Name: overexpressing long noncoding rnas using gene-activating crispr
Uploaded: 2019-03-01T15:00:00
Description: Watch this Scientific Journal Video about Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR at JoVE.com

C.P. is supported by RO1 DK60729 and P30 DK 41301-26. D.P. is supported by a Crohn&#39;s &#38; Colitis Foundation (CCFA) career development award, CURE: Digestive Diseases Research Center (DDRC) DK41301, and UCLA Clinical and Translational Science Institute (CTSI) UL1TR0001881. The UCLA virology core was funded by the Center of AIDS Research (CFAR) grant 5P30 AI028697. The UCLA Integrated Molecular Technologies core was supported by CURE/P30 grant DK041301. This work was also supported by the UCLA AIDS Institute.

NOTE: It is important to note that this protocol uses replication-deficient lentiviruses. Perform viral handling only after appropriate lab safety training. Bleach all items and surfaces that come in contact with live viruses for a minimum of 10 min after handling. Use a disposable lab coat and face/eye protection, as well as double gloves, at all times. Perform virus work in biosafety level 2+ labs with viral certification. Dedicate tissue culture hoods and incubators to viral work.
<p class="jove_t...

<ol>
	<li>Miao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trends+of+long+noncoding+RNA+research+from+2007+to+2016:+a+bibliometric+analysis.">Trends of long noncoding RNA research from 2007 to 2016: a bibliometric analysis.</a> Oncotarget. 8 (47), 83114-83127 (2017).</li><li>Derrien, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GENCODE+v7+catalog+of+human+long+noncoding+RNAs:+analysis+of+their+gene+structure,+evolution,+and+expression.">The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression.</a> Genome Research. 22 (9), 1775-1789 (2012).</li><li>Johnsson, P., Lipovich, L., Grander, D., Morris, K. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+conservation+of+long+non-coding+RNAs;+sequence,+structure,+function.">Evolutionary conservation of long non-coding RNAs; sequence, structure, function.</a> Biochimica et Biophysica Acta. 1840 (3), 1063-1071 (2014).</li><li>Perez-Pinera, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+gene+activation+by+CRISPR-Cas9-based+transcription+factors.">RNA-guided gene activation by CRISPR-Cas9-based transcription factors.</a> Nature Methods. 10 (10), 973-976 (2013).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Maeder, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+RNA-guided+activation+of+endogenous+human+genes.">CRISPR RNA-guided activation of endogenous human genes.</a> Nature Methods. 10 (10), 977-979 (2013).</li><li>Konermann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+transcriptional+activation+by+an+engineered+CRISPR-Cas9+complex.">Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.</a> Nature. 517 (7536), 583-588 (2015).</li><li>Schmittgen, T. D., Livak, K. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyzing+real-time+PCR+data+by+the+comparative+C(T)+method.">Analyzing real-time PCR data by the comparative C(T) method.</a> Nature Protocols. 3 (6), 1101-1108 (2008).</li><li>Gomez, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+NeST+long+ncRNA+controls+microbial+susceptibility+and+epigenetic+activation+of+the+interferon-gamma+locus.">The NeST long ncRNA controls microbial susceptibility and epigenetic activation of the interferon-gamma locus.</a> Cell. 152 (4), 743-754 (2013).</li><li>Padua, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+long+noncoding+RNA+signature+for+ulcerative+colitis+identifies+IFNG-AS1+as+an+enhancer+of+inflammation.">A long noncoding RNA signature for ulcerative colitis identifies IFNG-AS1 as an enhancer of inflammation.</a> American Journal of Physiology-Gastrointestinal and Liver Physiology. 311 (3), G446-G457 (2016).</li><li>Collier, S. P., Henderson, M. A., Tossberg, J. T., Aune, T. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+the+Th1+genomic+locus+from+Ifng+through+Tmevpg1+by+T-bet.">Regulation of the Th1 genomic locus from Ifng through Tmevpg1 by T-bet.</a> Journal of Immunology. 193 (8), 3959-3965 (2014).</li><li>Kotake, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+ANRIL+is+required+for+the+PRC2+recruitment+to+and+silencing+of+p15(INK4B)+tumor+suppressor+gene.">Long non-coding RNA ANRIL is required for the PRC2 recruitment to and silencing of p15(INK4B) tumor suppressor gene.</a> Oncogene. 30 (16), 1956-1962 (2011).</li><li>Gilbert, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-Scale+CRISPR-Mediated+Control+of+Gene+Repression+and+Activation.">Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation.</a> Cell. 159 (3), 647-661 (2014).</li><li>Cheng, A. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+activation+of+endogenous+genes+by+CRISPR-on,+an+RNA-guided+transcriptional+activator+system.">Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system.</a> Cell Research. 23 (10), 1163-1171 (2013).</li><li>Matouskova, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reference+genes+for+real-time+PCR+quantification+of+messenger+RNAs+and+microRNAs+in+mouse+model+of+obesity.">Reference genes for real-time PCR quantification of messenger RNAs and microRNAs in mouse model of obesity.</a> PLoS One. 9 (1), e86033 (2014).</li></ol>

This manuscript presents a protocol for using activating CRISPR to overexpress lncRNAs in vitro. This is an especially important technique when studying long noncoding RNAs as the transcriptomic product is the functional unit. After overexpression, the researcher can, then, use these cells to increase the signal-to-noise ratio when studying binding partners and even measure the cellular consequences of increased levels of lncRNAs. Additionally, as lncRNAs frequently act on cis-genes, this endogenous overexpression techni...

While most biomedical research has focused on protein-coding transcripts, the majority of transcribed genes actually consists of noncoding RNAs (Ensembl release 93).Current research is beginning to explore this field, with the number of publications on lncRNAs in disease processes rising exponentially between 2007 and 20171. These publications demonstrate that many lncRNAs are associated with disease. However, the molecular mechanisms of these lncRNAs are difficult to study due to their diverse functions as compared to mRNAs. Compounding the problem of understanding the role of lncRNAs in disease, lncRNAs are often expressed at lower levels than coding RNAs2. Additionally, lncRNAs are poorly conserved, which limits the functional studies in human-cell-line-based techniques3. One method to study the mechanism of these novel genes is to endogenously overexpress them in cultured cells. Overexpression studies can provide key information as to the function of specific genes and enable researchers to dissect key molecular pathways.
A new method to activate the transcription of lncRNA genes is based on CRISPR technologies developed initially by the Gersbach laboratory4. This protocol has been adapted for use in lncRNA biology and for the expression of these genes in other model systems. In the CRISPR overexpressing technique, a protein called CRISPR-associated protein 9 (Cas9) can be directed toward a DNA sequence via an antisense gRNA that is recognized by Cas9. Normally, Cas9 will induce DNA cleavage; however, mutations in Cas9, previously developed for the overexpression technique, deactivate this step5. When a transcriptional activator is fused to a &#34;dead&#34; Cas9 (dCas9) and transduced into cell lines, the endogenous overexpression of lncRNAs can be achieved4,6. The addition of additional modifications to the gRNA, enabling additional transcriptional factors to bind to the gRNA, increased the efficacy of the dCas9 gene activation system 10-fold7. Importantly, it was demonstrated that transcriptional activation requires close proximity (&#60;200 bp) to the transcriptional start site genes, enabling a specific upregulation in gene-rich areas7. Unlike CRISPR knockout technologies, dCas9 and gRNA cassettes need to be integrated into the genome to allow for cells to retain an overexpression over multiple generations. One method to achieve this is to use lentiviruses to integrate the dCas9- and gRNA-containing cassettes. After integration, the lncRNA gene expression can be determined.
In this article, a protocol for lncRNA overexpression in a Jurkat T-cell model will be demonstrated. A step-by-step procedure is shown and can also be adapted to adherent cells.

<table border="0" cellpadding="0" cellspacing="0" style="width:837px;" width="837">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:245px;">Ampicillin</td>
			<td style="width:195px;">Fisher Scientific</td>
			<td style="width:195px;">BP1760-5</td>
			<td style="width:203px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CaCl2</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">C1016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">cDNA synthesis kit (iScript)</td>
			<td style="width:195px;">BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 forward primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>5&#39;-TCGCCACAGCATAAAGAAGA&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 reverse primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>5&#39;-CTTTTCATGGTACGCCACCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 vector</td>
			<td>Addgene</td>
			<td style="width:195px;">50918</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DMEM</td>
			<td>Corning</td>
			<td style="width:195px;">10013CM</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">Ethanol</td>
			<td style="width:195px;">Acros Organics</td>
			<td style="width:195px;">61509-0010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FBS</td>
			<td>Sigma Aldrich</td>
			<td>F2442</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">gRNA plasmid</td>
			<td>VectorBuilder</td>
			<td style="width:195px;">VB180119-1195qxv</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HEK293T cells</td>
			<td>ATCC</td>
			<td style="width:195px;">&#160;CRL-1573</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">HEPES</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">H3375</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPRT1 forward primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>GACCAGTCAACAGGGGACAT&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPRT1 reverse primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>GCTTGCGACCTTGACCATCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hygromycin B</td>
			<td>Corning</td>
			<td style="width:195px;">MT3024CR</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">Isopropanol</td>
			<td style="width:195px;">Fisher Scientific</td>
			<td style="width:195px;">BP2618-500</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Jurkat cells</td>
			<td>ATCC</td>
			<td style="width:195px;">&#160;TIB-152</td>
			<td style="width:203px;">clone E6-1</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-glutamine</td>
			<td>Corning</td>
			<td style="width:195px;">25005Cl</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB agar</td>
			<td>Fisher Scientific</td>
			<td>BP1425-500</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB broth</td>
			<td>Fisher Scientific</td>
			<td>BP1426-2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Maxi-prep kit (Plasmid Purification Kit)</td>
			<td>Qiagen</td>
			<td style="width:195px;">12362</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">Na2HPO4</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">NIST2186II</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Optimem I reduced serum media&#160;</td>
			<td>Gibco</td>
			<td style="width:195px;">31985070</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p24 elisa</td>
			<td>Perkin Elmer</td>
			<td style="width:195px;">NEK050B</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">PBS</td>
			<td style="width:195px;">Corning</td>
			<td style="width:195px;">21-040-CMR</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Penicillin and Streptomycin</td>
			<td>Corning</td>
			<td>30-002-Cl</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pMDG2.G</td>
			<td>Addgene &#160;</td>
			<td style="width:195px;">#12259</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pMDLg/pRRE</td>
			<td>Addgene&#160;</td>
			<td style="width:195px;">#60488</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Poly-L-Lysine</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">P-4832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polybrene</td>
			<td>EMD Millipore</td>
			<td style="width:195px;">TR-1003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pRSV-REV</td>
			<td>Addgene</td>
			<td style="width:195px;">#12253</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Puromycin dihydrochloride</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">P8833</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNA purification kit (Aurum RNA mini)</td>
			<td style="width:195px;">BioRad</td>
			<td>7326820</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sodium Butyrate</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">B5887</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SYBR green (iTaq universal)</td>
			<td style="width:195px;">BioRad</td>
			<td>1725122</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">X100</td>
			<td></td>
		</tr>
	</tbody>
</table>

overexpressing long noncoding rnas using gene-activating crispr

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since 2007. These studies have confirmed that lncRNAs are altered in almost all diseases. However, studying the functional roles for lncRNAs in the context of disease remains difficult due to the lack of protein products, tissue-specific expression, low expression levels, complexities in splice forms, and lack of conservation among species. Given the species-specific expression, lncRNA studies are often restricted to human research contexts when studying disease processes. Since lncRNAs function at the molecular level, one way to dissect lncRNA biology is to either remove the lncRNA or overexpress the lncRNA and measure cellular effects. In this article, a written and visualized protocol to overexpress lncRNAs in vitro is presented. As a representative experiment, an lncRNA associated with inflammatory bowel disease, Interferon Gamma Antisense 1 (IFNG-AS1), is shown to be overexpressed in a Jurkat T-cell model. To accomplish this, the activating clustered regularly interspaced short palindromic repeats (CRISPR) technique is used to enable overexpression at the endogenous genomic loci. The activating CRISPR technique targets a set of transcription factors to the transcriptional start site of a gene, enabling a robust overexpression of multiple lncRNA splice forms. This procedure will be broken down into three steps, namely (i) guide RNA (gRNA) design and vector construction, (ii) virus generation and transduction, and (iii) colony screening for overexpression. For this representative experiment, a greater than 20-fold enhancement in IFNG-AS1 in Jurkat T cells was observed.

A dual vector system to overexpress the lncRNA IFNG-AS1 
The example experiment in this manuscript is the overexpression of a Jurkat T-cell model system expressing the lncRNA IFNG-AS19. IFNG-AS1 is an lncRNA associated with inflammatory bowel disease, that has been seen to regulate Interferon Gamma10. The IFNG-AS1 gene contains three splice variants that all use the same transcriptional start site (...

Watch this Scientific Journal Video about Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR at JoVE.com

Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR

Traditional cDNA-based overexpression techniques have a limited applicability for the overexpression of long noncoding RNAs due to their multiple splice forms with potential functionality. This review reports a protocol using CRISPR technology to overexpress multiple splice variants of a long noncoding RNA.

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since ...

Noncoding RNAs often have multiple isoforms. In in vitro overexpression studies, it is often difficult to study all these expressed isoforms. This technique allows users to derive expression directly from the genome and enable the cells to express the endogenous isoforms for a particular noncoding RNA.This powerful technique allows the user to specifically direct the expression of any gene in the genome with fidelity and accuracy. By designing guide RNAs to specific genes, one is able to use the endogenous gene-splicing machinery to express the natural isoforms in a given cell. Demonstrating the procedure will be Robert Rankin, a post-doc from my laboratory.To design the guide RNA sequence which is located within 100 base pairs of the transcriptional start site, use genetic databases such as BLAT to make sure that the guide RNA is unique to the gene of interest. Store the guide RNA and the deactivated Cas9 plasmids at four degrees Celsius. Streak out E.coli on a Luria broth agar plate with ampicillin and grow the bacteria overnight at 37 degrees Celsius.The next day, pick a colony and grow the bacteria in five milliliters of LB with ampicillin overnight, vigorously shaking the tube in a 37-degree Celsius incubator. The next day, add two milliliters of bacteria to 200 milliliters of LB with ampicillin in a two-liter flask, vigorously shaking the flask overnight in a 37-degree Celsius incubator. Spin down the bacteria at 3, 724 times g for 20 minutes and proceed to DNA purification.To create the dCas9-containing lentivirus, first coat 100-milliliter tissue culture dishes with five milliliters of 0.01%Poly-L-Lysine and plate five million HEK293T cells per dish in 10 milliliters of complete Dulbecco's Modified Eagles Medium, then prepare DNA transfection samples by mixing 10 micrograms of an LTR-containing guide RNA vector or an LTR-containing deactivated Cas9 vector with plasmids containing components of viruses. Add water to a total volume of 450 microliters and filter the mixture through a 0.2-micron filter tip attached to a syringe. Next, add 50 microliters of 2.5-molar calcium dichloride to each transfection sample of the DNA and mix gently.Filter the calcium-DNA mixture through a 0.2-micron filter tip attached to a syringe. Pipette 500 microliters of 2X HBS into a five-milliliter polystyrene tube. Add 500 microliters of the calcium-DNA mixture dropwise and gently vortex.Incubate at room temperature for three minutes. Add one milliliter of the DNA-calcium HBS suspension to each HEK293T-containing tissue culture dish and incubate them in a 5%carbon dioxide incubator at 37 degrees Celsius overnight. On day three, slowly remove and discard the media from the dishes.Carefully wash the cells with PBS once. Add six milliliters of complete DMEM supplemented with 20-millimolar HEPES and 10-millimolar sodium butyrate. Then incubate the cells in a 5%carbon dioxide incubator at 37 degrees Celsius for five to six hours.After the incubation, wash the cells with PBS once and add five milliliters of complete DMEM with 20-millimolar HEPES to the HEK293T cells. Incubate the cells in a 5%carbon dioxide incubator at 37 degrees Celsius for 12 hours. On day four, collect the HEK293T cell supernatants and filter the supernatant containing the virus.To begin the viral particle counts, first dilute the wash concentrate from the P24 ELISA kit by adding 19 parts of distilled, deionized water. Then, dilute the positive control from this kit to 200 nanograms per milliliter using RPMI 1640 as the diluent and make dilutions for a standard curve in 1.5-milliliter tubes according to the P24 ELISA dilution table. To measure the concentration of the virus within the samples add the sample dilutions to the designated wells of a 96-well plate, starting from 1:1000 dilution and modify the volume as necessary in order to be within the range of the standard curve.Then dilute the samples with Triton X-100 to a final concentration of 0.5%and add 200 microliters of each sample and RPMI 1640 to the designated wells. Seal the plate and incubate it at 37 degrees Celsius for two hours. Wash the plate with 300 microliters per well of the 1X wash buffer six times.Remove any excess fluid by inverting the plate and tapping it on a paper towel. Then add 100 microliters of detector antibody from the kit to all wells except the substrate blank. Seal the plate and incubate it at 37 degrees Celsius for one hour.Wash the plate and then remove any excess fluid by inverting the plate and tapping it on a paper towel. In order to measure the detector antibody, dilute the streptavidin horseradish peroxidase at 1:100 dilution with SA-HRP diluent. Mix the diluted SA-HRP thoroughly and add 100 microliters to all wells except the blank.Seal and incubate the plate at room temperature for 30 minutes. Next, wash the plate with the 1X wash buffer and tap away any excess liquid. Drop one ortho-phenylenediamine tablet in 11 milliliters of the substrate diluent to make enough substrate solution for one plate.Vortex the OPD solution vigorously to dissolve it completely and protect it from light. Add 100 microliters of OPD substrate solution to all wells including the blank. Using a spectrophotometer, read absorbance at 450 nanometers immediately.Repeat 10 times at one-second intervals and take the average measurement. Resuspend and culture Jurkat T-cells in a T75 flask with a density of one million cells in five milliliters of the reduced serum media with polybrene. Then add HEK293T-conditioned media containing one million dCas9-containing viral particles.Incubate the cells at 37 degrees Celsius with 5%carbon dioxide. Three days post-infection, spin down the cells at 233 time g for five minutes and resuspend them in 10 milliliters of complete DMEM supplemented with puromycin. Culture the cells in T75 flasks and incubate them at 37 degrees Celsius with 5%carbon dioxide.Every third day for a period of nine days, spin down the cells at 233 times g for five minutes and replace the media with the complete DMEM supplemented with puromycin. Count the cells using a hemocytometer or an automated cell counter. Then, on a 96-well plate with tissue culture-treated tissue, add 10, 000 cells in 100 microliters of the complete DMEM supplemented with puromycin in the first well.Make 1:1 serial dilutions of the contents of the following wells with the complete DMEM supplemented with puromycin. Incubate the cells at 37 degrees Celsius with 5%carbon dioxide. Expand clonal cells into two 24-well plates, then plate two million cells per well of a six-well plate for three of the clones.Plate the other three wells with non-transduced Jurkat cells as controls. Finally, plate the cells into a T75 flask and put the cells in a cell culture incubator overnight. To begin quantitative PCR to measure gene expression, first synthesize complementary DNA by adding one microgram of RNA, four microliters of cDNA synthesis buffer, and one microliter of reverse transcriptase to 250 microliter tubes, then add water to a final volume of 20 microliters.Then, use a thermal cycler at 42 degrees Celsius for 30 minutes and at 95 degrees Celsius for five minutes to inactivate the reverse transcriptase. Dilute the cDNA with 60 microliters of water after the synthesis. Run polymerase chain reactions for tubes containing 0.5 microliters of each forward and reverse primer at final concentration of 10 micromolar, five microliters of SYBR green, and four microliters of cDNA.Finally select Jurkat-dCas9 cells in DMEM supplemented with Hygromycin B for 10 days. Spin down the cells and change the media every three days. Purify RNAse and proceed to RT-qPCR.In this study, gRNA sequences that were within 10 to 100 base pairs away from the transcriptional start site were used for directing the Cas9-activating complex to the transcriptional locus of IFNG-AS1, a long noncoding RNA associated with inflammatory bowel disease. To enable the selection of double transduced cells, a two-plasmid system was used to transduce either dCas9 or gRNAse enhancers into cells. Here MS2 proteins enhance the overexpression of IFNG-AS1.Cas9 expression was confirmed for both clones. Primers against HPRT1 were used to confirm the presence of RNA in the non-transduced cells. mRNA expression was confirmed by omitting the reverse transcriptase from the cDNA reaction.Three splice variants of IFNG-AS1 could be detected with either transcript-specific primer sets or a primer set against all known IFNG-AS1 transcripts. All fluorescence curves were exponential with the housekeeping gene HPRT1 reaching the exponential phase within a half cycle between control and IFNG-AS1 gRNA-expressing cells. Primers against all known IFNG-AS1 transcripts were the most detectable between experiments, with measurements of 20-fold increases in IFNG-AS1 expression.However, the third transcript of IFNG-AS1 showed a five-to 10-fold significant increase in IFNG-AS1 levels. To actively overexpress your desired gene, design of the guide RNA in step 2.1 is critical to the success of the protocol. Additionally, production of quality viral particles will ensure a robust expression of your protocol components.Once the desired gene is overexpressed, functional studies can be performed to investigate the gene mechanisms. In our example, we chose to look at cytokine production following overexpression of our gene of interest. This technique was initially developed by the Griesbach Group In 2013 and has been broadly applied and elaborated on by other groups.We were excited to apply this technique to long noncoded RNAs in order to explore their specific functions. Replication-defective lentiviruses should be handled in a laboratory that's been approved for viral work. Additionally, human cell lines and E.coli bacteria are considered biohazardous.Lastly, recombinant DNA plasmids should be handled by trained staff.

Research

JoVE Journal

Genetics

Sequence-specific and Selective Recognition of Double-stranded RNAs over Single-stranded RNAs by Chemically Modified Peptide Nucleic Acids

RNAs are emerging as important biomarkers and therapeutic targets. Thus, there is great potential in developing chemical probes and therapeutic ligands ...

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

Metabolic Labeling and Profiling of Transfer RNAs Using Macroarrays

Transfer RNAs (tRNA) are abundant short non-coding RNA species that are typically 76 to 90 nucleotides in length. tRNAs are directly responsible for ...

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been ...

Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these ...

CRISPR Guide RNA Cloning for Mammalian Systems

The outlined protocol describes streamlined methods for the efficient and cost-effective generation of Cas9-associated guide RNAs. Two alternative ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...