The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.

1. Template Preparation
NOTE: Any genomic DNA template suspected to contain DNA derived from one of the seven Eimeria species which infect chickens can be used as template for LAMP-based Eimeria species identification. Intestinal tissue samples for field diagnostic analysis should be collected during routine post-mortem as described here.
<ol>
	<li>Choose the section (or sections) of intestine to be tested. See Table 1 for a guide to sample site selection and the Eimeria species most likely to be present18 and Figure 1 for the species-specific range of distribution and location of the sampling sites. 
	NOTE: This is of key importance since Eimeria are notably host site specific. Each species that infects chickens is defined by the intestinal region that it targets19. The decision may be influenced by previous experience of the farm, interest in one or more specific Eimeria species or other diagnostic indicators6.</li>
	<li>Excise 5 cm or longer lengths of the intestinal section(s) selected to test for Eimeria using sterile scissors or a scalpel. Optionally, store the samples for subsequent analysis in a fixative such as for example in RNAlater18 or 95% ethanol. 
	NOTE: If storing in ethanol the sample should be washed thoroughly in sterile tris-ethylenediaminetetraacetic acid (TE) buffer prior to use.</li>
	<li>Cut the sample open longitudinally, remove most intestinal contents (if present) and scrape cells from the mucosal layer free using either the edge of a sterile glass microscope slide or an ethanol/flame sterilised scissor blade. Optionally for a pooled sample include cells from all four of the species-specific intestinal sites in a single tube.</li>
	<li>Put the scraped material into a sterile 1.5 ml screw-top microcentrifuge tube containing 100 &#181;l sterile TE buffer including 10% (w/v) Chelex 100 resin.</li>
	<li>Shake each sample vigorously for 1 min. Ensure that the screw top is firmly closed and then incubate in a boiling water bath for 10 min.</li>
	<li>After boiling allow each sample to cool at the ambient temperature for 1-2 min.</li>
	<li>Centrifuge each sample using a microcentrifuge at top speed (e.g., ~10,000 x g) for 1 min.</li>
	<li>Collect 2 &#181;l of the resulting supernatant to be template in each LAMP assay to be undertaken. Optionally, pool more than one intestinal site in a single tube to provide a multi-site assay.</li>
</ol>
2. Eimeria LAMP Primer Preparation (Pre-assay)
<ol>
	<li>Prepare Eimeria LAMP primer stocks adequate for 100 assays:
	<ol>
		<li>Reconstitute each lyophilised Eimeria LAMP primer by adding molecular grade water to a concentration of 100 &#181;M (as specified by the manufacturer). If not specified, calculate the volume of molecular grade water required using the physical and molecular weights of each primer.</li>
		<li>Pipette 60 &#181;l molecular grade water into a separate 0.5 ml flip-top microcentrifuge tube for each Eimeria species to be assayed.</li>
		<li>Add primers FIP, BIP, F3, B3, LF and LB specific to the target Eimeria species to the water using the volumes shown in Table 2, creating a series of seven species-specific primer mixes.</li>
		<li>Briefly vortex mix the primer solution, then pulse microfuge and freeze until required.</li>
	</ol>
	</li>
	<li>Prepare a LAMP reaction mastermix for each Eimeria species to be assayed. Multiply the volumes shown in Table 3 by the number of samples and add three to a positive control, negative control and pipetting spare. Pipette into a 0.5 or 1.5 ml flip-top microcentrifuge tube.</li>
</ol>
3. Eimeria LAMP Assay
<ol>
	<li>Pipette 23 &#181;l Eimeria species-specific Bst DNA polymerase/LAMP mastermix into a 0.5 ml microcentrifuge tube.</li>
	<li>Add 2 &#181;l DNA template (prepared in section 1), making a final reaction volume of 25 &#181;l.</li>
	<li>Add 2 &#181;l Eimeria species-specific genomic DNA to one reaction (positive control). Add 2 &#181;l molecular grade water to reaction (negative control). 
	NOTE: If species-specific genomic DNA is not available a previous positive LAMP or standard PCR product may be used instead.</li>
	<li>Incubate in a water bath or heat block at 62oC for 30 min. Optionally, de-activate the Bst DNA polymerase by heating to 80oC for 10 min if the reaction is not going to be read immediately.</li>
</ol>
4. LAMP Assay Read-out
<ol>
	<li>At the conclusion of the incubation assess the colour of each reaction by eye under indoor light. Negative results appear pink to violet in colour, positive results appear sky blue20.</li>
	<li>Optionally, confirm the LAMP assay result in a laboratory by mixing 5 &#181;l LAMP reaction product with 1 &#181;l DNA gel loading buffer for agarose gel electrophoresis using a 2% agarose gel in 1 x Tris/Borate/EDTA (TBE) buffer, pre-stained using a nucleic acid stain (5 &#181;l per 50 ml agarose). Add 5 &#181;l of a 1Kb molecular size DNA ladder to lane 1 of the gel to allow fragment size calculation.</li>
</ol>

<ol><li>Chapman, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+selective+review+of+advances+in+coccidiosis+research%5BTitle%5D)+AND+%22Adv+Parasitol%22%5BJournal%5D)">A selective review of advances in coccidiosis research.</a> Adv Parasitol. 83, 93-171 (2013).</li>
<li>Shirley, M. W., Smith, A. L., Tomley, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+biology+of+avian+Eimeria+with+an+emphasis+on+their+control+by+vaccination%5BTitle%5D)+AND+%22Adv+Parasitol%22%5BJournal%5D)">The biology of avian Eimeria with an emphasis on their control by vaccination.</a> Adv Parasitol. 60, 285-330 (2005).</li>
<li>Fornace, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Occurrence+of+Eimeria+species+parasites+on+small-scale+commercial+chicken+farms+in+Africa+and+indication+of+economic+profitability%5BTitle%5D)+AND+%22PLoS+ONE%22%5BJournal%5D)">Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability.</a> PLoS ONE. 8 (12), e84254(2013).</li>
<li>Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genomic+analysis+of+Eimeria+spp.+populations+in+relation+to+performance+levels+of+broiler+chicken+farms+in+Arkansas+and+North+Carolina%5BTitle%5D)+AND+%22J+Parasitol%22%5BJournal%5D)">Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina.</a> J Parasitol. 95 (4), 871-880 (2009).</li>
<li>Peek, H. W., Landman, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Coccidiosis+in+poultry%3A+anticoccidial+products%2C+vaccines+and+other+prevention+strategies%5BTitle%5D)+AND+%22Vet+Q%22%5BJournal%5D)">Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies.</a> Vet Q. 31 (3), 143-161 (2011).</li>
<li>Johnson, J., Reid, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Anticoccidial+drugs%3A+lesion+scoring+techniques+in+battery+and+floor-pen+experiments+with+chickens%5BTitle%5D)+AND+%22Exp+Parasitol%22%5BJournal%5D)">Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens.</a> Exp Parasitol. 28 (1), 30-36 (1970).</li>
<li>Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+survey+of+the+economic+impact+of+subclinical+Eimeria+infections+in+broiler+chickens+in+Norway%5BTitle%5D)+AND+%22Avian+Pathol%22%5BJournal%5D)">A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway.</a> Avian Pathol. 37 (3), 333-341 (2008).</li>
<li>Procunier, J., Fernando, M., Barta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Species+and+strain+differentiation+of+Eimeria+spp.+of+the+domestic+fowl+using+DNA+polymorphisms+amplified+by+arbitrary+primers%5BTitle%5D)+AND+%22Parasitology+Research%22%5BJournal%5D)">Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers.</a> Parasitology Research. 79 (2), 98-102 (1993).</li>
<li>Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Development+of+a+diagnostic+PCR+assay+for+the+detection+and+discrimination+of+four+pathogenic+Eimeria+species+of+the+chicken%5BTitle%5D)+AND+%22Avian+Pathol%22%5BJournal%5D)">Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken.</a> Avian Pathol. 27 (5), 490-497 (1998).</li>
<li>Vrba, V., Blake, D. P., Poplstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantitative+real-time+PCR+assays+for+detection+and+quantification+of+all+seven+Eimeria+species+that+infect+the+chicken%5BTitle%5D)+AND+%22Vet+Parasitol%22%5BJournal%5D)">Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken.</a> Vet Parasitol. 174 (3-4), 183-190 (2010).</li>
<li>Morris, G. M., Gasser, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Biotechnological+advances+in+the+diagnosis+of+avian+coccidiosis+and+the+analysis+of+genetic+variation+in+Eimeria%5BTitle%5D)+AND+%22Biotechnol+Adv%22%5BJournal%5D)">Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria.</a> Biotechnol Adv. 24 (6), 590-603 (2006).</li>
<li>Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aPerry%2C+B+%22Investing+in+animal+health+research+to+alleviate+poverty%22">Investing in animal health research to alleviate poverty</a>. , ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).</li>
<li>Nagamine, K., Hase, T., Notomi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Accelerated+reaction+by+loop-mediated+isothermal+amplification+using+loop+primers%29%5BTitle%5D)+AND+%22Mol+Cell+Probes%22%5BJournal%5D)">Accelerated reaction by loop-mediated isothermal amplification using loop primers).</a> Mol Cell Probes. 16 (3), 223-229 (2002).</li>
<li>Notomi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Loop-mediated+isothermal+amplification+of+DNA%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Loop-mediated isothermal amplification of DNA.</a> Nucleic Acids Res. 28 (12), E63(2000).</li>
<li>Kaneko, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Detection+of+enterotoxigenic+Clostridium+perfringens+in+meat+samples+by+using+molecular+methods%5BTitle%5D)+AND+%22Appl+Environ+Microbiol%22%5BJournal%5D)">Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.</a> Appl Environ Microbiol. 77 (21), 7526-7532 (2011).</li>
<li>Karanis, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Development+and+preliminary+evaluation+of+a+loop-mediated+isothermal+amplification+procedure+for+sensitive+detection+of+cryptosporidium+oocysts+in+fecal+and+water+samples%5BTitle%5D)+AND+%22Appl+Environ+Microbiol%22%5BJournal%5D)">Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples.</a> Appl Environ Microbiol. 73 (17), 5660-5662 (2007).</li>
<li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+detection+of+Infectious+bursal+disease+virus+by+reverse+transcription+loop-mediated+isothermal+amplification+assay%5BTitle%5D)+AND+%22J+Vet+Diagn+Invest%22%5BJournal%5D)">Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay.</a> J Vet Diagn Invest. 21 (6), 841-843 (2009).</li>
<li>Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Loop-mediated+isothermal+amplification+%28LAMP%29+assays+for+the+species-specific+detection+of+Eimeria+that+infect+chickens%5BTitle%5D)+AND+%22BMC+Vet+Res%22%5BJournal%5D)">Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.</a> BMC Vet Res. 7 (1), 67(2011).</li>
<li>Long, P., Joyner, L., Millard, B., Norton, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+guide+to+laboratory+techniques+used+in+the+study+and+diagnosis+of+avian+coccidiosis%5BTitle%5D)+AND+%22Folia+Veterinaria+Latina%22%5BJournal%5D)">A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis.</a> Folia Veterinaria Latina. 6 (3), 201-217 (1976).</li>
<li>Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Colorimetric+detection+of+loop-mediated+isothermal+amplification+reaction+by+using+hydroxy+naphthol+blue%5BTitle%5D)+AND+%22BioTechniques%22%5BJournal%5D)">Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue.</a> BioTechniques. 46 (3), 167-172 (2009).</li>
<li>Arakawa, A., Baba, E., Fukata, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Eimeria+tenella+infection+enhances+Salmonella+typhimurium+infection+in+chickens%5BTitle%5D)+AND+%22Poult+Sci%22%5BJournal%5D)">Eimeria tenella infection enhances Salmonella typhimurium infection in chickens.</a> Poult Sci. 60 (10), 2203-2209 (1981).</li>
<li>Blake, D. P., Smith, A. L., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Amplified+fragment+length+polymorphism+analyses+of+Eimeria+spp.%3A+an+improved+process+for+genetic+studies+of+recombinant+parasites%5BTitle%5D)+AND+%22Parasitol+Res%22%5BJournal%5D)">Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites.</a> Parasitol Res. 90 (6), 473-475 (2003).</li>
<li>Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Detection+of+Campylobacter+spp.+in+chicken+fecal+samples+by+real-time+PCR%5BTitle%5D)+AND+%22J+Clin+Microbiol%22%5BJournal%5D)">Detection of Campylobacter spp. in chicken fecal samples by real-time PCR.</a> J Clin Microbiol. 42 (11), 5125-5132 (2004).</li>
<li>Raj, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Real-time+PCR-based+quantification+of+Eimeria+genomes%3A+a+method+to+outweigh+underestimation+of+genome+numbers+due+to+PCR+inhibition%5BTitle%5D)+AND+%22Avian+Pathol%22%5BJournal%5D)">Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition.</a> Avian Pathol. 42 (4), 304-308 (2013).</li>
<li>Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Eimeria+maxima%3A+the+influence+of+host+genotype+on+parasite+reproduction+as+revealed+by+quantitative+real-time+PCR%5BTitle%5D)+AND+%22Int+J+Parasitol%22%5BJournal%5D)">Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR.</a> Int J Parasitol. 36 (1), 97-105 (2006).</li>
<li>Beck, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+approaches+to+diversity+of+populations+of+apicomplexan+parasites%5BTitle%5D)+AND+%22Int+J+Parasitol%22%5BJournal%5D)">Molecular approaches to diversity of populations of apicomplexan parasites.</a> Int J Parasitol. 39 (2), 175-189 (2009).</li>
</ol>

The authors declare that they have no competing financial interests.

The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~&#163;0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment. 
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25. 
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.

Global chicken production has increased ten-fold over the last 50 years with the developing world hosting nearly four times the expansion witnessed in the developed world <a href="http://www.faostat.org">(www.faostat.org)</a>. As the relevance of chicken production to world food security has grown so too has the profile of pathogens which can cause serious disease in chickens. One prime example are the Eimeria species, ubiquitous protozoan parasites which can cause the enteric disease coccidiosis1. Wherever chickens are reared one or more Eimeria species are likely to be common2-4. In the developed world Eimeria are primarily controlled by chemoprophylaxis, employing shuttle or rotation programmes to minimise the impact of resistance5. Live vaccines are also used in systems where bird value is sufficient to justify the cost (e.g., breeding stock, layers and some broilers5). As a result of these measures clinical coccidiosis is often well controlled, although sub-clinical infection is common5. In the developing world vaccination is rare and drug application frequently less well informed. As a consequence sub-clinical and clinical coccidiosis is more common and exerts a significant economic impact3.
Diagnosis of eimerian infection has traditionally relied on lesion scoring post-mortem, although even the authors of the most widely used scoring system commented that for some species &#8220;it seems doubtful whether such a procedure should be attempted in any but moderately severe infections&#8221;6. Supplementary evidence can be gathered through microscopic detection of the environmentally resistant oocyst lifecycle stage in faecal or litter samples, although overlapping morphology can confound all but the expert6,7. Molecular alternatives using polymerase chain reaction (PCR), random amplification of polymorphic DNA PCR (RAPD-PCR) and quantitative PCR technologies have been available for up to 20 years8-10, but to date they have failed to become popular. Relative expense and the requirement for specialist laboratory equipment or processing have limited their uptake, despite the often subjective and technically demanding nature of the older pathology- and microscopy-based approaches10,11. Such limitations can be exaggerated in many of the poorer regions of the world such as South East Asia, where the impact of coccidiosis on poverty may be proportionately greater12. In response there is a clear demand for new straightforward and sensitive, but cost effective, Eimeria species-specific diagnostic assays.
Loop-mediated isothermal amplification (LAMP) is an easy to prepare DNA polymerase-driven technique that is capable of amplifying large quantities of DNA. Most importantly, LAMP uses a Bst DNA polymerase instead of the Taq DNA polymerase commonly used in PCR, which facilitates DNA amplification at a single constant temperature without the requirement for thermal cycling13,14. LAMP can be amenable to application in even the most rudimentary laboratory or in the field. Characterised by relative resistance to many PCR inhibitors, high sensitivity and specificity, LAMP assays have been developed for a wide range of pathogens including infectious bursal disease virus, Clostridium perfringens and Cryptosporidium15-17. In response to demand for new cost-effective Eimeria species-specific diagnostics a panel of LAMP assays specific to each of the seven Eimeria species that infect chickens has been developed18. Applications for the new assays include monitoring parasite occurrence, of particular value given the association of species such as Eimeria maxima or Eimeria necatrix with poor economic performance3,4. Other applications include assessing the efficacy of a farm&#8217;s anticoccidial strategy, diagnosis of sub-clinical infection or clinical disease and evaluation of risk posed by Eimeria to a farm.

<table><tbody><tr><td>RNAlater</td><td>Ambion</td><td>AM7024</td><td></td></tr><tr><td>Ethanol</td><td>VWR Chemicals</td><td>20821.321</td><td>Caution, highly flammable</td></tr><tr><td>100 x Tris-EDTA (TE) buffer concentrate</td><td>Sigma-Aldrich</td><td>T9285</td><td></td></tr><tr><td>Chelex 100 resin</td><td>Bio-Rad</td><td>142-1253</td><td></td></tr><tr><td>Molecular grade water</td><td>Invitrogen</td><td>10977035</td><td></td></tr><tr><td>E. acervulina F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CCTAACATTTCGCTTCACGGAC</td></tr><tr><td>E. acervulina B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*ATGAGCAAGTGGAACACCTTG</td></tr><tr><td>E. acervulina FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT</td></tr><tr><td>E. acervulina BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG</td></tr><tr><td>E. acervulina LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TAAGGTTACACCCGTGGAGG</td></tr><tr><td>E. acervulina LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCCATGCACAAAGCGACTT</td></tr><tr><td>E. brunetti F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GGCCATCAAGTTCCATGAGC</td></tr><tr><td>E. brunetti B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TCAACCTCCTGAGTGTGGTT</td></tr><tr><td>E. brunetti FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT</td></tr><tr><td>E. brunetti BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC</td></tr><tr><td>E. brunetti LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAAACGCTCGAACATGGC</td></tr><tr><td>E. brunetti LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CTTCTCCACAGACCCAGAGGT</td></tr><tr><td>E. maxima F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*ACTACGGAAAAGTGCGTAGCT</td></tr><tr><td>E. maxima B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CCTTCCTCCCTTCTGAAAACTG</td></tr><tr><td>E. maxima FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAGTCACTGCTGATGTACCAAA&lt;br/&gt; AG-GAACTATGCCGCTTTCCCCTG</td></tr><tr><td>E. maxima BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA</td></tr><tr><td>E. maxima LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CAAGCCTACGCGGACATC</td></tr><tr><td>E. maxima LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TTATGCAGCTGGGTCAACG</td></tr><tr><td>E. mitis F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*ACGATAGCCAAGACACGTAAGG</td></tr><tr><td>E. mitis B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CCCCGTGATAAGAGTAGGAACA</td></tr><tr><td>E. mitis FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGCGGGTCGTGAGATTTAAATT&lt;br/&gt; AT-GGAAGATCAGGACGGGCACT</td></tr><tr><td>E. mitis BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GTTTCAGTTGATGAACAAGCGA&lt;br/&gt; GA-TGCGCCTCTAGAATCAAGACG</td></tr><tr><td>E. mitis LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TCCATGCATCCCCTTGTT</td></tr><tr><td>E. mitis LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGTGGGCACAGATTGATTC</td></tr><tr><td>E. necatrix F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TGGCTTTCCCGCGTACC</td></tr><tr><td>E. necatrix B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGGCCCAACACAAAGACTG</td></tr><tr><td>E. necatrix FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGCTTGAGTTTTAAGCTATGCA&lt;br/&gt; CA-GACCCAAGCAGCTCACCAA</td></tr><tr><td>E. necatrix BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC</td></tr><tr><td>E. necatrix LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GTCTGTAACTTGGGACGTTGT</td></tr><tr><td>E. necatrix LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAACAGCCGGAGCCTCTC</td></tr><tr><td>E. praecox F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCCCTTGTATGTTGCTGTTTCT</td></tr><tr><td>E. praecox B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCGCACGAATCTGAATCACAC</td></tr><tr><td>E. praecox FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*ATCTCCTCAAAGACTTTCGCGT&lt;br/&gt; A-GCGCTTGGCTATATCCATAGG</td></tr><tr><td>E. praecox BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT</td></tr><tr><td>E. praecox LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAATAGCATTGCCAGGTGG</td></tr><tr><td>E. praecox LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GTCCACTGTCATTAATATTGC&lt;br/&gt; TGC</td></tr><tr><td>E. tenella F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCTTGTGAAGGTCAGCGTG</td></tr><tr><td>E. tenella B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCTGAGTCCATACGTACTTCCT</td></tr><tr><td>E. tenella FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCCACTGCTATGGAAAGTCAC&lt;br/&gt; AC-CATAACTGGCATGCAGGGGT</td></tr><tr><td>E. tenella BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GTTTGGCCCGAAAGTTGTGAA&lt;br/&gt; GA-CGTCAGAAATTGCTGCCCAAT</td></tr><tr><td>E. tenella LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGCATGTGCAGTTGAAGACA</td></tr><tr><td>E. tenella LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CCAAATGTATCTGCTAGTTATA&lt;br/&gt; TTAACAAG</td></tr><tr><td>10 x ThermoPol reaction buffer</td><td>New England Biolabs</td><td>B9004S</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>M7506</td><td></td></tr><tr><td>dNTPs</td><td>Promega</td><td>U1330</td><td></td></tr><tr><td>Betaine solution (5 M)</td><td>Sigma-Aldrich</td><td>B0300</td><td></td></tr><tr><td>Bst polymerase</td><td>New England Biolabs</td><td>M0275S</td><td></td></tr><tr><td>Hydroxynaphthol blue</td><td>Sigma-Aldrich</td><td>33936</td><td>Dissolved in molecular grade water.</td></tr><tr><td>UltraPure agarose</td><td>Invitrogen</td><td>16500-500</td><td></td></tr><tr><td>10 x Tris/Borate/EDTA (TBE) buffer</td><td>Invitrogen</td><td>AM9863</td><td></td></tr><tr><td>Blue/Orange DNA loading dye (x6)</td><td>Promega</td><td>G1881</td><td></td></tr><tr><td>GeneRuler 1Kb DNA ladder</td><td>Thermo Scientific</td><td>SM0313</td><td></td></tr><tr><td>SafeView nucleic acid stain</td><td>NBS Biologicals</td><td>NBS-SV</td><td></td></tr></tbody></table>

loop-mediated isothermal amplification (lamp) assays for the species-specific detection of eimeria that infect chickens

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm&#8217;s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

Assay validation
During validation each Eimeria species-specific LAMP assay was tested using a panel of pure DNA samples representing all seven Eimeria species that infect the chicken, as well as chicken genomic DNA as a host control. Agarose gel electrophoresis was used to resolve each assay and demonstrated absolute species specificity with no host cross-reactivity18. Next, a ten-fold serial dilution series prepared using purified Eimeria tenella genomic DNA revealed an assay sensitivity limit of between one and ten genome copies18. No upper limit was determined with positive results achieved up to and including the highest concentration (100,000 genome copies)18.
Application with field samples
Samples collected for Eimeria testing are likely to be derived from chickens found dead, culled as a consequence of poor health or culled for sentinel health surveillance, indicating a likely sample size of between one and three when part of a routine. Testing three birds collected from a US broiler farm as part of a surveillance programme yielded three sets of intestinal samples. Targeted application of the species-specific LAMP assays, prioritising the preferred intestinal sites for each Eimeria species (Table 1), allowed visual identification of eimerian infection in all birds tested using hydroxynaphthol blue as an indicator (Figure 2A). The colour achieved with a negative LAMP reaction when using hydroxynaphthol blue can range from violet to pink, but is always distinct from the blue achieved by a positive result. Confirmation by agarose gel electrophoresis provided comparable results (Figure 2B). During field application the user may choose to apply the full screen against all seven species, or target only those species prioritised as important or known to be circulating on the farm or surrounding area.
The failure of PCR-based approaches to become established as diagnostics for the occurrence of Eimeria emphasises the requirement for simplicity in any new test. While LAMP offers simpler preparation and processing than PCR, the requirement to test multiple intestinal sites per bird remains discouraging. Production of a single pooled DNA sample per bird, which can then be tested with one or more LAMP assays, is likely to be more appealing. Processing one pooled sample per bird, representing material collected from each of the specific intestinal sites described in Table 1 and pooled prior to DNA preparation, for testing with all seven LAMP assays provided the same result as when each intestinal site was processed separately (Figure 2 compared with Figure 3).
<img alt="Figure 1" src="/files/ftp_upload/52552/52552fig1.jpg" /> 
Figure 1.&#160;Intestinal sampling sites for LAMP detection of Eimeria species parasites that infect chickens. The intestinal regions targeted by each Eimeria species is highlighted by the coloured lines, with the preferred sites of sampling indicated by the number between the dotted black lines (E. acervulina: yellow/1, E. brunetti: pink/2, E. maxima: blue/3, E. mitis: orange/4, E. necatrix: red/5, E. praecox: green/6 and E. tenella: grey/7). <a href="https://www.jove.com/files/ftp_upload/52552/52552fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/52552/52552fig2.jpg" /> 
Figure 2.&#160;LAMP diagnosis of eimerian infection from three commercial broiler chickens. LAMP reactions resolved using (A) hydroxynaphthol blue, where a sky blue reaction was positive and a violet to pink reaction was negative, and (B) agarose gel electrophoresis. The intestinal sites sampled were as shown in Table 1 for each parasite species. A = E. acervulina, B = E. brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox and T = E. tenella. Lane 1 contained the GeneRuler 1Kb DNA ladder. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/52552/52552fig3.jpg" /> 
Figure 3. LAMP diagnosis of eimerian infection using pooled samples from three separate commercial broiler chickens. LAMP reactions resolved using hydroxynaphthol blue, where a sky blue reaction was positive and violet to pink reaction was negative. A = E. acervulina, B = E. brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox and T = E. tenella. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Sample site</td>
			<td>Eimeria species assay (most likely)</td>
		</tr>
		<tr>
			<td>Duodenum (D)</td>
			<td>E. acervulina, E. praecox</td>
		</tr>
		<tr>
			<td>Jejunum/ileum* (J/I)</td>
			<td>E. maxima, E. necatrix</td>
		</tr>
		<tr>
			<td>Caeca (C)</td>
			<td>E. necatrix, E. tenella</td>
		</tr>
		<tr>
			<td>Terminal ileum (TI)</td>
			<td>E. brunetti, E. mitis</td>
		</tr>
		<tr>
			<td>Pooled sample (P)</td>
			<td>E. acervulina, E. brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, E. tenella</td>
		</tr>
	</tbody>
</table>
Table 1.&#160;Intestinal region-specific selection of candidate Eimeria species assays. The choice of region to be sampled varies for each Eimeria species as illustrated in Figure 1. Pooled samples include material collected from all four specific sites which were then combined for DNA preparation.
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Primer*</td>
			<td>Stock concentration (&#181;M)</td>
			<td>Volume (&#181;l)</td>
		</tr>
		<tr>
			<td>Water</td>
			<td>-</td>
			<td>60</td>
		</tr>
		<tr>
			<td>Forward Inner Primer (FIP)</td>
			<td>100</td>
			<td>40</td>
		</tr>
		<tr>
			<td>Backward Inner Primer (BIP)</td>
			<td>100</td>
			<td>40</td>
		</tr>
		<tr>
			<td>Forward Outer Primer (F3)</td>
			<td>100</td>
			<td>10</td>
		</tr>
		<tr>
			<td>Backward Outer Primer (B3)</td>
			<td>100</td>
			<td>10</td>
		</tr>
		<tr>
			<td>Loop Forward (LF)</td>
			<td>100</td>
			<td>20</td>
		</tr>
		<tr>
			<td>Loop Backward (LB)</td>
			<td>100</td>
			<td>20</td>
		</tr>
		<tr>
			<td>Total</td>
			<td></td>
			<td>200</td>
		</tr>
	</tbody>
</table>
Table 2.&#160;Preparation of a LAMP primer premix. The components and proportions required to prepare a primer premix for LAMP. Volumes shown are for 100 LAMP reactions. *Primer identities as shown in the Materials and Barkway et al&#160;(2011)18.
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td></td>
			<td>Stock concn</td>
			<td>Final reaction concn</td>
			<td>Volume per reaction(&#181;l)</td>
		</tr>
		<tr>
			<td>DDW</td>
			<td>-</td>
			<td>-</td>
			<td>10.1</td>
		</tr>
		<tr>
			<td>ThermoPol buffer</td>
			<td>10 x</td>
			<td>1 x</td>
			<td>2.5</td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>100 mM</td>
			<td>2 mM</td>
			<td>0.5</td>
		</tr>
		<tr>
			<td>Primer mix*</td>
			<td colspan="2">Table 2</td>
			<td>2.5</td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>25 mM</td>
			<td>400 uM</td>
			<td>0.4</td>
		</tr>
		<tr>
			<td>Betaine</td>
			<td>5 M</td>
			<td>1 M</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Hydroxynaphthol blue</td>
			<td>3 mM</td>
			<td>120 &#181;M</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Bst DNA polymerase&#160;</td>
			<td>8,000 U/ml</td>
			<td>8 U</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Total</td>
			<td></td>
			<td></td>
			<td>23</td>
		</tr>
	</tbody>
</table>
Table 3.&#160;Preparation of a LAMP reaction mastermix. *Eimeria species-specific.

Watch this Scientific Journal Video about Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens at JoVE.com

Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the ...

loop-mediated-isothermal-amplification-lamp-assays-for-species

Research

JoVE Journal

Immunology and Infection

26.9K Views.  Royal Veterinary College, London. Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

Video: Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Rapid Diagnosis of Avian Influenza Virus in Wild Birds: Use of a Portable rRT-PCR and Freeze-dried Reagents in the Field

Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal.
Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene.
The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey Bird Banding Laboratory. The primary advantage of this technique is to expedite diagnosis of wild birds, increasing the chances of containing an outbreak in a remote location. On-site diagnosis would also prove useful for identifying and studying infected individuals in wild populations. The opportunity to collect information on host biology (immunological and physiological response to infection) and spatial ecology (migratory performance of infected birds) will provide insights into the extent to which wild birds can act as vectors for AIV over long distances.

This study describes diagnosis of avian influenza in wild birds using a portable rRT-PCR system. The method takes advantage of freeze-dried reagents to screen wild birds in a non-laboratory setting, typical of an outbreak scenario. Use of molecular tools provides accurate and sensitive alternatives for rapid diagnosis.

Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory ...

Avian Influenza Surveillance with FTA  Cards: Field Methods, Biosafety, and Transportation Issues Solved

Avian Influenza Viruses (AIVs) infect many mammals, including humans1. These AIVs are diverse in their natural hosts, harboring almost all possible viral subtypes2. Human pandemics of flu originally stem from AIVs3. Many fatal human cases during the H5N1 outbreaks in recent years were reported. Lately, a new AIV related strain swept through the human population, causing the 'swine flu epidemic'4. Although human trading and transportation activity seems to be responsible for the spread of highly pathogenic strains5, dispersal can also partly be attributed to wild birds6, 7. However, the actual reservoir of all AIV strains is wild birds.
In reaction to this and in face of severe commercial losses in the poultry industry, large surveillance programs have been implemented globally to collect information on the ecology of AIVs, and to install early warning systems to detect certain highly pathogenic strains8-12. Traditional virological methods require viruses to be intact and cultivated before analysis. This necessitates strict cold chains with deep freezers and heavy biosafety procedures to be in place during transport. Long-term surveillance is therefore usually restricted to a few field stations close to well equipped laboratories. Remote areas cannot be sampled unless logistically cumbersome procedures are implemented. These problems have been recognised13, 14 and the use of alternative storage and transport strategies investigated (alcohols or guanidine)15-17. Recently, Kraus et al.18 introduced a method to collect, store and transport AIV samples, based on a special filter paper. FTA cards19 preserve RNA on a dry storage basis20 and render pathogens inactive upon contact21. This study showed that FTA cards can be used to detect AIV RNA in reverse-transcription PCR and that the resulting cDNA could be sequenced and virus genes and determined.
In the study of Kraus et al.18 a laboratory isolate of AIV was used, and samples were handled individually. In the extension presented here, faecal samples from wild birds from the duck trap at the Ottenby Bird Observatory (SE Sweden) were tested directly to illustrate the usefulness of the methods under field conditions. Catching of ducks and sample collection by cloacal swabs is demonstrated. The current protocol includes up-scaling of the work flow from single tube handling to a 96-well design. Although less sensitive than the traditional methods, the method of FTA cards provides an excellent supplement to large surveillance schemes. It allows collection and analysis of samples from anywhere in the world, without the need to maintaining a cool chain or safety regulations with respect to shipping of hazardous reagents, such as alcohol or guanidine.

A method to preserve, detect and sequence RNA from Avian Influenza Viruses was validated and extended using natural faecal samples from birds. This technique removes the necessity of maintaining a cool chain and handling of infectious viruses and can be applied in a 96-well high-throughput setup.

Avian Influenza Viruses (AIVs) infect many mammals, including humans1. These AIVs are diverse in their natural hosts, harboring almost all possible viral ...

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different downstream patient-to-patient transmission potentials, and require very different patient treatments. Thus, recent Zika outbreaks make it urgent to develop tools that rapidly discriminate these viruses in patients and trapped mosquitoes, to select the correct patient treatment, and to understand and manage their epidemiology in real time.
Unfortunately, current diagnostic tests, including those receiving 2016 emergency use authorizations and fast-track status, detect viral RNA by reverse transcription polymerase chain reaction (RT-PCR), which requires instrumentation, trained users, and considerable sample preparation. Thus, they must be sent to &#34;approved&#34; reference laboratories, requiring time. Indeed, in August 2016, the Center for Disease Control (CDC) was asking pregnant women who had been bitten by a mosquito and developed a Zika-indicating rash to wait an unacceptable 2 to 4 weeks before learning whether they were infected. We very much need tests that can be done on site, with few resources, and by trained but not necessarily licensed personnel.
This video demonstrates an assay that meets these specifications, working with urine or serum (for patients) or crushed mosquito carcasses (for environmental surveillance), all without much sample preparation. Mosquito carcasses are captured on paper carrying quaternary ammonium groups (Q-paper) followed by ammonia treatment to manage biohazards. These are then directly, without RNA isolation, put into assay tubes containing freeze-dried reagents that need no chain of refrigeration. A modified form of reverse transcription loop-mediated isothermal amplification with target-specific fluorescently tagged displaceable probes produces readout, in 30 min, as a three-color fluorescence signal. This is visualized with a handheld, battery-powered device with an orange filter. Forward contamination is prevented with sealed tubes, and the use of thermolabile uracil DNA glycosylase (UDG) in the presence of dUTP in the amplification mixture.

Current multiplexed diagnostics to detect Zika, chikungunya, and dengue viruses require complex sample preparation and expensive instrumentation, and are difficult to use in low resource environments. We show a diagnostic that uses isothermal amplification with target-specific strand displaceable probes to detect and differentiate these viruses with high sensitivity and specificity.

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different ...

Biochemistry

Parasite Induced Genetically Driven Autoimmune Chagas Heart Disease in the Chicken Model

The Trypanosoma cruzi acute infections acquired in infancy and childhood seem asymptomatic, but approximately one third of the chronically infected cases show Chagas disease up to three decades or later. Autoimmunity and parasite persistence are competing theories to explain the pathogenesis of Chagas disease 1, 2. To separate roles played by parasite persistence and autoimmunity in Chagas disease we inoculate the T. cruzi in the air chamber of fertilized eggs. The mature chicken immune system is a tight biological barrier against T. cruzi and the infection is eradicated upon development of its immune system by the end of the first week of growth 3. The chicks are parasite-free at hatching, but they retain integrated parasite mitochondrial kinetoplast DNA (kDNA) minicircle within their genome that are transferred to their progeny. Documentation of the kDNA minicircle integration in the chicken genome was obtained by a targeted prime TAIL-PCR, Southern hybridizations, cloning, and sequencing 3, 4. The kDNA minicircle integrations rupture open reading frames for transcription and immune system factors, phosphatase (GTPase), adenylate cyclase and phosphorylases (PKC, NF-Kappa B activator, PI-3K) associated with cell physiology, growth, and differentiation 3, 5-7, and other gene functions. Severe myocarditis due to rejection of target heart fibers by effectors cytotoxic lymphocytes is seen in the kDNA mutated chickens, showing an inflammatory cardiomyopathy similar to that seen in human Chagas disease. Notably, heart failure and skeletal muscle weakness are present in adult chickens with kDNA rupture of the dystrophin gene in chromosome 1 8. Similar genotipic alterations are associated with tissue destruction carried out by effectors CD45+, CD8&gamma;&delta;+, CD8&alpha; lymphocytes. Thus this protozoan infection can induce genetically driven autoimmune disease.

The inoculation of Trypanosoma cruzi in fertile eggs prior to incubation renders the parasite kDNA minicircle integration in embryo cells genome. Crossbreeding reveals the vertical transfer of the mutations to progeny. The kDNA integrates into coding regions at several chromosomes and the chickens die with an inflammatory autoimmune heart disease.

The Trypanosoma cruzi acute infections acquired in infancy and childhood seem asymptomatic, but approximately one third of the chronically infected cases ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. burnetii DNA in cell cultures and clinical samples. PCR requires specialized equipment and extensive end user training, and therefore, it is not suitable for routine work especially in a resource-constrained area. We have developed a loop-mediated isothermal amplification (LAMP) assay to detect the presence of C. burnetii in patient samples. This method is performed at a single temperature around 60 &#176;C in a water bath or heating block. The sensitivity of this LAMP assay is very similar to PCR with a detection limit of about 25 copies per reaction. This report describes the preparation of the reaction using lyophilized reagents and visualization of results using hydroxynaphthol blue (HNB) or a UV lamp with fluorescent intercalating dye in the reaction. The LAMP reagents were lyophilized and stored at room temperature (RT) for one month without loss of detection sensitivity. This LAMP assay is particularly robust because the reaction mixture preparation does not involve complex steps. This method is ideal for use in resource-limited settings where Q fever is endemic.

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

We described here a simple loop-mediated isothermal amplification (LAMP) method using lyophilized reagents for the detection of C. burnetii in patient samples.

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Visual Detection of Multiple Nucleic Acids in a Capillary Array

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently needed in disease diagnosis, microbial monitoring, genetically modified organism (GMO) detection, and forensic analysis. We have previously described the platform called CALM (Capillary Array-based Loop-mediated isothermal amplification for Multiplex visual detection of nucleic acids). Herein, we describe improved fabrication and performance processes for this platform. Here, we apply a small, ready-to-use cassette assembled by capillary array for multiplex visual detection of nucleic acids. The capillary array is pre-treated into a hydrophobic and hydrophilic pattern before fixing loop-mediated isothermal amplification (LAMP) primer sets in capillaries. After assembly of the loading adaptor, LAMP reaction mixture is loaded and isolated into each capillary, due to capillary force by a single pipetting step. The LAMP reactions are performed in parallel in the capillaries. The results are visually read out by illumination with a hand-held UV flashlight. Using this platform, we demonstrate monitoring of 8 frequently appearing elements and genes in GMO samples with high specificity and sensitivity. In summary, the platform described herein is intended to facilitate the detection of multiple nucleic acids. We believe it will be widely applicable in fields where high-throughput nucleic acid analysis is required.

This protocol describes the fabrication of a small, ready-to-use cassette that can be applied for visual detection of multiple nucleic acids in a single, test that is easy to operate. In this approach, a capillary array was used for multiplex and highly efficient detection of GMO targets.

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently ...

Bioengineering

High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of combining reactions together. We designed and evaluated a panel based on this principle to rapidly identify the presence of common disease agents in dogs and horses with acute respiratory illness. This manuscript describes a nanoscale diagnostic PCR workflow for sample preparation, amplification, and analysis of target pathogen sequences, focusing on procedures that are different from microliter scale reactions. In the respiratory panel presented, 18 assays were each set up in triplicate, accommodating up to 48 samples per plate. A universal extraction and pre-amplification workflow was optimized for high-throughput sample preparation to accommodate multiple matrices and DNA and RNA based pathogens. Representative data are presented for one RNA target (influenza A matrix) and one DNA target (equine herpesvirus 1). The ability to quickly and accurately test for a comprehensive, syndrome-based group of pathogens is a valuable tool for improving efficiency and ergonomics of diagnostic testing and for acute respiratory disease diagnosis and management.

High-throughput testing of DNA and RNA based pathogens by nanoscale PCR is described using a syndromic canine and equine respiratory PCR panel.

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of ...

Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Assay for the Specific and Rapid Detection of Tilapia Lake Virus

Tilapia lake virus disease (TiLVD), an emerging viral disease in tilapia caused by the tilapia lake virus (TiLV), is a persistent challenge in the aquaculture industry that has resulted in the mass morbidity and mortality of tilapia in many parts of the world. An effective, rapid, and accurate diagnostic assay for TiLV infection is therefore necessary to detect the initial infection and to prevent the spread of the disease in aquaculture farming. In this study, a highly sensitive and practical reverse transcription loop-mediated isothermal amplification (RT-LAMP) method is presented to detect tilapia lake virus in fish tissue. A comparison of the RT-qPCR and RT-LAMP assays of infected samples revealed positive results in 63 (100%) and 51 (80.95%) samples, respectively. Moreover, an analysis of uninfected samples showed that all 63 uninfected tissues yielded negative results for both the RT-qPCR and RT-LAMP assays. The cross-reactivity with five pathogens in tilapia was evaluated using RT-LAMP, and all the tests showed negative results. Both the liver and mucus samples obtained from infected fish showed comparable results using the RT-LAMP method, suggesting that mucus can be used in RT-LAMP as a nonlethal assay to avoid killing fish. In conclusion, the results demonstrated that the presented RT-LAMP assay provides an effective method for TiLV detection in tilapia tissue within 1 h. The method is therefore recommended as a screening tool on farms for the rapid diagnosis of TiLV.

Reverse Transcription Loop-Mediated Isothermal Amplification RT-LAMP Assay for the Specific and Rapid Detection of Tilapia Lake Virus

We present an RT-LAMP assay for the detection of TiLV in tilapia fish using simple instruments over a relatively short period of time compared to conventional RT-PCR techniques. This protocol may help control the epidemic spread of TiLVD, especially in developing countries.

Tilapia lake virus disease (TiLVD), an emerging viral disease in tilapia caused by the tilapia lake virus (TiLV), is a persistent challenge in the ...

Human Respiratory Bacterial Infection Diagnosis Using Isothermal Amplification

Rapid Detection of Bacterial Pathogens Causing Lower Respiratory Tract Infections via Microfluidic-Chip-Based Loop-Mediated Isothermal Amplification

Respiratory tract infections (RTIs) are among the most common problems in clinical settings. Rapid and accurate identification of bacterial pathogens will provide practical guidelines for managing and treating RTIs. This study describes a method for rapidly detecting bacterial pathogens that cause respiratory tract infections via multi-channel loop-mediated isothermal amplification (LAMP). LAMP is a sensitive and specific diagnostic tool that rapidly detects bacterial nucleic acids with high accuracy and reliability. The proposed method offers a significant advantage over traditional bacterial culturing methods, which are time-consuming and often require greater sensitivity for detecting low levels of bacterial nucleic acids. This article presents representative results of K. pneumoniae infection and its multiple co-infections using LAMP to detect samples (sputum, bronchial lavage fluid, and alveolar lavage fluid) from the lower respiratory tract. In summary, the multi-channel LAMP method provides a rapid and efficient means of identifying single and multiple bacterial pathogens in clinical samples, which can help prevent the spread of bacterial pathogens and aid in the appropriate treatment of RTIs.

Author Spotlight: Advancing Rapid Detection of Respiratory Pathogens Using Microfluidic Chip 

Various bacterial pathogens can cause respiratory tract infections and lead to serious health issues if not detected accurately and treated promptly. Rapid and accurate detection of these pathogens via&#160;loop-mediated isothermal amplification provides effective management and control of respiratory tract infections in clinical settings.

Respiratory tract infections (RTIs) are among the most common problems in clinical settings. Rapid and accurate identification of bacterial pathogens will ...

Nucleofection and In Vivo Propagation of Chicken Eimeria Parasites

Transfection is a technical process through which genetic material, such as DNA and double-stranded RNA, are delivered into cells to modify the gene of interest. Currently, transgenic technology is becoming an indispensable tool for the study of Eimeria, the causative agents of coccidiosis in poultry and livestock. This protocol provides a detailed description of stable transfection in eimerian parasites: purification and nucleofection of sporozoites or second-generation merozoites, and in vivo propagation of transfected parasites. Using this protocol, we achieved transfection in several species of Eimeria. Taken together, nucleofection is a useful tool to facilitate genetic manipulation in eimerian parasites.

Nucleofection and In Vivo Propagation of Chicken Eimeria Parasites

Here, we provided a method to achieve stable transfection of chicken Eimeria parasites by nucleofecting sporozoites or second-generation merozoites. Genetically modified eimerian parasites expressing heterologous antigenic genes could be used as vaccine delivery vehicles.

Transfection is a technical process through which genetic material, such as DNA and double-stranded RNA, are delivered into cells to modify the gene of ...

Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens

Samenvatting

Meer video's verkennen