The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.

1. תבנית הכנה הערה: כל תבנית ה- DNA הגנומי חשודה להכיל DNA נגזר מאחד משבעת המינים שEimeria להדביק תרנגולות יכולה לשמש כתבנית לזיהוי מינים מבוסס LAMP Eimeria. דגימות רקמת מעי לניתוח אבחון שדה צריכים להיות שנאספו במהלך נתיחה שלאחר המוות שגרתי כפי שמתוארים כאן. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בחר הקטע (או קטעים) של מעי להיבדק. ראה בטבלת 1 מדריך לבחירת אתר לדוגמא ומיני הסיכוי הטובים ביותר להיות נוכח 18 ואיור 1 למגוון מינים ספציפיים של הפצה ומיקומם של אתרי הדגימה Eimeria. הערה: זה הוא בעל חשיבות מרכזית מאז Eimeria הוא בעיקר אתר מארח ספציפי. כל מין שמדביק תרנגולות מוגדר על ידי אזור המעיים שמטרות 19. ההחלטה עשויה להיות מושפעת מניסיון הקודם של החווה, עניין באחד או מומחדש מיני Eimeria ספציפיים או אינדיקטורים אבחון אחרים 6. </li><li style=";text-align:right;direction:rtl"> סנטימטר בלו 5 או אורכים ארוכים יותר של סעיף המעיים (ים) שנבחר לבדיקת Eimeria באמצעות מספריים סטרילי או אזמל. לחלופין, לאחסן הדגימות לניתוח שלאחר מכן במקבע כמו למשל בRNAlater אתנול 18 או 95%. הערה: אם האחסון באתנול המדגם יש לשטוף ביסודיות בחומצה טריס-ethylenediaminetetraacetic סטרילי (TE) חיץ לפני השימוש. </li><li style=";text-align:right;direction:rtl"> חותך את המדגם הפתוח לאורך זמן, להסיר את תוכן המעיים ביותר (אם קיימים) ולגרד תאים מהשכבה הרירית חופשיים או באמצעות הקצה של שקופית מיקרוסקופ הזכוכית סטרילית או להב מספריים אתנול / להבה מעוקרת. לחלופין למדגם במאגר כולל תאים מכל ארבעת אתרי מעיים המינים ספציפיים בצינור אחד. </li><li style=";text-align:right;direction:rtl"> שים את החומר המגורד לתוך צינור microcentrifuge סטרילי 1.5 מיליליטר בורג העליון המכיל מאגר TE סטרילי 100 μl כולל 10% (w / v) Chelex 100 שרף. </li><li style=";text-align:right;direction:rtl"> נער כל דגימת מרץ 1 דקות. ודא שהחלק העליון הבורג סגור היטב ואז דגירה באמבט מים רותח למשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> לאחר הרתיחה לאפשר לכל מדגם להתקרר בטמפרטורת הסביבה במשך 1-2 דקות. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה כל דגימה באמצעות microcentrifuge במהירות שיא (לדוגמא, XG ~ 10,000) 1 דקות. </li><li style=";text-align:right;direction:rtl"> אסוף 2 μl של supernatant וכתוצאה מכך להיות תבנית בכל assay LAMP להתבצע. לחלופין, בריכה יותר מאתר אחד במעיים בצינור בודד במטרה לספק assay רב באתר. </li></ol> 2. Eimeria LAMP פריימר הכנה (Pre-assay) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן מניות פריימר Eimeria LAMP הולמות עבור 100 מבחני: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מחדש כל צבע יסוד Eimeria LAMP Lyophilised על ידי הוספת מים כיתה מולקולריות לריכוז של 100 מיקרומטר (כמפורט על ידי היצרן). אם לא צוין, לחשב את הנפח של usin מים הנדרשים בכיתה מולקולריתg המשקולות הפיזיות ומולקולריות של כל צבע יסוד. </li><li style=";text-align:right;direction:rtl"> מים כיתה מולקולרית 60 μl פיפטה לתוך צינור microcentrifuge 0.5 מיליליטר להעיף העליון נפרד לכל מיני Eimeria להיות assayed. </li><li style=";text-align:right;direction:rtl"> להוסיף פריימרים FIP, BIP, F3, B3, LF וLB הספציפי ליעד מיני Eimeria למים באמצעות הכרכים מוצגים בטבלה 2, יצירת סדרה של תערובות פריימר שבעה מינים ספציפיים. </li><li style=";text-align:right;direction:rtl"> בקצרה מערבולת לערבב פתרון פריימר, אז דופק microfuge ולהקפיא עד לרגע שימוש. </li></ol></li><li style=";text-align:right;direction:rtl"> הכן mastermix תגובת LAMP עבור כל מין Eimeria להיות assayed. להכפיל את הנפחים מוצגים בטבלה 3 במספר דוגמאות ולהוסיף שלוש עד ביקורת חיובית, שליטה שלילית וחילוף pipetting. פיפטה לתוך 0.5 או 1.5 מיליליטר להעיף עליונה צינור microcentrifuge. </li></ol> 3. Eimeria LAMP Assay <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מינים ספציפיים פיפטה 23 μl Eimeria BST DNA פולימראז / LAMP mastermix ל0.5 מיליליטר צינור microcentrifuge. </li><li style=";text-align:right;direction:rtl"> להוסיף תבנית 2 μl DNA (מוכנה בסעיף 1), מה שהופך סופי נפח תגובה של 25 μl. </li><li style=";text-align:right;direction:rtl"> להוסיף הדנ&quot;א הגנומי 2 μl Eimeria מינים ספציפי לתגובה אחת (ביקורת חיובית). מוסיף מים כיתה מולקולריים 2 μl לתגובה (שליטה שלילית). הערה: אם הדנ&quot;א הגנומי מינים ספציפיים אינו זמין LAMP החיובי קודם או מוצר PCR סטנדרטי ניתן להשתמש במקום. </li><li style=";text-align:right;direction:rtl"> דגירה באמבט מים או לחסום חום בגיל 62 o C למשך 30 דקות. לחלופין, דה-להפעיל את פולימראז BST DNA על ידי חימום עד 80 מעלות צלזיוס במשך 10 דקות אם התגובה היא לא הולכת לקרוא באופן מיידי. </li></ol> 4. LAMP Assay קריאה מתוך <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בסיומו של הדגירה להעריך את הצבע של כל תגובה על ידי עין תחת אור הפנימי. תוצאות שליליות מופיעות הוורודות לסגולות בצבע, תוצאות חיוביות מופיעות שמיים כחולים 20. </li><li style=";text-align:right;direction:rtl"> לחלופין, לאשר את תוצאת assay LAMP בLaboratאורי על ידי ערבוב מוצר תגובת LAMP 5 μl עם חיץ טעינת ג&#39;ל DNA μl 1 לג&#39;ל אלקטרופורזה agarose באמצעות ג&#39;ל agarose 2% ב 1 x טריס Borate EDTA חיץ / / (TBE), מראש מוכתם באמצעות כתם חומצות גרעין (μl 5 ל 50 מיליליטר agarose). הוסף 5 μl של סולם ה- DNA הגודל מולקולרי 1KB לנתיב 1 של הג&#39;ל לאפשר חישוב גודל שבר. </li></ol>

<ol>
	<li>Chapman, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+selective+review+of+advances+in+coccidiosis+research.">A selective review of advances in coccidiosis research.</a> Adv Parasitol. 83, 93-171 (2013).</li><li>Shirley, M. W., Smith, A. L., Tomley, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+avian+Eimeria+with+an+emphasis+on+their+control+by+vaccination.">The biology of avian Eimeria with an emphasis on their control by vaccination.</a> Adv Parasitol. 60, 285-330 (2005).</li><li>Fornace, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Occurrence+of+Eimeria+species+parasites+on+small-scale+commercial+chicken+farms+in+Africa+and+indication+of+economic+profitability.">Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability.</a> PLoS ONE. 8 (12), e84254 (2013).</li><li>Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+analysis+of+Eimeria+spp.+populations+in+relation+to+performance+levels+of+broiler+chicken+farms+in+Arkansas+and+North+Carolina.">Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina.</a> J Parasitol. 95 (4), 871-880 (2009).</li><li>Peek, H. W., Landman, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coccidiosis+in+poultry:+anticoccidial+products,+vaccines+and+other+prevention+strategies.">Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies.</a> Vet Q. 31 (3), 143-161 (2011).</li><li>Johnson, J., Reid, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anticoccidial+drugs:+lesion+scoring+techniques+in+battery+and+floor-pen+experiments+with+chickens.">Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens.</a> Exp Parasitol. 28 (1), 30-36 (1970).</li><li>Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+survey+of+the+economic+impact+of+subclinical+Eimeria+infections+in+broiler+chickens+in+Norway.">A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway.</a> Avian Pathol. 37 (3), 333-341 (2008).</li><li>Procunier, J., Fernando, M., Barta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+and+strain+differentiation+of+Eimeria+spp.+of+the+domestic+fowl+using+DNA+polymorphisms+amplified+by+arbitrary+primers.">Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers.</a> Parasitology Research. 79 (2), 98-102 (1993).</li><li>Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+diagnostic+PCR+assay+for+the+detection+and+discrimination+of+four+pathogenic+Eimeria+species+of+the+chicken.">Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken.</a> Avian Pathol. 27 (5), 490-497 (1998).</li><li>Vrba, V., Blake, D. P., Poplstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+real-time+PCR+assays+for+detection+and+quantification+of+all+seven+Eimeria+species+that+infect+the+chicken.">Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken.</a> Vet Parasitol. 174 (3-4), 183-190 (2010).</li><li>Morris, G. M., Gasser, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotechnological+advances+in+the+diagnosis+of+avian+coccidiosis+and+the+analysis+of+genetic+variation+in+Eimeria.">Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria.</a> Biotechnol Adv. 24 (6), 590-603 (2006).</li><li>Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Investing in animal health research to alleviate poverty. , (2002).</li><li>Nagamine, K., Hase, T., Notomi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accelerated+reaction+by+loop-mediated+isothermal+amplification+using+loop+primers).">Accelerated reaction by loop-mediated isothermal amplification using loop primers).</a> Mol Cell Probes. 16 (3), 223-229 (2002).</li><li>Notomi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+of+DNA.">Loop-mediated isothermal amplification of DNA.</a> Nucleic Acids Res. 28 (12), E63 (2000).</li><li>Kaneko, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+enterotoxigenic+Clostridium+perfringens+in+meat+samples+by+using+molecular+methods.">Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.</a> Appl Environ Microbiol. 77 (21), 7526-7532 (2011).</li><li>Karanis, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+preliminary+evaluation+of+a+loop-mediated+isothermal+amplification+procedure+for+sensitive+detection+of+cryptosporidium+oocysts+in+fecal+and+water+samples.">Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples.</a> Appl Environ Microbiol. 73 (17), 5660-5662 (2007).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+Infectious+bursal+disease+virus+by+reverse+transcription+loop-mediated+isothermal+amplification+assay.">Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay.</a> J Vet Diagn Invest. 21 (6), 841-843 (2009).</li><li>Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+(LAMP)+assays+for+the+species-specific+detection+of+Eimeria+that+infect+chickens.">Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.</a> BMC Vet Res. 7 (1), 67 (2011).</li><li>Long, P., Joyner, L., Millard, B., Norton, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+guide+to+laboratory+techniques+used+in+the+study+and+diagnosis+of+avian+coccidiosis.">A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis.</a> Folia Veterinaria Latina. 6 (3), 201-217 (1976).</li><li>Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colorimetric+detection+of+loop-mediated+isothermal+amplification+reaction+by+using+hydroxy+naphthol+blue.">Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue.</a> BioTechniques. 46 (3), 167-172 (2009).</li><li>Arakawa, A., Baba, E., Fukata, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+tenella+infection+enhances+Salmonella+typhimurium+infection+in+chickens.">Eimeria tenella infection enhances Salmonella typhimurium infection in chickens.</a> Poult Sci. 60 (10), 2203-2209 (1981).</li><li>Blake, D. P., Smith, A. L., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplified+fragment+length+polymorphism+analyses+of+Eimeria+spp.:+an+improved+process+for+genetic+studies+of+recombinant+parasites.">Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites.</a> Parasitol Res. 90 (6), 473-475 (2003).</li><li>Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+Campylobacter+spp.+in+chicken+fecal+samples+by+real-time+PCR.">Detection of Campylobacter spp. in chicken fecal samples by real-time PCR.</a> J Clin Microbiol. 42 (11), 5125-5132 (2004).</li><li>Raj, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR-based+quantification+of+Eimeria+genomes:+a+method+to+outweigh+underestimation+of+genome+numbers+due+to+PCR+inhibition.">Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition.</a> Avian Pathol. 42 (4), 304-308 (2013).</li><li>Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+maxima:+the+influence+of+host+genotype+on+parasite+reproduction+as+revealed+by+quantitative+real-time+PCR.">Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR.</a> Int J Parasitol. 36 (1), 97-105 (2006).</li><li>Beck, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+approaches+to+diversity+of+populations+of+apicomplexan+parasites.">Molecular approaches to diversity of populations of apicomplexan parasites.</a> Int J Parasitol. 39 (2), 175-189 (2009).</li></ol>

The authors declare that they have no competing financial interests.

The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~&#163;0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment. 
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25. 
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.

ייצור עוף עולמי גדל פי עשר במהלך 50 השנים האחרונות עם העולם המתפתח אירוח כמעט פי ארבע מההתרחבות עדים בעולם המפותח <a href="http://www.faostat.org">(www.faostat.org).</a> כרלוונטי של ייצור עוף לביטחון מזון בעולם גדל כך גם יש לו את הפרופיל של פתוגנים אשר יכול לגרום למחלה קשה בתרנגולות. דוגמה בולטת הם מיני Eimeria, טפילי protozoan בכל מקום שיכול לגרום למחל coccidiosis enteric 1. בכל מקום שתרנגולות גדלות מיני Eimeria אחד או יותר עשויים להיות נפוץ 2-4. בעולם המפותח Eimeria נשלטים בעיקר על ידי chemoprophylaxis, העסקת תוכניות הסעות או סיבוב כדי למזער את ההשפעה של התנגדות 5. חיסונים חיים משמשים גם במערכות שבן ערך ציפור מספיק כדי להצדיק את העלות (לדוגמא, גידול המניה, שכבות וכמה פטמים 5). כresult הצעדים הללו coccidiosis הקליני לעתים קרובות מבוקר היטב, אם כי הזיהום תת קליני שכיח 5. בחיסון העולם המתפתח הוא נדיר ויישום תרופה לעתים קרובות הודיע ​​פחות טוב. כתוצאה מכך coccidiosis תת-קליני והקליני הוא נפוץ יותר ומפעיל השפעה כלכלית משמעותית 3. אבחנה של זיהום eimerian הסתמכה באופן מסורתי על נגע הבקיע שלאחר מוות, למרות שאפילו מחברי מערכת הניקוד ביותר בשימוש נרחב בתגובה, כי לכמה מינים &quot;זה נראה ספק אם הליך כזה צריך להיות ניסיון בכל אבל חמור מתון זיהומים&quot; 6. ראיות משלימות יכולות להיות שנאספו באמצעות זיהוי מיקרוסקופי של שלב מחזור החיים oocyst עמיד לסביבה בדגימות צואה או המלטה, אם כי חופף מורפולוגיה יכול לבלבל כל אבל המומחה 6,7. חלופות מולקולריות באמצעות תגובת השרשרת של פולימראז (PCR), amplificatio האקראיn של צורות DNA PCR (RAPD-PCR) וטכנולוגיות PCR כמותי היה זמין לתקופה של עד 20 שנים 8-10, אך עד כה הם לא הצליחו להפוך לפופולריים. חשבון יחסית והדרישה לציוד מעבדה מומחה או עיבוד מוגבל הספיגה שלהם, למרות הטבע לעתים קרובות סובייקטיבית ותובעני מבחינה טכנית של pathology- המבוגר ומבוססת מיקרוסקופיה גישות 10,11. יכולות להיות מוגזמות מגבלות כאלה ברבים מהאזורים העניים יותר של העולם, כגון דרום מזרח אסיה, שבו ההשפעה של coccidiosis על עוני עשויה להיות גדולה יותר באופן יחסי 12. בתגובה יש ביקוש ברור לפשוט חדשים ורגיש, אך חסכוני, מבחני אבחון Eimeria מינים ספציפיים. הגברה בידוד התרמי (LAMP) בתיווך לולאה היא קל להכנת טכניקה מונע DNA פולימרז כי הוא מסוגל הגברת כמויות גדולות של DNA. והכי חשוב, LAMP משתמש polymera BST DNAse במקום פולימראז תקי DNA משמש בדרך כלל בPCR, המאפשר הגברה DNA בטמפרטורה קבועה יחידה ללא הדרישה לרכיבה על אופניים תרמיים 13,14. LAMP יכול להיות נוח ליישום באפילו המעבדה הבסיסית ביותר או בתחום. Characterised על ידי התנגדות ביחס למעכבי PCR רבים, רגישות גבוהה וספציפיות, מבחני LAMP פותחו עבור מגוון רחב של פתוגנים הכוללים וירוס מחלה מדבקת bursal, perfringens Clostridium וCryptosporidium 15-17. בתגובה לדרישה לאבחון Eimeria חסכוני מינים ספציפיים חדש פנל של מבחני LAMP ספציפיים לכל אחד משבעת המינים שEimeria להדביק תרנגולות פותח 18. בקשות למבחנים החדשים כוללות התרחשות טפיל ניטור, של ערך מסוים נתנה את הקשר בין מינים כגון מקסימום Eimeria או necatrix Eimeria עם PE הכלכלי הירודrformance 3,4. יישומים אחרים כוללים הערכת היעילות של אסטרטגית anticoccidial של החווה, אבחנה של דלקת תת קליניים או מחלה קלינית והערכה של הסיכון הנשקף Eimeria לחווה.

<table border="0" cellpadding="0" cellspacing="0" width="889">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Name</td>
			<td style="width:161px;">Company</td>
			<td style="width:139px;">Catalogue number</td>
			<td style="width:295px;">Comments</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNAlater</td>
			<td style="width:161px;">Ambion</td>
			<td style="width:139px;">AM7024</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ethanol</td>
			<td style="width:161px;">VWR Chemicals</td>
			<td style="width:139px;">20821.321</td>
			<td style="width:295px;">Caution, highly flammable</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">100 x Tris-EDTA (TE) buffer concentrate</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">T9285</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Chelex 100 resin</td>
			<td style="width:161px;">Bio-Rad</td>
			<td style="width:139px;">142-1253</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Molecular grade water</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">10977035</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTAACATTTCGCTTCACGGAC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATGAGCAAGTGGAACACCTTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TAAGGTTACACCCGTGGAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCATGCACAAAGCGACTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GGCCATCAAGTTCCATGAGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCAACCTCCTGAGTGTGGTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAACGCTCGAACATGGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CTTCTCCACAGACCCAGAGGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACTACGGAAAAGTGCGTAGCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTTCCTCCCTTCTGAAAACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAGTCACTGCTGATGTACCAAA 
			AG-GAACTATGCCGCTTTCCCCTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CAAGCCTACGCGGACATC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TTATGCAGCTGGGTCAACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACGATAGCCAAGACACGTAAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCCCGTGATAAGAGTAGGAACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCGGGTCGTGAGATTTAAATT 
			AT-GGAAGATCAGGACGGGCACT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTCAGTTGATGAACAAGCGA 
			GA-TGCGCCTCTAGAATCAAGACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCCATGCATCCCCTTGTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGTGGGCACAGATTGATTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TGGCTTTCCCGCGTACC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGGCCCAACACAAAGACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCTTGAGTTTTAAGCTATGCA 
			CA-GACCCAAGCAGCTCACCAA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCTGTAACTTGGGACGTTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAACAGCCGGAGCCTCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCCTTGTATGTTGCTGTTTCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCGCACGAATCTGAATCACAC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATCTCCTCAAAGACTTTCGCGT 
			A-GCGCTTGGCTATATCCATAGG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAATAGCATTGCCAGGTGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCCACTGTCATTAATATTGC 
			TGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTTGTGAAGGTCAGCGTG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTGAGTCCATACGTACTTCCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCACTGCTATGGAAAGTCAC 
			AC-CATAACTGGCATGCAGGGGT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTGGCCCGAAAGTTGTGAA 
			GA-CGTCAGAAATTGCTGCCCAAT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCATGTGCAGTTGAAGACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCAAATGTATCTGCTAGTTATA 
			TTAACAAG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x ThermoPol reaction buffer</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">B9004S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:295px;">MgSO4</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">M7506</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">dNTPs</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">U1330</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Betaine solution (5 M)</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">B0300</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Bst polymerase</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">M0275S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Hydroxynaphthol blue</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">33936</td>
			<td style="width:295px;">Dissolved in molecular grade water.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">UltraPure agarose</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">16500-500</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x Tris/Borate/EDTA (TBE) buffer</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">AM9863</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Blue/Orange DNA loading dye (x6)</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">G1881</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">GeneRuler 1Kb DNA ladder</td>
			<td style="width:161px;">Thermo Scientific</td>
			<td style="width:139px;">SM0313</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SafeView nucleic acid stain</td>
			<td style="width:161px;">NBS Biologicals</td>
			<td style="width:139px;">NBS-SV</td>
			<td style="width:295px;"></td>
		</tr>
	</tbody>
</table>

loop-mediated isothermal amplification (lamp) assays for the species-specific detection of eimeria that infect chickens

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm&#8217;s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

אימות assay במהלך אימות כל assay LAMP מינים ספציפיים Eimeria נבדק באמצעות פנל של דגימות DNA טהורות המייצגות את כל שבעת מיני Eimeria כי להדביק את העוף, כמו גם הדנ&quot;א הגנומי עוף כביקורת מארח. ג&#39;ל אלקטרופורזה agarose שימשה כדי לפתור כל assay והפגינה סגוליות מינים מוחלטים ללא תגובתיות צולבת מארח 18. בשלב הבא, פי עשר סדרת דילול סדרתי הוכנה באמצעות tenella Eimeria המטוהר הדנ&quot;א הגנומי חשף גבול רגישות של assay בין אחת לעשרה עותקי הגנום 18. אין גבול העליון נקבע עם תוצאות טובות שהושגו עד וכוללים הריכוז הגבוה ביותר (100,000 העותקים בגנום) 18. יישום עם דגימות שדה דגימות שנאספו לבדיקת Eimeria צפויות להיגזר מתרנגולות נמצאו מת, ונבחרים כתוצאה מpoor בריאות או שלוקט למעקב בריאות זקיף, מה שמעיד על גודל מדגם סביר של בין אחת לשלוש, כאשר חלק משגרה. בדיקת שלוש ציפורים שנאספו מחווה פטם ארה&quot;ב כחלק מתכנית מעקב הניבה שלושה סטים של דגימות מעי. ממוקד יישום של מבחני LAMP מינים ספציפיים, תוך מתן עדיף לאתרי המעיים המועדפים עבור כל מין Eimeria (טבלה 1), אפשר זיהוי חזותי של זיהום eimerian בכל ציפורים נבדק באמצעות (איור 2 א) hydroxynaphthol הכחול כאינדיקטור. הצבע שהושג עם תגובת LAMP שלילית בעת השימוש hydroxynaphthol כחולה יכול לנוע בין סגול לורוד, אבל הוא תמיד שונה מכחול מושגת על ידי תוצאה חיובית. אישור על ידי ג&#39;ל אלקטרופורזה agarose סיפק תוצאות דומות (איור 2). במהלך יישום שדה המשתמש יכול לבחור ליישם את המסך המלא נגד כל שבעת המינים, או להתמקד רק אלה מינים עדיפות כחשוב או ידוע להיות במחזור בחווה או סביבתה. הכישלון של גישות המבוססות על PCR להתבסס כאבחון להתרחשות של Eimeria מדגישה את הדרישה לפשטות בכל מבחן חדש. בעוד LAMP מציע הכנה פשוטה ועיבוד מ PCR, החובה לבחון אתרי מעיים מרובים לכל ציפור נשארה מייאשת. ייצור של מדגם יחיד במאגר ה- DNA לכל ציפור, אשר לאחר מכן ניתן לבדוק עם מבחני LAMP אחד או יותר, עשוי להיות מושך יותר. עיבוד מדגם במאגר אחד לכל ציפור, המייצג את החומר שנאסף מכל אחד מאתרי מעיים הספציפיים מתוארים בטבלה 1 ויקוו לפני הכנת DNA, לבדיקה עם כל שבעת מבחני LAMP סיפק את אותה התוצאה כמו בעת כל אתר מעיים היה מעובד בנפרד (איור 2 לעומת איור 3). <img alt="איור 1" src=&quot;/files/ftp_upload/52552/52552fig1.jpg&quot; /&gt; איור 1. אתרי דגימת מעיים לגילוי LAMP של טפילי מיני Eimeria להדביק תרנגולות. האזורים במעי הממוקדים על ידי כל מיני Eimeria מודגש על ידי הקווים בצבע, עם האתרים המועדפים של דגימה מצויינים על ידי המספר בין הקווים השחורים המקווקו (א &#39; acervulina: / 1, Brunetti הצהוב E.: / ורוד 2, מקסימום E.: כחול / 3, mitis א: / 4, necatrix הכתום E.: אדום / 5, praecox א: / ירוק 6 וtenella א: אפור / 7). <a href="https://www.jove.com/files/ftp_upload/52552/52552fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/52552/52552fig2.jpg" /> אבחון 2. מנורת איור של זיהום eimerian הלוך ושובשלוש תרנגולות מ &#39;מסחריות פטם. תגובות LAMP נפתרו באמצעות () hydroxynaphthol כחולות, שבו תגובה כחולה שמים הייתה חיובית וסגולה לתגובה הוורודה היה שלילי, וג&#39;ל אלקטרופורזה agarose (B). אתרי המעיים נדגמו כפי שמוצגים בטבלה 1 עבור כל מין טפיל. = E. acervulina, B = E. Brunetti, מא = E. מקסימום, Mi = E. mitis, N = E. necatrix, P = E. praecox וT = E. tenella. ליין 1 מכיל סולם GeneRuler 1KB DNA. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/52552/52552fig3.jpg" /> אבחון 3. מנורת איור של זיהום eimerian באמצעות נקווה דגימות משלושה עופות פטם מסחריים נפרדים. reac LAMPמשא ונפתר באמצעות כחול hydroxynaphthol, שבו תגובה כחולה שמים הייתה חיובית וסגולות לתגובה הוורודה היה שלילי. = E. acervulina, B = E. Brunetti, מא = E. מקסימום, Mi = E. mitis, N = E. necatrix, P = E. praecox וT = E. tenella. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> אתר לדוגמא </td><td> assay מיני Eimeria (סביר להניח) </td></tr><tr><td> תריסריון (D) </td><td> acervulina E., praecox E. </td></tr><tr><td> מעי ריק / מעי * (J / I) </td><td> א &#39;מקסימום, necatrix E. </td></tr><tr><td> Caeca (C) </td><td> necatrix E., tenella E. </td></tr><tr><td> מעי Terminal (TI) </td><td> Brunetti E., mitis E. </td></tr&gt; <tr><td> מדגם יקווה (P) </td><td> acervulina E., Brunetti א, א מקסימום, mitis E., necatrix E., praecox E., tenella E. </td></tr></tbody></table> טבלת 1. בחירת מעיים אזור ספציפי של מבחני מיני המועמד Eimeria. הבחירה של אזור שתדגם משתנה עבור כל מין Eimeria כפי שמודגם באיור 1. דגימות נקוו כוללות חומר שנאסף מכל ארבעת האתרים הספציפיים שאוחדו לאחר מכן להכנת DNA. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> * פריימר </td><td> ריכוז מניות (מיקרומטר) </td><td> נפח (μl) </td></tr><tr><td> מים </td><td> - </td><td> 60 </td></tr><tr><td> קדימה הפנימי פריימר (FIP) </td><td> 100 </td><td> 40 </td></tr><tr><td> אחורה פנימי פריmer (BIP) </td><td> 100 </td><td> 40 </td></tr><tr><td> קדימה החיצוני פריימר (F3) </td><td> 100 </td><td> 10 </td></tr><tr><td> אחורה החיצוני פריימר (B3) </td><td> 100 </td><td> 10 </td></tr><tr><td> לולאה קדמית (LF) </td><td> 100 </td><td> 20 </td></tr><tr><td> לולאה לאחור (LB) </td><td> 100 </td><td> 20 </td></tr><tr><td> סה&quot;כ </td><td></td><td> 200 </td></tr></tbody></table> הכנת טבלה 2. premix פריימר LAMP. הרכיבים והפרופורציות יידרשו להכין premix פריימר לLAMP. כרכים המוצגים הם עבור 100 תגובות LAMP. * זהויות פריימר כפי שמוצג בחומרים וBarkway et al (2011) 18. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td></td><td> n קונצרט כלשהו המניה </td><td> n קונצרט כלשהו התגובה האחרונה </td><td> נפח לכל תגובה (μl) </td></tr><tr><td> DDW </td><td> - </td><td> - </td><td> 10.1 </td></tr><tr><td> מאגר ThermoPol </td><td> 10 x </td><td> 1 x </td><td> 2.5 </td></tr><tr><td> 4 MgSO </td><td> 100 מ&quot;מ </td><td> 2 מ&quot;מ </td><td> 0.5 </td></tr><tr><td> תערובת פריימר * </td><td colspan="2"> טבלה 2 </td><td> 2.5 </td></tr><tr><td> dNTPs </td><td> 25 מ&quot;מ </td><td> 400 אום </td><td> 0.4 </td></tr><tr><td> Betaine </td><td> 5 M </td><td> 1 M </td><td> 5 </td></tr><tr><td> Hydroxynaphthol כחול </td><td> 3 מ&quot;מ </td><td> 120 מיקרומטר </td><td> 1 </td></tr><tr><td> פולימראז BST DNA </td><td> 8,000 U / ml </td><td> 8 U </td><td> 1 </td></tr><tr><td> סה&quot;כ </td><td></td><td></td><td> 23 </td></tr></tbody></table> הכנת לוח 3. לאםmastermix תגובת P. * Eimeria מינים ספציפיים.

Watch this Scientific Journal Video about Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens at JoVE.com

Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

Isothermal הגברה מבחני בתיווך לולאה (LAMP) לאיתור המינים ספציפי של<em&gt; Eimeria</em&gt; כי להדביק תרנגולות

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the ...

loop-mediated-isothermal-amplification-lamp-assays-for-species

Research

JoVE Journal

Immunology and Infection

Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens

26.8K Views.  Royal Veterinary College, London. Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

Video: Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in situ hybridization (FISH) for rapid culture-independent detection of Salmonella spp. Cell-charged tapes can also be placed face-down on selective agar for solid-phase enrichment prior to detection. Alternatively, low-volume liquid enrichments (liquid surface miniculture) can be performed on the surface of the tape in non-selective broth, followed by FISH and analysis via flow cytometry. To begin, sterile adhesive tape is brought into contact with fresh produce, gentle pressure is applied, and the tape is removed, physically extracting microbes present on these surfaces. Tapes are mounted sticky-side up onto glass microscope slides and the sampled cells are fixed with 10% formalin (30 min) and dehydrated using a graded ethanol series (50, 80, and 95%; 3 min each concentration). Next, cell-charged tapes are spotted with buffer containing a Salmonella-targeted DNA probe cocktail and hybridized for 15 - 30 min at 55&deg;C, followed by a brief rinse in a washing buffer to remove unbound probe. Adherent, FISH-labeled cells are then counterstained with the DNA dye 4',6-diamidino-2-phenylindole (DAPI) and results are viewed using fluorescence microscopy. For solid-phase enrichment, cell-charged tapes are placed face-down on a suitable selective agar surface and incubated to allow in situ growth of Salmonella microcolonies, followed by FISH and microscopy as described above. For liquid surface miniculture, cell-charged tapes are placed sticky side up and a silicone perfusion chamber is applied so that the tape and microscope slide form the bottom of a water-tight chamber into which a small volume (&le; 500 &mu;L) of Trypticase Soy Broth (TSB) is introduced. The inlet ports are sealed and the chambers are incubated at 35 - 37&deg;C, allowing growth-based amplification of tape-extracted microbes. Following incubation, inlet ports are unsealed, cells are detached and mixed with vigorous back and forth pipetting, harvested via centrifugation and fixed in 10% neutral buffered formalin. Finally, samples are hybridized and examined via flow cytometry to reveal the presence of Salmonella spp. As described here, our "tape-FISH" approach can provide simple and rapid sampling and detection of Salmonella on tomato surfaces. We have also used this approach for sampling other types of fresh produce, including spinach and jalape&ntilde;o peppers.

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple adhesive-tape-based approach for sampling of tomato and other fresh produce surfaces, followed by rapid whole cell detection of Salmonella using fluorescence in situ hybridization (FISH).

שילוב של הדגימה דבק קלטת מבוססי פלואורסצנטי באתרו הכלאה עבור איתור מהיר של סלמונלה על תוצרת טרייה

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below 50-75 copies/ml) is necessary to gain insight to viral dynamics and virus host interactions in patients who naturally control the infection and those who are on combination antiretroviral therapy (cART). 
Here we describe how to amplify viral genomes by single genome sequencing (the SGS protocol) 13, 19 and how to accurately quantify HIV-1 RNA in patients with low viral loads (the single-copy assay (SCA) protocol) 12, 20. 
The single-copy assay is a real-time PCR assay with sensitivity depending on the volume of plasma being assayed. If a single virus genome is detected in 7 ml of plasma, then the RNA copy number is reported to be 0.3 copies/ml. The assay has an internal control testing for the efficiency of RNA extraction, and controls for possible amplification from DNA or contamination. Patient samples are measured in triplicate.
The single-genome sequencing assay (SGS), now widely used and considered to be non-labor intensive 3, 7, 12, 14, 15,is a limiting dilution assay, in which endpoint diluted cDNA product is spread over a 96-well plate. According to a Poisson distribution, when less than 1/3 of the wells give product, there is an 80% chance of the PCR product being resultant of amplification from a single cDNA molecule. SGS has the advantage over cloning of not being subjected to resampling and not being biased by PCR-introduced recombination 19. However, the amplification success of SCA and SGS depend on primer design. Both assays were developed for HIV-1 subtype B, but can be adapted for other subtypes and other regions of the genome by changing primers, probes, and standards.

Quantifying levels of HIV-1 RNA in plasma and sequencing single HIV-1 genomes from individuals with viral loads below the limit of detection (50-75 copies/ml) is difficult. Here we describe how to extract and quantify plasma viral RNA using a real time PCR assay that reliably measures HIV-1 RNA down to 0.3 copies/ml and how to amplify viral genomes by single genome sequencing, from samples with very low viral loads.

הגברה וכימות HIV-1 RNA אצל אנשים שנדבקו ב-HIV עם המון ויראלי מתחת לגבול של זיהוי על ידי מבחני קלינית רגילה

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below ...

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

מבחני לזיהוי של antivirals הרומן נגד וירוס Bluetongue

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense against gram-negative bacterium Salmonella typhimurium. Salmonella establishes persistent infection in the intestine of C. elegans and results in early death of infected animals. A number of immunity mechanisms have been identified in C. elegans to defend against Salmonella infections. Autophagy, an evolutionarily conserved lysosomal degradation pathway, has been shown to limit the Salmonella replication in C. elegans and in mammals. Here, a protocol is described to infect C. elegans with Salmonella typhimurium, in which the worms are exposed to Salmonella for a limited time, similar to Salmonella infection in humans. Salmonella infection significantly shortens the lifespan of C. elegans. Using the essential autophagy gene bec-1 as an example, we combined this infection method with C. elegans RNAi feeding approach and showed this protocol can be used to examine the function of C. elegans host genes in defense against Salmonella infection. Since C. elegans whole genome RNAi libraries are available, this protocol makes it possible to comprehensively screen for C. elegans genes that protect against Salmonella and other intestinal pathogens using genome-wide RNAi libraries.

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

C. elegans has emerged as a new genetic model to study host-pathogen interactions. Here we describe a protocol to infect C. elegans with Salmonella typhimurium coupled with the double-strand RNAi interference technique to examine the role of host genes in defense against Salmonella infection.

פרוטוקול להדביק<em&gt; Elegans Caenorhabditis</em&gt; עם<em&gt; Typhimurium סלמונלה</em

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

מבחני ויראלי המוקדם כניסה לזיהוי והערכה של אנטי תרכובות

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Qualitative and Quantitative Assays for Detection and Characterization of Protein Antimicrobials

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods to screen for target enzymes prior to investing greater research effort and resources. The goal of this protocol is to demonstrate two complementary assays for conducting these initial evaluations. The microslide diffusion assay provides an initial or simple detection screen to enable the qualitative and rapid assessment of proteolytic activity against an array of both viable and heat-killed bacterial target substrates. As a counterpart, the increased sensitivity and reproducibility of the dye-release assay provides a quantitative platform for evaluating and comparing environmental influences affecting the hydrolytic activity of protein antimicrobials. The ability to label specific heat-killed cell culture substrates with Remazol brilliant blue R dye expands this capability to tailor the dye-release assay to characterize enzymatic activity of interest.

Here, we present protocols to rapidly screen and characterize enzymes for antimicrobial activity. The microslide diffusion assay and the dye-release assay utilize target bacterial substrates for qualitative and quantitative enzymatic activity evaluation.

מבחנים איכותיים וכמוני עבור זיהוי ואפיון של antimicrobials החלבון

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. burnetii DNA in cell cultures and clinical samples. PCR requires specialized equipment and extensive end user training, and therefore, it is not suitable for routine work especially in a resource-constrained area. We have developed a loop-mediated isothermal amplification (LAMP) assay to detect the presence of C. burnetii in patient samples. This method is performed at a single temperature around 60 &#176;C in a water bath or heating block. The sensitivity of this LAMP assay is very similar to PCR with a detection limit of about 25 copies per reaction. This report describes the preparation of the reaction using lyophilized reagents and visualization of results using hydroxynaphthol blue (HNB) or a UV lamp with fluorescent intercalating dye in the reaction. The LAMP reagents were lyophilized and stored at room temperature (RT) for one month without loss of detection sensitivity. This LAMP assay is particularly robust because the reaction mixture preparation does not involve complex steps. This method is ideal for use in resource-limited settings where Q fever is endemic.

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

We described here a simple loop-mediated isothermal amplification (LAMP) method using lyophilized reagents for the detection of C. burnetii in patient samples.

התפתחות Lyophilized Loop בתיווך ריאגנטים הגברה איזו תרמים לצורך זיהוי של<em&gt; Burnetii Coxiella</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Assays for Studying the Role of Vitronectin in Bacterial Adhesion and Serum Resistance

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin acquisition at the bacterial cell surface plays in resistance to the host immune system. Flow cytometry experiments identified human plasma vitronectin as a ligand for the bacterial receptor outer membrane protein H of Haemophilus influenzae type f. An enzyme-linked immunosorbent assay was employed to characterize the protein-protein interactions between purified recombinant protein H and vitronectin, and binding affinity was assessed using bio-layer interferometry. The biological importance of the binding of vitronectin to protein H at the bacterial cell surface in evasion of the host immune response was confirmed using a serum resistance assay with normal and vitronectin-depleted human serum. The importance of vitronectin in bacterial adherence was analyzed using glass slides with and without vitronectin coating, followed by Gram staining. Finally, bacterial adhesion to human alveolar epithelial cell monolayers was investigated. The protocols described here can be easily adapted to the study of any bacterial species of interest.

This report describes protocols for characterizing interactions between bacterial outer membrane proteins and the human complement regulator vitronectin. The protocols can be used to study the binding reactions and biological function of vitronectin in any bacterial species.

מבחני ללמוד את התפקיד של Vitronectin הידבקות חיידקים עמידות סרום

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin ...

Detection of Antibodies That Neutralize the Cellular Uptake of Enzyme Replacement Therapies with a Cell-based Assay

The administration of enzyme replacement therapies (ERTs) and other biologic therapies to patients may elicit an anti-drug immune response. The characterization of these anti-drug antibodies (ADA), especially those that may neutralize the biological activity of the drug, termed neutralizing antibodies (NAbs), is crucial in understanding the effects of these antibodies on the drug&#39;s pharmacological profile. This protocol describes a cell-based flow cytometry method to detect factors that neutralize the cellular uptake of a representative lysosomal ERT in human matrix. The protocol consists of three procedures: screening, a confirmatory step, and titer assays to detect, identify, and establish the relative level of neutralizing antibody titer in subject samples.
In this method, samples are first mixed with the fluorophore-conjugated ERT product, then incubated with cells [e.g., human T lymphocytes (Jurkat cells)] that express a cell-surface cation-independent mannose 6-phosphate receptor (CI-M6PR), and finally, analyzed with a flow cytometer. A sample without NAbs will result in the uptake of the fluorophore-conjugated ERT product via CI-M6PR, whereas, the presence of NAbs will bind to the drug and interfere with the CI-M6PR binding and uptake. The amount of the fluorophore-conjugated ERT internalized by the Jurkat cells is measured by flow cytometry and evaluated as the percentage (%) signal inhibition compared to the response obtained in the presence of a representative drug-na&#239;ve matrix. In the confirmatory step, the samples are pre-incubated with ERT-conjugated magnetic beads to deplete drug-specific factors that bind to the drug (such as NAbs) prior to an incubation with cells. Samples that screen and confirm positive for drug-specific NAbs in the assay are then serially diluted to generate an antibody titer. Semi-quantitative antibody titers may be correlated with measurements of drug safety and efficacy.

Here we present a cell-based flow cytometry method to detect neutralizing antibodies or other factors that interfere with the cellular uptake of enzyme replacement therapies in a human matrix, such as cerebral spinal fluid (CSF) or human serum.

זיהוי נוגדנים המנטרלים את קליטת סלולר הנובעים מהשימוש בתחליפי האנזים עם Assay מבוססת-תא

The administration of enzyme replacement therapies (ERTs) and other biologic therapies to patients may elicit an anti-drug immune response. The ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

פלטפורמה תפוקה גבוהה להקרנה של סלמונלה spp /שיגלה spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...