RSM은 NSF 대학원 연구 활동에서 자금 조달을 인정합니다. MBN은 루이스 - Sigler 원정대 자금 피터 루이스의 부여 선물을 인정합니다. DB는 NIH (GM046406) 양이 생물학 (GM071508)에 대한 일반적인 의학 센터의 국립 연구소에서 자금 조달을 인정합니다. 우리는 유동 세포 계측법 실험에 대한 지원은 크리스티나 DeCoste을 인정합니다.

그림 2는 프로토콜 섹션 1-3의 회로도를 제공한다. 1. ATFs의 창조 <ol><li> PCR은 관심의 DNA 결합 도메인을 증폭하기위한 프라이머를 만듭니다. ACT1 프로모터 및 호르몬 수용체에 상 동성이 (도 3 및도 4의 설명 참조) 균주 yMN15으로 정확한 재결합을 용이하게하기 위해 PCR을 통해 부가된다. </li><li> PCR은 높은 충실도 중합 효소를 사용하여 그 DBD를 증폭. </li><li> 리튬 아세테이트 방법 (13)을 이용하여 효모로 정제 된 PCR 생성물의&gt; 1 μg 변형. </li><li> 마이크로 원심에서 15 초 동안 최고 속도로 변환, 회전 세포에 따라 변형 믹스를 제거합니다. </li><li> YPD에 멸균 물과 판의 ~ 200 μL에 재현 탁. </li><li> 다음 날, YPD에서 복제 판은 5-FOA 판에 13 (콜드 스프링 하버 효모의 사용 설명서에 설명 된 바와 같이, 5-FOA 플레이트가 만들어집니다). </li><li> 2-4 일 동안 성장을 허용AYS 및 restreak 적어도 5-10 식민지 YPD 상. 포함을 확인하기 위해 표 1과 순서에 프라이머를 사용하여 식민지 PCR을 수행합니다. </li></ol> 2. ATF 플라스미드 기자의 창조 <ol><li> (문학에서 올 가능성이 가장 높은) ATF의 결합 부위를 확인합니다. </li><li> (필요한 경우, 또는 Ultramers) 주문 올리고으로 결합 영역을 원하는. 표 2에 나타낸 바와 같이를 NotI 및 XbaI의에 대한 올바른 오버행 위쪽과 아래쪽 가닥으로 주문하십시오. </li><li> 몰 농도 (100 μM)에 올리고 희석. </li><li> T4 폴리 뉴클레오티드 키나제 및 열 순환기에 다음 어닐링을 이용하여 인산화. 반응 조건은 표 3에있다. </li><li> 다이제스트 ~ 1 ~ 37 ° C (표 4의 반응 조건)에서 1 시간 동안을 NotI-HF &amp;를 XbaI과 pMN8 ㎍의. </li><li> 젤 백본 밴드를 정화. </li><li> 10 NG / μL로 정제 된 백본을 희석. </li><li> 이중 가닥, 포스 희석μL 당 백본의 몰 농도를 5 배에 바인딩 사이트를 ated. </li><li> T4 DNA 리가 제를 사용하여, 30 분 (표 5) 실온에서 소화 백본에 결합 부위를 결찰. </li><li> 변환의 경우, 표준의 50 μL, 같은 XL1 - 블루 또는 DH5-알파와 같은 화학적으로 유능한 대장균 절반 연결 반응을 추가합니다. </li><li> 다음 열 충격 42 ° C의 물을 욕조에 45 초 동안 세포와는 2 분 동안 얼음에 배치합니다. </li><li> 변환 반응에 SOC 매체 900 μl를 추가합니다. </li><li> 롤러 드럼에 1 시간 동안 37 ° C에서 성장. </li><li> LB + AMP (100 ㎍ / ㎖)을 접시 당 100 ~ 200 ㎕의 세포를 확산하고 밤새 품어. </li><li> E.을 성장 LB + AMP의 대장균 액체 및 수확 플라스미드 DNA. 순서는 프라이머 5&#39;-GTACCTTATATTGAATTTTC-3 &#39;를 이용하여 결찰 식민지에서 새로운 리포터 플라스미드를 확인합니다. </li><li> ATF 함유 효모 STR에 새 기자 플라스미드를 변환리튬 아세테이트 변환을 사용하여 제 1 항에서 알아. </li></ol> 3. GFP 리포터를 사용하여 유전자 발현에 ATF 유도의 효과를 정량화 샘플을 준비 : <ol><li> 25 mM의 β-에스트라 디올 주식 (β-에스트라 디올의 에탄올 + 0.0681 g을 10 ㎖)를 확인합니다. 냉장 보관하십시오. </li><li> ATF는 + 5ml는 SC-URA에 밤새 긴장을 기자 함유 성장. </li><li> 확보 구 250 ㎖의 플라스크를 흔들어 각각 25 ㎖의 SC-URA를 추가합니다. </li><li> 0 NM, 0.1 nm의, 1 nm의 10 ㎚, 100 NM, 1 μM, 10 μM의 β-에스트라 디올을 추가합니다. 이 가장 쉽게 25 mM의 β-에스트라 디올 주식의 10 배 희석으로 제작하여 수행됩니다. 10 μM의 β-에스트라 디올의 최종 농도를 들어, SC-URA 25 ㎖에 25 mM의 β-에스트라 디올 주식의 10 μl를 추가합니다. </li><li> 플라스크 (1:200 희석)에 하룻밤 문화의 125 μl를 추가합니다. </li><li> 2 나머지 플라스크를 들어, 구성 적 GFP 생산 strai 접종n 및 GFP 부족한 변형. 이러한 사이토 흐름을 교정하기위한 요구된다. </li><li> 12 ~ 18 시간 동안 30 ° C에서 200 rpm으로 흔들어. 참고 : 최적의 배양 시간이 GFP 유도 더 이상 변화가 β-에스트라 디올의 추가 다음 경우 식별에 의해 결정된다. </li><li> 각 문화의 500 μl를 가지고 별도의 1.7 ML의 마이크로 원심 튜브에 스핀 다운. </li><li> 기음 SC-URA. </li><li> 1 ㎖ PBS +0.1 % 트윈 20 대기음에 한 번 씻으십시오. </li><li> PBS +0.1 % 트윈 20에 resuspend의 1 ML을 추가합니다. </li><li> 팔콘 튜브에 PBS +0.1 % 트윈 - 20의 1 ML을 추가합니다. </li><li> 5 ML 튜브 (최종 부피 = 2 ㎖)에 재현 탁 셀을 추가 (몇 일 동안 4 ° C에 저장할 수 있습니다.) </li><li> 선택 사항 : 이별에 가볍게 초음파 처리 세포 어떤 응집 세포. 유동 세포 계측법 분석 : 개요 : 10,000-100,000 세포의 형광은 일반적으로 샘플 당 분석된다. 데이터 FlowJo 또는 MATLAB에서 사용자 정의 스크립트를 사용하거나 하나를 처리 할 수​​ 있습니다R.는 GFP 양성 및 음성 컨트롤을 사용하여 GFP 채널의 전압을 조정해야합니다. FCS 파일이 반출되면, 그러한 기능 fca_readfcs (함께도 6의 것과 같은 스크립트 <a href="http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader">http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader가</a> ) 처리하는 데 사용될 수있다 데이터. </li><li> 유동 세포 계측법을 수행합니다. <ol><li> 효모 세포를 식별하는 데 사용할 앞으로 분산 형 (FSC)와 사이드 분산 형 (SSC). </li><li> ~ 3000 세포 / 초의 유량을 설정한다. </li><li> GFP (FITC 채널)를 측정한다. </li><li> 데이터가 수집되면, 수출. FCS 파일 </li></ol></li><li> MATLAB을로드합니다. </li><li> . FCS 파일, fcs_readfcs.m, 그림 6에서 동일한 폴더에 유사한 스크립트를 이동합니다. </li><li> 데이터 및 스크립트가 포함 된 폴더에 현재 작업 디렉토리를 변경합니다. </li><li> (참고 그림 6에서 스크립트를 실행합니다 :전설 수동) 그림 7에서 볼 무엇을 생산하기 위해 입력되었습니다. </li></ol> 4. 세포 성장에 ATF 유도의 효과를 정량화 <ol><li> 냉동 주식에서, 모두 밖으로 행진 (1) 별도의 YPD 판에 ATF 함유 변형 (예 : yMN15 등) (2) ATF-부족한 변형. </li><li> 성장의 2 일 후, 각 균주 YPD 액체 5 ㎖를 포함하는 별도의 문화 튜브에 접종하고 30 ℃에서 하룻밤 성장 </li><li> 10 배 100 % 에탄올에 1 만 배 (0.025 μM β-에스트라 디올)에 0.25 mM의 β-에스트라 디올 원액까지의 일련의 희석을 수행합니다. </li><li> YPD 액체 (1-250 희석) 10 ㎖에 하룻밤 문화의 40 μl를 추가합니다. </li><li> 각 균주를 들어, 96 - 웰 플레이트의 18 우물에 희석 세포의 96 μl를 추가합니다. </li><li> 세포에 β-에스트라 디올의 4 μl를 추가합니다. 중요한 점은 각 웰 총 에탄올의 동일한 금액을 가지고 있는지 확인하는 것입니다. (대안 적으로, MO<html> β-에스트라 디올의 집중 재고를 사용하고 이후 지점으로 희석 될 수있다 다시 성장에 에탄올의 효과) 측정하지 않습니다. </li><li> 세중의에서 수행합니다. 각 변형에 대한 우물의 세 에탄올 전용 컨트롤해야한다. </li><li> 가스 투과 막에있는 96 - 웰 플레이트를 커버. </li><li> 플레이트 리더의 성장 (OD 600)를 모니터링합니다. </li><li> 이러한 최대 슬로프를 찾는 같은 표준 방법을 사용하여 임의의 수의 증가율을 계량화한다. 참고 : 우리는 R 프로그래밍 환경에서 실행되는 오픈 소스 소프트웨어 패키지 grofit 14 일 좋은 성공을 했어 그것은 언급 할 가치가있다 그 96 - 웰 플레이트 분석에서 계산 성장률 (25 ㎖의 문화) - 플라스크를 흔들어 비교하면서. 필요한 것은 아닙니다 (때문에 생리학 및 계측에서 모두 차이), 우리는 (이것은 항상 그렇지 않을 수도 있지만) 상대적으로 성장 속도가 유사하다는 것을 발견했습니다 같은. </li></ol>TLE &quot;&gt; 5. 유도 성 게놈 대립 만들기 <ol><li> pMN10, (반대 방향으로) KanMX에 융합 pMN8에서 ATF 응답 프로모터 noncentromeric 플라스미드를 얻습니다. </li><li> 제한 섹션 2와 벡터 백본 젤 추출물을 소화. </li><li> 단련, 인산화 및 제 2 절에 설명 된대로 적절한 바인딩 사이트를 포함 결찰 올리고. </li><li> 순서는 확인합니다. 이 플라스미드는 이제 유도 대립 유전자를 만들기위한 DNA 템플릿이 될 것입니다. </li><li> 관심의 해당 ATF를 표현하는 효모를 얻습니다. </li><li> PCR은 표 6에서 프라이머를 사용한 KanMX 촉진제 카세트 (~ 2킬로바이트)를 증폭한다. </li><li> 리튬 아세테이트 방법을 사용 ATF-발현 균주에 PCR 생성물을 변형. </li><li> YPD + G418 다음날 위에 YPD 및 복제 접시에 접시. </li><li> 일까지 앞으로 프라이머 (5&#39;-CTGCAGCGAGGAGCCGTAAT-3 &#39;) 및 역방향 프라이머 내부를 사용하여 프로모터의 적절한 삽입 확인그 발기인 전자 유전자는 대체되었습니다. 역방향 프라이머는 일반적으로 첫번째 ATG (15)의 하류 200-300 bp의 사이가 될 수 있도록 설계된다. 최종 PCR 제품은 ~ 1.2 KB입니다. </li></ol>

<ol>
	<li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic acids res. 41, e57 (2013).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast-acting+and+nearly+gratuitous+induction+of+gene+expression+and+protein+depletion+in+Saccharomyces+cerevisiae.">Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae.</a> Mol. Biol. cell. 22, 4447-4459 (2011).</li><li>Louvion, J. F., Havaux-Copf, B., Picard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+of+GAL4-VP16+to+a+steroid-binding+domain+provides+a+tool+for+gratuitous+induction+of+galactose-responsive+genes+in+yeast.">Fusion of GAL4-VP16 to a steroid-binding domain provides a tool for gratuitous induction of galactose-responsive genes in yeast.</a> Gene. 131, 129-134 (1993).</li><li>Littlewood, T. D., Hancock, D. C., Danielian, P. S., Parker, M. G., Evan, G. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+oestrogen+receptor+ligand-binding+domain+as+an+improved+switch+for+the+regulation+of+heterologous+proteins.">A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins.</a> Nucleic acids res. 23, 1686-1690 (1995).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+Analysis+of+mRNA+Molecules+Using+Fluorescence+In+Situ+Hybridization+in+Saccharomyces+cerevisiae.">Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae.</a> J. Vis. Exp. (76), e50382 (2013).</li><li>McIsaac, R. S., Petti, A. A., Bussemaker, H. J., Botstein, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perturbation-based+analysis+and+modeling+of+combinatorial+regulation+in+the+yeast+sulfur+assimilation+pathway.">Perturbation-based analysis and modeling of combinatorial regulation in the yeast sulfur assimilation pathway.</a> Mol. Biol. cell. 23, 2993-3007 (2012).</li><li>Belli, G., Gari, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic acids res. 26, 942-947 (1998).</li><li>Baron, U., Bujard, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tet+repressor-based+system+for+regulated+gene+expression+in+eukaryotic+cells:+principles+and+advances.">Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances.</a> Meth. Enzymol. 327, 401-421 (2000).</li><li>Kodama, S., Okada, K., Akimoto, K., Inui, H., Ohkawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+aryl+hydrocarbon+receptors+for+bioassay+of+aryl+hydrocarbon+receptor+ligands+in+transgenic+tobacco+plants.">Recombinant aryl hydrocarbon receptors for bioassay of aryl hydrocarbon receptor ligands in transgenic tobacco plants.</a> Plant Biotechnol. J. 7, 119-128 (2009).</li><li>Hickman, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+regulation+of+sulfur+and+phospholipid+metabolism+reflects+the+importance+of+methylation+in+the+growth+of+yeast.">Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.</a> Mol. Biol. cell. 22, 4192-4204 (2011).</li><li>Taxis, C., Stier, G., Spadaccini, R., Knop, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+protein+depletion+by+genetically+controlled+deprotection+of+a+dormant+N-degron.">Efficient protein depletion by genetically controlled deprotection of a dormant N-degron.</a> Mol. Syst. Biol. 5, 267 (2009).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nat. methods. 6, 917-922 (2009).</li><li>Burke, D. J., Amberg, D. C., Strathern, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. , (2005).</li><li>Kahm, M., Hasenbrink, G., Lichtenberg-Frate, H., Ludwig, J., Kschischo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=grofit:+Fitting+Biological+Growth+Curves+with+R.">grofit: Fitting Biological Growth Curves with R.</a> J. Stat. Softw. 33, 1-21 (2010).</li><li>Rozen, S., Skaletsky, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer3+on+the+WWW+for+general+users+and+for+biologist+programmers.">Primer3 on the WWW for general users and for biologist programmers.</a> Methods Mol. Biol. 132, 365-386 (2000).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150, 647-658 (2012).</li><li>Chockalingam, K., Chen, Z., Katzenellenbogen, J. A., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+specific+receptor-ligand+pairs+for+use+in+the+creation+of+gene+switches.">Directed evolution of specific receptor-ligand pairs for use in the creation of gene switches.</a> Proceedings of the National Academy of Sciences of the United States of America. 102, 5691-5696 (2005).</li><li>McLachlan, M. J., Chockalingam, K., Lai, K. C., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+orthogonal+ligand+specificity+in+a+single+scaffold.">Directed evolution of orthogonal ligand specificity in a single scaffold.</a> Angewandte Chemie. 48, 7783-7786 (2009).</li><li>Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., Tyers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+pathways+that+couple+cell+growth+and+division+in+yeast.">Systematic identification of pathways that couple cell growth and division in yeast.</a> Science. 297, 395-400 (2002).</li><li>Sopko, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+pathways+and+phenotypes+by+systematic+gene+overexpression.">Mapping pathways and phenotypes by systematic gene overexpression.</a> Mol. cell. 21, 319-330 (2006).</li><li>Shimizu-Sato, S., Huq, E., Tepperman, J. M., Quail, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+light-switchable+gene+promoter+system.">A light-switchable gene promoter system.</a> Nat. biotechnol. 20, 1041-1044 (2002).</li><li>Polstein, L. R., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Light-inducible+spatiotemporal+control+of+gene+activation+by+customizable+zinc+finger+transcription+factors.">Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors.</a> J. Am. Chem. Soc. 134, 16480-16483 (2012).</li><li>Losi, A., Gartner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Old+chromophores,+new+photoactivation+paradigms,+trendy+applications:+flavins+in+blue+light-sensing+photoreceptors.">Old chromophores, new photoactivation paradigms, trendy applications: flavins in blue light-sensing photoreceptors.</a> Photochem. Photobiol. 87, 491-510 (2011).</li><li>Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond-timescale,+genetically+targeted+optical+control+of+neural+activity.">Millisecond-timescale, genetically targeted optical control of neural activity.</a> Nat. Neurosci. 8, 1263-1268 (2005).</li><li>Gradinaru, V., Mogri, M., Thompson, K. R., Henderson, J. M., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+deconstruction+of+parkinsonian+neural+circuitry.">Optical deconstruction of parkinsonian neural circuitry.</a> Science. 324, 354-359 (2009).</li><li>Milias-Argeitis, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+silico+feedback+for+in+vivo+regulation+of+a+gene+expression+circuit.">In silico feedback for in vivo regulation of a gene expression circuit.</a> Nat. biotechnol. 29, 1114-1116 (2011).</li></ol>

McIsaac, 노이스, 그리고 Botstein (다른 사람들과)는 특허 공개로이 시스템의 일부를 제출했다.

여기에 설명 된 호르몬 기반의 스위치는 생체 내에서 DNA 시퀀스를 대상으로 그 DNA 결합 도메인의 능력을 테스트에 기본 세포 생물학을 공부, 수많은 응용 프로그램이 있습니다. 이 시스템은 유도, 빠른 조치, 꽉 규제 등급 응답 등 많은 바람직한 기능이 없습니다 (즉. 측정 가능한 leakiness를, 그림 7 참조). 그러나, 개선 및 확장의 여지가 여전히있다. 합성 생물학의 최근 연구는 다중 합성 시스템을 강조하고 잘 특징으로, 프로그램 DNA 부분 (16)의 레퍼토리를 확장하고있다. 별개의 표적 유전자의 독립, 조건식 여러 유도 및 중복 특이성이 부족 DNA 결합 도메인이 모두 필요합니다. 엔지니어링 및 자연적으로 발생하는 수용체의 가용성은 새로운 인공 전사 인자를 개발되는 부품의 큰 세트를 제공합니다. 확장상호 직교 스위치의 레퍼토리는 크게 (17, 18)에 접근 감독 진화에 힘 입어있다. 우리 인공 전사 인자의 리간드 - 결합 특이성을 재 프로그래밍 전류 노력은 미래에 제시 될 것이다. 이전에는 유전자 삭제 / 과발현 형질 결과는 광범위하게 효모 (19, 20)에서 연구되고있다. 그러나, 발현 수준의 범위에서 서로 다른 표현형에 표현의 효과를 연구 간단한 것부터되지 않았습니다. 여기에 제시된 시스템의 주요 특징은 등급을 매긴 자연 (그림 8)입니다. 종종 가정 반면, 유전자 발현과 그 표현형 사이의 관계가 반드시 단조하지 않을 수 있습니다. 이러한 Z 3 EV 및 Z 4 EV 인공 전사 인자는 간단 유전자 발현의 변화에 표현형 응답을 시금의 작업을하게됩니다. 마지막으로, 프로토콜 토론이 원고의 에드 엔지니어링 및 에스트라 디올을 β에 반응 인공 전사 인자의 특성을위한 것입니다, 그러나, 중요한 다른 화학적 반응 도메인 (예 : PhyB/Pif3, LOV 및 BLUF 등) 등 응답 도메인을 사용하는 것입니다, 그의 활동은 문화의 성장 매체 21-23를 교란하지 않고 되돌릴 수 있습니다. 광 기반 시스템은 시공간 유전자 발현의 조절, 단백질 - 단백질 상호 작용, 이온 수송 및 이미 21-26 강력한 입증 효소 활성을 촉진한다. 결론적으로, 우리는 효모에서 유도, 인공 전사 인자의 신속한 건설을위한 방법을 제시 하였다. 이 프로토콜은 자신의 동족 GFP 기자와 함께 건설뿐만 아니라, 유동 세포 계측법을 사용하여 기자의 데이터를 분석하고 성장에 ATF 활성화의 효과를 시금 방법에 대한 템플릿을 제공합니다.

효모에서 유전자 스위치를 개발하는 것은 학문과 산업 모두 연구에 큰 관심입니다. 이상적인 경우, 유전자 스위치는 실험자가 원하는 경우에만 특정 유전자 (또는 유전자 세트)을 활성화하는 데 사용할 수있다. 하류 합성 프로모터의 배치 유전자의 코딩 서열을 유도 분자의 부재로 표현되지 않는다 : 유도 물질을 첨가 할 때 유전자 발현이 빠르게한다. 그것은 단지 최근 이러한 스위치는 유도제의 부재에 변형이 결실 표현형을 표시하지만 유도제의 존재하에 발현은 모든 세포에서 유도의 수준에 비례하여 활성화 효모에서 설계 될 수 있다는 것을 증명되었다 1,2. 역사적으로, 효모 조건식 시스템은 MET, PHO 및 GAL 프로모터 (활동 메티오닌, 인산의 세포 수준에 민감 등 영양소 응답 DNA 서열에 크게 의존갈락토스, 각각). 조건식이 달성 될 수 있지만, 그것은 상당한다면 발현 효과의 선정에 온다. 이러한 인간의 에스트로겐 수용체로 호르몬 수용체는 진핵 생물 3,4 효과 스위치적일 수있다. 호르몬의 부재에서, 호르몬 수용체 융합 단백질은 그것의 Hsp90 샤페론 복합체와 상호 작용하는 세포질에서 압수 될 수있다. 적절한 리간드를 결합하면, 수용체는의 Hsp90 보호자 단지에서 배출되는 원인과 핵 지방화 신호를 공개, 구조적인 변화를 겪는다. 특정 호르몬 수용체 함유 단백질의 현지화 역학을 관찰하기 위해, 우리는 Gal4dbd.ER.VP16 (GEV, Gal4p DNA 결합 도메인, 인간 에스트로겐 수용체의 리간드 결합 도메인을 포함하는 합성 전사 인자의 C-말단 융합을 생성 , 및 VP16) GFP 2. 핵 이행을 첨가 한 다음에 13 분 이내에 관찰되는 야생형 효모가 완전히 불활성, 유도, ß-에스트라 디올의 양을 포화. 이 시간까지, 세포의 대부분은 (형광 제자리 교잡을 통해 정량) GEV의 표적 유전자에 대한 명확하게 보이는 활성 전사 사이트뿐만 아니라 완전히 성숙의 mRNA 2,5있다. GEV의 표적 유전자는 핵으로 이동시키다 DNA에 결합하고, 전사를 활성화하기 위해 &lt;키메라 활성화 2.5 분을 소요 보여, 2.5 분 2,6 (마이크로 어레이를 사용하여 측정) 내에서 표현&gt; 2 배 증가. 여러 온 - 스위치, 다른 하나는, 아무도 속도를 달성 없습니다 (대장균 대장균에서 고전 독시사이클린 (doxycycline) 기반의 스위치 7,8와 애기 장대에서 인디고 기반 스위치 9 포함) 다양한 작은 분자 또는 약물을 사용 효모에 적용되었지만, 특이도, 또는 호르몬 기반의 스위치에 의해 전시 된 규제의 압박감. 그것은 t 언급 할 가치가있다모자 급속-스위치 오프 또한 효모에서 개발되었으며, 일반적으로 순서 2,10,11,12을 대상으로 단백질 분해 효소 또는 유비퀴틴 리가 아제에 유전자를 융합하여 작동합니다. 급속 셀로부터 목적 단백질을 분리하는 능력은 필수 유전자의 연구뿐만 아니라 열을 삭제할 때 유전 억제하는 경향이있는 유전자를 용이하게한다. 이 프로토콜에 설명 된 방법을 구축하고 온 스위치 효모 합성의 특성을위한 것입니다. 첫째, 우리는 신속하게 그 DNA 결합 도메인으로 구성된 유 전적으로 통합 된 융합 단백질을 생성하는 방법을 보여, 리간드는 인간 에스트로겐 수용체 결합 도메인 및 VP16 (DBD-EV의). 우리의 프로토콜에 따라, 융합 단백질 ACT1 프로모터로부터 발현된다. 우리는 그 다음 ATF의 동족 기자 플라스미드를 만들고 유동 세포 계측법을 사용하여 기능을 테스트하는 방법을 보여줍니다. 우리는이 기자의 플라스미드는 새로운 ATFs (그림 1)에 사용되는 구상이지만, 그들은 B 수전자뿐만 아니라 네이티브 전사 활성에 대한 기자로 사용된다. 마지막으로, 96 - 웰 플레이트에서 세포 증식에​​ ATF 활성화의 효과를 테스트하고 유도 게놈 대립 유전자 공학 상세가 제공된다.

<table border="0" cellpadding="0" cellspacing="0" width="352">
	<colgroup>
		<col span="4" />
	</colgroup>
	<tbody>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Name of the Reagent</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments&#160;</td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Expand High Fidelity PCR System</td>
			<td style="width:88px;">Roche</td>
			<td style="width:88px;">11 732 650 001</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">T4 DNA Ligase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0202S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Competent E. coli</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">18258-012</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Estradiol</td>
			<td style="width:88px;">Tocris Biosciences</td>
			<td style="width:88px;">2824</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Ampicillin</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">BP1760-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">T4 Polynucleotide Kinase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0201</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">PBS</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">10010-23</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">Tween-20</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">9005-64-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">clonNAT</td>
			<td style="width:88px;">Jena Bioscience</td>
			<td style="width:88px;">AB-102L</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">XbaI</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R0145S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">NotI-HF</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R3189S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">CutSmart Buffer</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">B7204S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Glucose</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">D15-500</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Bacto-Peptone</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">211677</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Yeast Extract</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">210929</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Agarose</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">214010</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">100% Ethanol</td>
			<td style="width:88px;">Decon Laboratories</td>
			<td style="width:88px;">04-355-222</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">G418</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">11811-031</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:88px;">QIAGEN</td>
			<td style="width:88px;">27104</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Lithium acetate dihydrate</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">L-6883</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Salmon sperm DNA</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">93283</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">PEG 3350</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">P-3640</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plasmids pMN8 and pMN10; yeast strain yMN15</td>
			<td style="width:88px;">Noyes or Botstein labs</td>
			<td style="width:88px;"></td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Luria Broth</td>
			<td>Sigma-Aldrich</td>
			<td>L3397</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EQUIPMENT:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Material Name</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments (optional)</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">LSRII Flow Cyometer&#160;</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">Various Models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="103">
			<td height="103" style="height:103px;width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">Software for analyzing .FCS files from flow cytometry experiments</td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">R</td>
			<td style="width:88px;">Open Source</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">For analyzing growth-rate data from plate reader.&#160;</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Falcon Tubes</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">352052</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="52">
			<td height="52" style="height:52px;width:88px;">1.7 ml Eppendorf&#160; Tubes</td>
			<td style="width:88px;">GeneMate</td>
			<td style="width:88px;">C3262-1</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">250 ml Shake Flasks</td>
			<td style="width:88px;">Corning</td>
			<td style="width:88px;">4446-250</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">96-well, flat-bottom plates</td>
			<td style="width:88px;">Costar</td>
			<td style="width:88px;">3635</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plate Reader (Synergy H1 Multi-Mode Plate Reader)</td>
			<td style="width:88px;">BioTek</td>
			<td style="width:88px;">H1MG</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Breathe-Easy Membranes</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">Z380059-1PAK</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Thermocycler</td>
			<td style="width:88px;">various companies</td>
			<td style="width:88px;">Various models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">SC-Ura powder</td>
			<td style="width:88px;">MP Biomedicals</td>
			<td style="width:88px;">114410622</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">5-FOA</td>
			<td style="width:88px;">Zymo Research</td>
			<td style="width:88px;">F9001-1</td>
			<td style="width:88px;"></td>
		</tr>
	</tbody>
</table>

rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters

합성 생물학 이성적으로 디자인 및 소망 정량적 특성과 합성 회로를 구축 할뿐만 아니라, 기본 제어 회로의 구조를 심문하는 툴을 제공하는 것을 목적으로한다. 두 경우 모두, 제공된 표적 이탈 효과, 신속하고 가변 방식으로 유전자 발현을 프로그래밍하는 능력은 유용 할 수있다. 우리는 사람의 에스트로겐 수용체와 VP16의 리간드 결합 도메인 뒤에 URA3 카세트의 ACT1 프로모터 상류를 포함하는 효모 균주를 구축했다. URA3의 존재에 대한 DNA 결합 도메인 및 선택을 포함하는 선형 PCR 생성물로 균주를 변형시켜, 구성 적으로 발현 인공 전사 인자 (ATF)는 상동 재조합에 의해 생성 될 수있다. 이러한 방식으로 설계된 ATFs함으로써 오프 - 타겟 활성화와 일반적으로 사용되는 컨디셔닝 발견 nonphysiological 성장 조건을 모두 제거 유도제의 존재 하에서 고유 표적 유전자를 활성화 할ONAL 유전자 발현 시스템. 그 기본 또는 인공 전사 인자에 특이 적으로 반응 GFP 기자 플라스미드의 신속한 건설을위한 간단한 방법도 제공됩니다.

<html> 그림 5는 시간이 지남에 Z 3 EV, Z 4 EV, 또는 GEV로 GFP의 유도를 보여줍니다. 결합 도메인 nonyeast DNA를 함유 ATFs에 응답 GFP 생산의 증가를 참고. 우리는 최근이 효모 게놈 1에 단일 유전자의 특이성을 달성 이러한 요인의 결과 추측. Z 3 EV 및 Z 4 EV는 다운 스트림 적절한 결합 부위 (5&#39;-GCGTGGGCG-3 &#39;와 5&#39;-포함하는 합성 프로모터의 위치 표적 유전자의 발현을 활성화하는 반면 혼자 GEV 유도는, 수백 개의 유전자의 활성화 / 억압에 이르게 GCGGCGGAGGAG-3 &#39;, 각각) 1. 그림 7은 시스템 (탐지 가능한 GFP 없음 유도 결과)의 모든 셀이 범위에 걸쳐 GFP를 유도하는 Z 3 EV의 능력을 유도에 대한 응답으로 유도 얻을 꽉 규제를 보여줍니다 β-에스트라 디올 농도는 그림 8에 나와 있습니다. <html> 천만에 &quot;FO : 유지 - together.within 페이지를 =&quot;항상 &quot;&gt; <img alt="그림 1" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig1highres.jpg" src="/files/ftp_upload/51153/51153fig1.jpg" /> 그림 1. β-에스트라 디올은 ATF에 바인딩 할 때 인공 전사 인자는 β-에스트라 디올.의 부재에서의 Hsp90와 상호 작용의 Hsp90은 ATF가 핵을 입력하고 플라스미드 기자의 표현을 활성화 할 수 있도록, 해리. <img alt="그림 2" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig2highres.jpg" src="/files/ftp_upload/51153/51153fig2.jpg" /> 그림 2. 인공 전사 인자 및 건물 / 동족 GFP 기자를 테스트를 포함하는 엔지니어링 계통에 대한 프로토콜의 개략도. load/51153/51153fig3highres.jpg &quot;SRC =&quot;/ files/ftp_upload/51153/51153fig3.jpg &quot;/&gt; 그림 3. LEU2 궤적의 변형 yMN15의 ACT1pr-URA3-EV 순서. <img alt="그림 4" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig4highres.jpg" src="/files/ftp_upload/51153/51153fig4.jpg" /> 성공적으로 yMN15로 변환 할 때 새로운 융합 단백질을 생성하기 위해 추가로 상 동성에 관심이 DNA 결합 도메인을 증폭하기위한 PCR 프라이머의 그림 4. 디자인. <img alt="그림 5" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig5highres.jpg" src="/files/ftp_upload/51153/51153fig5.jpg" /> 그림 5. GFP 유도 1 μM의 β-에스트라 디올에 대한 응답으로 세 가지 다른 ATF-프로모터 쌍으로. &lt;/ P&gt; <img alt="그림 6" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig6highres.jpg" src="/files/ftp_upload/51153/51153fig6.jpg" /> 그림 6. 세포 계측법 데이터 처리 흐름에 대한 MATLAB 스크립트. 이 스크립트에서 적응했다 <a href="http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data">http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data</a> . <img alt="그림 7" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig7highres.jpg" src="/files/ftp_upload/51153/51153fig7.jpg" /> 0 μ M의 β-에스트라 디올과 유도의 18 시간 다음 1 μM의 β-에스트라 디올에 대한 응답으로 Z 3 EV로 GFP의 그림 7. 유도. 형광도 내 잘못이었다Z 3 EV 시스템의 타이트한 규정을 설명하기 위해 GFP 부족한 세포에서 시작될 때까지 누출. 이 그림은 그림 6의 코드를 사용하여 생성되었습니다. <img alt="그림 8" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig8highres.jpg" src="/files/ftp_upload/51153/51153fig8.jpg" /> 그림 8. 유도 물질의 농도와 표현의 출력 사이의 관계는 ~ 1 힐 계수 등급을 매긴다. (A) β-에스트라 디올 농도의 함수로 GFP 표현의 분포. (B) (A)에서의 분포의 평균 형광. 데이터는 D는 β-에스트라 디올 복용량 = G의 분 + (G MAX-G의 분) D N / (K N + D의 N), G 최소 및 G 최대가 최소되는 함수 G (D)에 적합했고, GFP 최대 값, RES에 각기, N 힐 계수, K는 ½ (G 최대 + G의 분)을 산출 β-에스트라 디올 용량입니다. <table border="0" cellpadding="0" cellspacing="0" fo:keep-together.within-page="always" width="176"><tbody><tr><td> 올리고 뉴클레오티드 시퀀스 </td><td> 이름 </td></tr><tr><td> 5&#39;-TTGAAACCA AACTCGCCTCT-3 &#39; </td><td> DBD는 앞으로 확인 </td></tr><tr><td> 5&#39;-tccagagac ttcagggtgct-3 &#39; </td><td> DBD 검사 역 </td></tr></tbody></table> 테이블 1. 에스트로겐 수용체에 관심 DBD의 올바른 융합을 확인하는 프라이머. 앞으로 프라이머는 동종 ACT1 프로모터 및 역방향 프라이머는 에스트로겐 수용체에 상동입니다. 전형적인 DBD에 (~ 300 염기쌍)의 경우, PCR 생성물은 &lt;1.5 킬로바이트이다. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> 올리고 뉴클레오티드 시퀀스 </td><td> 이름 </td></tr><tr><td> 5&#39;-ggccgc ... DBD를 마시고 떠들 사이트 ... T-3 &#39; </td><td> 맨 위로 올리고 </td></tr><tr><td> 5&#39;-ctaga ... DNA 결합 부위 역 ... GC-3 &#39; </td><td> 바닥 올리고 </td></tr><tr><td> 5&#39;-GCC gcGTGGGCG T GCGTGGGCG G G CGTGGGCG T GCGTGGGCG G GCGTG GGCG T GCGTGGGCG T-3 &#39; </td><td> 맨 위로 올리고 + 6 배 Zif268 바인딩 사이트 </td></tr><tr><td> 5&#39;-ctagaCGCCCACGCACGCCCACGCC CGCCCACGCACGCCCACGCCCGCC CACGCACGCCCACgc-3 &#39; </td><td> 바닥 올리고 + 6 배 Zif268 바인딩 사이트 </td></tr></tbody></table> 그 결합 부위를 포함하는 dsDNA를 만들기위한 프라이머의 표 2. S의 tructure. Z 3 EV 응답 프로모터를 만들려면, 올리고 뉴클레오티드 최고 올리고 + 6 배 Zif268 결합 부위와 바닥 올리고는 + 6 배 Zif268 바인딩을 사용 하였다.올바른 DNA의 오버행을 만드는 순서는 소문자로되어 있습니다. Zif268 컨센서스 결합 부위, GCGTGGGCG는 상단 올리고에 밑줄이 그어져 있습니다. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> 시약 </td><td> 양 </td></tr><tr><td> T4 폴리 뉴클레오티드 키나제 버퍼 </td><td> 5 μL </td></tr><tr><td> T4 폴리 뉴클레오티드 키나제 (10,000 단위 / ㎖ @) </td><td> 1 μL </td></tr><tr><td> 맨 위로 올리고 (100 μM) </td><td> 1.5 ㎕의 </td></tr><tr><td> 바닥 올리고 (100 μM) </td><td> 1.5 ㎕의 </td></tr><tr><td> 물 </td><td> 41 μL </td></tr></tbody></table> 표 3. 인산화 및 상기 반응의 50 μl를 사용하여 열 순환기의 어닐링 프라이머. 두 열 순환기 단계가 있습니다. 1 단계 : 37 ° C에서 30 분 (인산화), 2 단계 : 95 ° C 30 초 (어닐링), 4​​ ° C에서까지 1 ° C의 실망 매 30 초 단계. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> 시약 </td><td> 양 </td></tr><tr><td> 를 XbaI </td><td> 1 μL </td></tr><tr><td> 를 NotI-HF </td><td> 1 μL </td></tr><tr><td> 플라스미드 DNA </td><td> 5 μL (1 ~ 2 μg) </td></tr><tr><td> 배 컷 스마트 버퍼 </td><td> 5 μL </td></tr><tr><td> 물 </td><td> 38 μL </td></tr></tbody></table> 표 4. 를 XbaI과 NotI을 가진 플라스미드 pMN8의 제한 다이제스트. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr height="22" style="height:16.5pt"><td class="xl65" height="22" style="height:16.5pt;width:66pt" width="88"> 시약 </td><td class="xl66" style="width:66pt" width="88"> 양 </td></tr><tr height="43" style="height:32.25pt"><td> T4 리가 버피FER </td><td> 2 μL </td></tr><tr height="22" style="height:16.5pt"><td> T4 리가 </td><td> 0.2 ㎕의 </td></tr><tr height="43" style="height:32.25pt"><td> 10 NG / μL @ 백본 </td><td> 1 μL </td></tr><tr height="106" style="height:79.5pt"><td> 배 몰 농도 / μL @ 바인딩 시퀀스 </td><td> 1 μL </td></tr><tr height="22" style="height:16.5pt"><td> 물 </td><td> 15.8 μL </td></tr></tbody></table> 표 5. 플라스미드 DNA에 결합 부위를 결찰. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> 뇌관 </td><td> 기술 </td></tr><tr><td> ~ 40 bp의 상류 ATG + CGCACTTAACTTCGCATCTG-3 &#39; </td><td> KanMX 발기인를 증폭 앞으로 프라이머 </td></tr><tr><td> 5&#39;-역 보체 (ATG + ~ 37bp) + TATAGTTTTTTCTCCTTGACG-3 &#39; </td><td> PRI에게 반전KanMX 발기인를 증폭 마 </td></tr><tr><td> 5&#39;-caatttgtctgctcaagaaaataaa ttaaatacaaataaaCGCAC TTAACTTCGCATCTG-3 &#39; </td><td> GCN4 프로모터 스왑을 만들기위한 앞으로 프라이머. </td></tr><tr><td> 5&#39;-tggatttaaagcaaataaacttgg ctgatattcggacatTATAGTT TTTTCTCCTTGACG-3 &#39; </td><td> GCN4 프로모터 스왑을 만들기위한 역방향 프라이머. </td></tr></tbody></table> 표 6. PCR은 titratible 대립 유전자를 만들기위한 KanMX 발기인을 증폭.

Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

이 프로토콜은 동족 GFP 기자 및 유동 세포 계측법을 통해 GFP 발현을 자극하는 ATFs 능력의 정량화 인공 전사 인자 (ATFs)의 신속한 건설을위한 실험 절차를 설명합니다.

빠른 합성 및 GFP 기반 기자들과 화학적으로 활성화 된 전사 인자의 상영

Synthetic biology aims to rationally design and build synthetic circuits with desired quantitative properties, as well as provide tools to interrogate the ...

rapid-synthesis-screening-chemically-activated-transcription-factors

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 1

Transcription: DNA to RNA

SCIENTISTS IN ACTION

14.4K 조회수.  Princeton University.  이 프로토콜은 동족 GFP 기자 및 유동 세포 계측법을 통해 GFP 발현을 자극하는 ATFs 능력의 정량화 인공 전사 인자 (ATFs)의 신속한 건설을위한 실험 절차를 설명합니다. 

비디오: Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Generation of Human CD40-activated B cells

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer immunotherapy 1-3. Compared to Dendritic cells (DCs), the best characterized APC, CD40-B cells have several distinct biological and technical properties. Similar to DCs, B cells show an increased expression of MHC and co-stimulatory molecules (Fig.1b), exhibit a strong migratory capacity and present antigen presentation efficiently to T cells, after stimulation with interleukin-4 and CD40 ligand (CD40L). However, in contrast to immature or mature DCs, CD40-B cells express the full lymph node homing triad consisting of CD62L, CCR7/CXCR4, and leukocyte function antigen-1 (LFA1, CD11a/CD18), necessary for homing to secondary lymphoid organs (Fig.1a) 3. CD40-B cells can be generated without difficulties from very small amounts of peripheral blood which can be further expanded in vitro to very large amounts of highly-pure CD40-B cells (&gt;109 cells per patient) from healthy donors as well as cancer patients (Fig.1c,d) 1,4. 
In this protocol we demonstrate how to obtain fully activated CD40-B cells from human PBMC. Key molecules for the cell culture are CD40 ligand, interleukin-4 (IL-4) and cyclosporin A (CsA), which are replenished in a 3-4 day culture cycle. For laboratory purposes CD40-stimulation is provided by NIH/3T3 cells expressing recombinant human CD40 ligand (tCD40L NIH/3T3) 5. To avoid contamination with non-transfected cells, expression of the human CD40 ligand on the transfectants has to be checked regularly (Fig.2). 
After 14 days CD40-B cell cultures consist of more than 95% pure B cells and an expansion of CD40-B cells over 65 days is frequently possible without any loss of function 1, 4. CD40-B cells efficiently take up, process and present antigens to T cells 6. They do not only prime na&#970;ve, but also expand memory T cells 7,8. CD40-activated B cells can be used to study B-cell activation, differentiation and function. Moreover, they represent a promising tool for therapeutic or preventive vaccination against tumors 9.

In this video we present the ex vivo generation and expansion of human CD40-activated B cells (CD40-B) from peripheral blood mononuclear cells (PBMC) by stimulation with CD40 ligand and interleukin-4.

인간 CD40 - 활성화된 B 세포의 생성

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer ...

연구

생물학

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

식물 Protoplasts의 형광 활성 세포 정렬

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes. However, many compounds identified in screens using cell culture models are often found to be toxic or pharmacologically inactive in vivo1-2. Screening in whole animal models can help avoid these pitfalls and streamline the path to drug development.
C. elegans is a multicellular model organism well suited for HTS. It is small (&lt;1 mm) and can be economically cultured and dispensed in liquids. C. elegans is also one of the most experimentally tractable animal models permitting rapid and detailed identification of drug mode-of-action3.
We describe a protocol for culturing and dispensing fluorescent strains of C. elegans for high-throughput screening of chemical libraries or detection of environmental contaminants that alter the expression of a specific gene. Large numbers of developmentally synchronized worms are grown in liquid culture, harvested, washed, and suspended at a defined density. Worms are then added to black, flat-bottomed 384-well plates using a peristaltic liquid dispenser. Small molecules from a chemical library or test samples (e.g., water, food, or soil) can be added to wells with worms. In vivo, real-time fluorescence intensity is measured with a fluorescence microplate reader. This method can be adapted to any inducible gene in C. elegans for which a suitable reporter is available. Many inducible stress and developmental transcriptional pathways are well defined in C. elegans and GFP transgenic reporter strains already exist for many of them4. When combined with the appropriate transgenic reporters, our method can be used to screen for pathway modulators or to develop robust biosensor assays for environmental contaminants. 
We demonstrate our C. elegans culture and dispensing protocol with an HTS assay we developed to monitor the C. elegans cap &#x2018;n&#x2019; collar transcription factor SKN-1. SKN-1 and its mammalian homologue Nrf2 activate cytoprotective genes during oxidative and xenobiotic stress5-10. Nrf2 protects mammals from numerous age-related disorders such as cancer, neurodegeneration, and chronic inflammation and has become a major chemotherapeutic target11-13.Our assay is based on a GFP transgenic reporter for the SKN-1 target gene gst-414, which encodes a glutathione-s transferase6. The gst-4 reporter is also a biosensor for xenobiotic and oxidative chemicals that activate SKN-1 and can be used to detect low levels of contaminants such as acrylamide and methyl-mercury15-16.

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

A procedure for liquid-based culturing and dispensing of C. elegans strains expressing fluorescent reporter proteins is described that does not require expensive sorting equipment. This approach can be applied to numerous inducible C. elegans genes for drug discovery or biosensing of contaminants.

형광등과 높은 처리량 검사 및 Biosensing C. 엘레간스 레인스

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron (dgn)-destabilized Green Fluorescent Protein (GFP)-based Reporter Protein

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. Maintenance of proteasome activity was implicated in many key cellular processes, like cell's stress response 3, cell cycle regulation and cellular differentiation 4 or in immune system response 5. The dysfunction of the ubiquitin-proteasome system has been related to the development of tumors and neurodegenerative diseases 4, 6. Additionally, a decrease in proteasome activity was found as a feature of cellular senescence and organismal aging 7, 8, 9, 10. Here, we present a method to measure ubiquitin-proteasome activity in living cells using a GFP-dgn fusion protein. To be able to monitor ubiquitin-proteasome activity in living primary cells, complementary DNA constructs coding for a green fluorescent protein (GFP)&#x2013;dgn fusion protein (GFP&#x2013;dgn, unstable) and a variant carrying a frameshift mutation (GFP&#x2013;dgnFS, stable 11) are inserted in lentiviral expression vectors. We prefer this technique over traditional transfection techniques because it guarantees a very high transfection efficiency independent of the cell type or the age of the donor. The difference between fluorescence displayed by the GFP&#x2013;dgnFS (stable) protein and the destabilized protein (GFP-dgn) in the absence or presence of proteasome inhibitor can be used to estimate ubiquitin-proteasome activity in each particular cell strain. These differences can be monitored by epifluorescence microscopy or can be measured by flow cytometry.

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron dgn-destabilized Green Fluorescent Protein GFP-based Reporter Protein

A method to monitor ubiquitin-proteasome activity in living cells is described. A degron-destabilized GFP- (GFP-dgn) and a stable GFP-dgnFS fusion protein are generated and transduced into the cell using a lentiviral expression vector. This technique allows to generate a stable GFP-dgn/GFP-dgnFS expressing cell line in which ubiquitin-proteasome activity can be easily assessed using epifluorescence or flow cytometry.

살아있는 세포에서 Ubiquitin-proteasome 활동 모니터링 Degron (dgn) - 불안정 그린 형광 단백질 (GFP) 기반 리포터 단백질을 사용하여

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. ...

Synthesis of Nine-atom Deltahedral Zintl Ions of Germanium and their Functionalization with Organic Groups

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 Their redox chemistry is even younger, just about ten years old, but despite this short history these deltahedral clusters ions E9n- (E = Si, Ge, Sn, Pb; n = 2, 3, 4) have already shown interesting and diverse reactivity and have been at the forefront of rapidly developing and exciting new chemistry.3-6 Notable milestones are the oxidative coupling of Ge94- clusters to oligomers and infinite chains,7-19 their metallation,14-16,20-25 capping by transition-metal organometallic fragments,26-34 insertion of a transition-metal atom at the center of the cluster which is sometimes combined with capping and oligomerization,35-47 addition of main-group organometallic fragments as exo-bonded substituents,48-50 and functionalization with various organic residues by reactions with organic halides and alkynes.51-58 
This latter development of attaching organic fragments directly to the clusters has opened up a new field, namely organo-Zintl chemistry, that is potentially fertile for further synthetic explorations, and it is the step-by-step procedure for the synthesis of germanium-divinyl clusters described herein. The initial steps outline the synthesis of an intermetallic precursor of K4Ge9 from which the Ge94- clusters are extracted later in solution. This involves fused-silica glass blowing, arc-welding of niobium containers, and handling of highly air-sensitive materials in a glove box. The air-sensitive K4Ge9 is then dissolved in ethylenediamine in the box and then alkenylated by a reaction with Me3SiC&equiv;CSiMe3. The reaction is followed by electrospray mass spectrometry while the resulting solution is used for obtaining single crystals containing the functionalized clusters [H2C=CH-Ge9-CH=CH2]2-. For this purpose the solution is centrifuged, filtered, and carefully layered with a toluene solution of 18-crown-6. Left undisturbed for a few days, the so-layered solutions produced orange crystalline blocks of [K(18-crown-6)]2[Ge9(HCCH2)2]&bull;en which were characterized by single-crystal X-ray diffraction. 
The process highlights standard reaction techniques, work-up, and analysis towards functionalized deltahedral Zintl clusters. It is hoped that it will help towards further development and understanding of these compounds in the community at large.

We present the high-temperature synthesis of intermetallic precursors K4Ge9, their dissolution in ethylenediamine to form Ge94- deltahedral Zintl ions, and the reaction of the clusters with alkynes to form organo-Zintl ions. The latter are characterized by electrospray mass spectrometry in solutions and by single-crystal X-ray diffraction in the solid state.

유기 그룹과 아홉살 원자 Deltahedral Zintl 게르마늄의 이온과 작용화의 합성

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. 
Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. 
We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video.

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) is a method for de novo detection of chromatin interactions, for better understanding of transcriptional control.

염색질 상호 작용을 매핑 및 전사 규정을 이해하는 데 이점 엔드 태그 장면 (ChIA-PET)과 염색질의 상호 작용 분석

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by secreting metabolites. These metabolites have the potential to modulate the physiology and differentiation of their microbial neighbors and are likely important factors in the establishment and maintenance of complex microbial communities. We have developed a fluorescence-based coculture screen to identify such chemically mediated microbial interactions. The screen involves combining a fluorescent transcriptional reporter strain with environmental microbes on solid media and allowing the colonies to grow in coculture. The fluorescent transcriptional reporter is designed so that the chosen bacterial strain fluoresces when it is expressing a particular phenotype of interest (i.e. biofilm formation, sporulation, virulence factor production, etc.) Screening is performed under growth conditions where this phenotype is not expressed (and therefore the reporter strain is typically nonfluorescent). When an environmental microbe secretes a metabolite that activates this phenotype, it diffuses through the agar and activates the fluorescent reporter construct. This allows the inducing-metabolite-producing microbe to be detected: they are the nonfluorescent colonies most proximal to the fluorescent colonies. Thus, this screen allows the identification of environmental microbes that produce diffusible metabolites that activate a particular physiological response in a reporter strain. This publication discusses how to: a) select appropriate coculture screening conditions, b) prepare the reporter and environmental microbes for screening, c) perform the coculture screen, d) isolate putative inducing organisms, and e) confirm their activity in a secondary screen. We developed this method to screen for soil organisms that activate biofilm matrix-production in Bacillus subtilis; however, we also discuss considerations for applying this approach to other genetically tractable bacteria.

Bacteria produce secreted compounds that have the potential to affect the physiology of their microbial neighbors. Here we describe a coculture screen that allows detection of such chemically mediated interspecies interactions by mixing soil microbes with fluorescent transcriptional reporter strains of Bacillus subtilis on solid media.

화학적 매개 종간의 상호 작용을 검출하는 공 배양을 사용하여

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

고해상도 용융 분석과 PCR을 이용하여 신속하고 효율적인 Zebrafish의 유전자형

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

후 전사적으로 규제 유전자의 화학 변조기에 대한 높은 처리량 검사

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder (ALLIGATOR)

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In circadian rhythms research, for example, clock gene fusions with firefly luciferase give rise to robust rhythms in cellular bioluminescence that persist over many days. Technical limitations associated with photomultiplier tubes (PMT) or conventional microscopy-based methods for bioluminescence quantification have typically demanded that cells and tissues be maintained under quite non-physiological conditions during recording, with a trade-off between sensitivity and throughput. Here, we report a refinement of prior methods that allows long-term bioluminescence imaging with high sensitivity and throughput which supports a broad range of culture conditions, including variable gas and humidity control, and that accepts many different tissue culture plates and dishes. This automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) also allows the observation of spatial variations in luciferase expression across a cell monolayer or tissue, which cannot readily be observed by traditional methods. We highlight how the ALLIGATOR provides vastly increased flexibility for the detection of luciferase activity when compared with existing methods.

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder ALLIGATOR

Genetically encoded luciferase is a popular non-invasive reporter of gene expression. Use of an automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) enables longitudinal recording from bioluminescent cells under a wide range of conditions. Here we show how ALLIGATOR may be used in the context of circadian rhythms research.