 중 각 태그의 발생 수를 계산하는 데 사용됩니다. 플라스미드 카운트 대응하는 조절 서열의 활성을 추정하는 데 사용될 수있는 동안의 mRNA의 비를 계산. 멜린 니코의 허가를 적응, 등 2.
MPRA은 관심 궤적 걸쳐 신규 조절 요소에 대해 개별 유전자 조절 요소는 1) 광범위한 돌연변이 유발, 2) 주사를 포함하여, 실험 다양한 설계에 적용 할 수 있으며, 3) 추정의 세트 천연 유전 적 변이의 효과를 테스트 프로모터, 인핸서 또는 소음기, 합성 규제 요소 사) 반 합리적인 엔지니어링. 리시퀀스 변종 braries은 퇴화 올리고 1,4, 조합 결찰 8 게놈 DNA 5의 조각화 올리고 뉴클레오티드 라이브러리 프로그램 마이크로 어레이 2,3,6,7-에 합성 (OLS), 조립 등 다양한 방법을 사용하여 생성 할 수 있습니다.
이 프로토콜은 프로모터의 라이브러리의 구조를 설명 변종 OLS와 pMPRA1 및 pMPRAdonor1 벡터 (각각 Addgene ID를 49349 및 49352; http://www.addgene.org)를 사용하여, 배양 된 포유류 세포 및 후속 정량에이 라이브러리의 일시 발현을 관련 태그의 깊은 시퀀싱 (태그-SEQ)에 의해 프로모터 활동. 이 프로토콜의 이전 버전 (2013) 연구 23, 800-811 멜린 니코 등. 자연 생명 공학 30, 271-277 (2012)과 Kheradpour 등. 게놈에보고 된 연구에 사용되었다.
1 시퀀스 설계 및 합성
MPRA_SfiI_F | GCTAAGGGCCTAACTGGCCGCTTCACTG |
MPRA_SfiI_R | GTTTAAGGCCTCCGTGGCCGACGCTCTTC |
TAGseq_P1 | AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT |
TAGseq_P2 | CAAGCAGAAGACGGCATACGAGAT [인덱스] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG |
표 1 프라이머 서열. [색인] 다중화 시퀀싱에 사용될 6-8 NT 인덱스 시퀀스를 나타낸다. 다른 인덱스 적어도 8 TagSeq-P2 프라이머를 얻습니다. 모든프라이머의 HPLC 또는 PAGE로 정제해야한다.
시약 | 1X 볼륨 (μL) |
Herculase II 퓨전 DNA 중합 효소 | 0.5 |
5 배 Herculase II 반응 버퍼 | 10 |
의 dNTP (10 mM의 각) | 1.25 |
BSA (20 ㎎ / ㎖) | 1.25 |
프라이머 MPRA_SfiI_F (25 μM) | 0.25 |
프라이머 MPRA_SfiI_R (25 μM) | 0.25 |
OLS 템플릿 (1-10 attomol) | 변화 |
핵산 분해 효소가없는 물 | 50 |
올리고 뉴클레오티드 합성 라이브러리의 그림 2 준비.) 세 가지 다른 원료 올리고 뉴클레오티드 합성 라이브러리 (OLS)은 10 % TBE-우레아 폴리 아크릴 아마이드 젤을 변성에서 실행됩니다. 전체 길이 올리고 뉴클레오티드 (*)에 해당하는 밴드 시각화 라이브러리 1에서 절제과 2 도서관 3 페이지 정화 방해 오염 물질을 포함 할 수 있습니다. 이러한 경우, 아가로 오스 겔상에서 동일한 올리고 뉴클레오티드 라이브러리 런의 개방 및 에멀젼 PCR 증폭 PCR 증폭. B)로 직접 이동 제품. 복잡한 올리고 뉴클레오티드 라이브러리의 PCR 증폭 자주 키메라 제품과 상한 및 하한 밴드로 나타날 수 있습니다 다른 아티팩트를 생성합니다. 에멀젼 PCR은 이러한 아티팩트를 최소화 할 수 있습니다.
2 라이브러리 생성
3 Transfection, 동요 및 RNA 분리
4 태그-SEQ
시약 | 1X 볼륨 (μL) |
mRNA의 샘플 (400-700 NG 전체) | 8 |
올리고 0dT (50 μM) | 1 |
의 dNTP (10 mM의 각) | 1 |
시약 | 1X 볼륨 (μL) |
10 배 첨자 III RT 버퍼 | 이 |
MgCl2를 (25 밀리미터) | 4 |
DTT (0.1 M) | 이 |
RNaseOut (40 U / μL) | 1 |
첨자 III (200 U / μL) | 1 |
표 4의 cDNA 합성 반응 믹스.
시약 | 1X 볼륨 (μL) |
배 PfuUltra II HotStart PCR 마스터 믹스 | 25 |
프라이머 TagSeq_P1 (25 μM) | 0.5 |
프라이머 TagSeq_P2 (25 μM) | 0.5 |
템플릿 (mRNA를 cDNA를 혼합 또는 플라스미드 DNA) | 변화 |
핵산 분해 효소가없는 물 | 50 |
표 5 태그-SEQ PCR 반응 혼합물.
MPRA 고해상도, 전사 조절 요소의 시퀀스 - 활성 관계를 정량적으로 절개를 용이하게한다. 성공적인 MPRA 실험은 전형적으로 형질 라이브러리 (도 3a)에서 서열의 대부분 고도로 재현 가능한 측정 값을 수득한다. 나쁨 재현성 (도 3b)이 관찰되는 경우, 이는 정량 서열 중 하나) 낮은 절대 활성, 또는 2) 낮은 형질 감염 효율 하나에, 회수 된 RNA 샘플에서 리포터의 mRNA 너무 낮은 농도를 나타낸다.
도 4는 시금 생성 대표적인 "공간 정보"를 보여준다 ~ 1,2 또는 센다이 바이러스에의 노출없이 HEK293 세포에서 인간 IFNB 유전자의 상류에 145 bp의 서열의 임의의 변형 37000. 발기인 TATA 박스 알려진 근위 증강 (10)는 명확하게 정보가 풍부한 REGI으로 식별 할 수 있습니다바이러스 의존적으로 기능.
그림 3 태그-SEQ 재현성. 고 (A)과 낮은 (B) 재현성이 독립적 인 복제 형질에서 태그-SEQ 데이터의 예를 나타내는 산포도. 후자의 플롯은 반복에의 한 높은 mRNA의 수가 많은 아웃 라이어의 태그를 보여줍니다. 이러한 유물은 일반적으로 기자의 mRNA의 농도 인해 기자의 구조 중 낮은 절대 활동, 또는 낮은 형질 전환 효율에 하나, 정량적 PCR 증폭 너무 낮았다을 나타냅니다.
인간의 IFNB 전사 시작 사이트와 근위 증강의 그림 4 정보 배출량 측정. 상류 IFNB 인간 유전자의 뉴클레오티드 145 (NT) 영역의 약 37,000 랜덤 변형 (A)로 및 센다이 바이러스 (B)의 노출없이 HEK293 세포를 사용 MPRA 분석 하였다. 파란색 막대는 각 위치에서 리포터 출력 및 뉴클레오타이드 간의 상호 정보를 나타낸다. 근위 증강 및 TATA 박스는 바이러스 감염시 높은 정보 콘텐츠의 영역으로 눈에 띄는.
MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency.
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple “promoter bashing” experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test.
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements.
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).
저자는 그들이 더 경쟁 금전적 이해 관계가 없다고 선언합니다.
이 작품은 상을 수 R01HG006785에서 국립 보건원 (NIH)의 국립 인간 게놈 연구소에 의해 지원되었다.
Name | Company | Catalog Number | Comments |
Oligonucleotide library synthesis | Agilent, CustomArray, or other OLS vendors | custom | If using OLS construction method |
pMPRA1 | Addgene | 49349 | MPRA plasmid backbone |
pMPRAdonor1 | Addgene | 49352 | luc2 ORF donor plasmid |
TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0) | Generic | n/a | OLS buffer |
Novex TBE-Urea Gels, 10% | Life Technologies | EC6875BOX | PAGE purification of OLS products |
Novex TBA-Urea Sample Buffer | Life Technologies | LC6876 | PAGE purification of OLS products |
SYBR Gold Nucleic Acid Gel Stain | Life Technologies | S-11494 | PAGE purification of OLS products |
Micellula DNA Emulsion & Purification Kit | EURx/CHIMERx | 3600-01 | Library amplification by emulsion PCR |
Herculase II Fusion DNA Polymerase | Agilent | 600675 | Polymerase for emulsion PCR |
SfiI | New England Biolabs | R0123S | Library cloning with pMPRA vectors |
KpnI-HF | New England Biolabs | R3142S | Library cloning with pMPRA vectors |
XbaI | New England Biolabs | R0145S | Library cloning with pMPRA vectors |
T4 DNA Ligase (2,000,000 units/ml) | New England Biolabs | M0202T | Library cloning with pMPRA vectors |
One Shot TOP10 Electrocomp E. coli | Life Technologies | C4040-50 | Library cloning with pMPRA vectors |
LB agar and liquid media with carbenicllin | Generic | n/a | Growth media for cloning |
E-Gel EX Gels 1% | Life Technologies | G4010-01 | Library verification and purification |
E-Gel EX Gels, 2% | Life Technologies | G4010-02 | Library verification and purification |
MinElute Gel Extraction Kit | Qiagen | 28604 | Library and backbone purification |
EndoFree Plasmid Maxi Kit | Qiagen | 12362 | Library DNA isolation |
Cell culture media | n/a | n/a | Experiment-specific |
Transfection reagents | n/a | n/a | Experiment-specific |
MicroPoly(A)Purist Kit | Life Technologies | AM1919 | mRNA isolation |
TURBO DNA-free Kit | Life Technologies | AM1907 | Plasmid DNA removal |
SuperScript III First-Strand Synthesis System | Life Technologies | 18080-051 | cDNA synthesis |
PfuUltra II Hotstart PCR Master Mix | Agilent | 600850 | Polymerase for Tag-Seq PCR |
Primers (see text) | IDT | custom | PAGE purify Tag-Seq primers |
JoVE'article의 텍스트 или 그림을 다시 사용하시려면 허가 살펴보기
허가 살펴보기This article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. 판권 소유