The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.

1. 템플릿 준비 주 : 닭 감염 일곱 에이 메리아 종 중 하나로부터 유도 된 DNA를 포함하는 것으로 의심 상관 게놈 DNA 템플릿 LAMP 기반 에이 메리아 종 식별을위한 주형으로 사용될 수있다. 여기에 설명 된대로 필드 진단 분석을위한 장 조직 샘플 일상 사후 동안 수집해야합니다. <ol><li> 소장의 부분 (또는 섹션)을 선택 테스트 할 수 있습니다. 샘플 사이트 선택에 대한 안내 및 샘플링 사이트의 분포와 위치의 종 - 특정 범위의 18 현재와 그림 1이 될 가능성이 가장 높은 에이 메리아 종은 표 1을 참조하십시오. 참고 : 에이 메리아는 특히 호스트 사이트 특정 때문에이 키 중요하다. 닭을 감염 각각의 종은 (19)을 대상으로 장 지역에 따라 정의된다. 결정은 하나 미주리 이전 농장의 경험, 관심에 의해 영향을받을 수있다특정 에이 메리아 종 또는 다른 진단 지표 (6) 재. </li><li> 소비세 5cm 또는 메리아 멸균 가위 또는 메스를 사용하여 테스트하기 위해 선택한 장 섹션 (들)의 긴 길이. 선택적으로, 이러한 RNAlater 18 또는 95 % 에탄올 예를 들어 같은 고정액 후속 분석을 위해 샘플을 저장합니다. 참고 : 에탄올에 샘플을 저장하는 것은 멸균 트리스 에틸렌 디아민 테트라 아세트산 철저하게 세척 할 필요가있는 경우 (TE)를 사용하기 전에 버퍼. </li><li> , 길이 방향으로 열려있는 샘플을 잘라 무료 멸균 유리 현미경 슬라이드의 가장자리 또는 에탄올 / 화염 멸균 가위 블레이드를 사용하여 점막층에서 세포를 가장 장 내용을 제거 (있는 경우) 및 긁어. 선택적으로 풀링 된 샘플에 대한 단일 관에서 종 특이 장 사이트의 네에서 세포를 포함한다. </li><li> (1) 100 ㎕를 포함한 무균 TE 완충액을 함유하는 멸균 1.5 ㎖의 스크류 - 탑 마이크로 원심 분리 튜브로 긁어 담을0 % (W / V) 100 Chelex 수지. </li><li> 1 분 동안 격렬하게 각각의 샘플을 흔들어. 상부 덮개가 단단히 닫혀 있는지 확인하고 10 분간 끓는 물에 목욕에 품어. </li><li> 끓는 후 각각의 샘플 1 ~ 2 분 동안 상온에서 냉각 할 수 있습니다. </li><li> 원심 분리기 1 분 최고 속도 (예를 들어, ~ 10,000 XG)에서 마이크로 원심을 사용하여 각 샘플. </li><li> 각 LAMP 분석에서 템플릿을 수행 할 수 상층 액 2 μl를 수집합니다. 선택적으로, 다중 사이트 분석을 제공하기 위해 하나의 튜브에 두 개 이상의 사이트를 장내 수영장. </li></ol> 2. 에이 메리아 LAMP 프라이머 준비 (사전 분석) <ol><li> (100) 분석에 적합한 에이 메리아 LAMP 프라이머 주식을 준비합니다 <ol><li> (제조자에 의해 지정) 100 μM의 농도로 분자 수준의 물을 첨가하여 각 동결 건조 에이 메리아 LAMP 프라이머를 복원합니다. 지정되지 않은 경우, 분자 수준의 물 날기 필요한 부피를 계산g 각 프라이머의 물리적 및 분자량. </li><li> 각 에이 메리아 종에 대해 별도의 0.5 ml의 플립 - 탑 마이크로 원심 튜브에 피펫 60 μL 분자 수준의 물을 분석한다. </li><li> 추가 FIP 프라이머, BIP, F3, B3, 일곱 종 특이 프라이머 믹스를 만드는 일련의 표 2에 나타내는 양을 사용하여 물에 대한 목표 에이 메리아 종 특정 LF 및 LB. </li><li> 간단히 와동 후, 프라이머 용액을 혼합하고 미세 원심 펄스 필요까지 동결. </li></ol></li><li> 각 에이 메리아 종을 분석 할 수 있도록 LAMP 반응 mastermix를 준비합니다. 샘플의 개수에 의해 표 3에 나타낸 양을 곱하고 양성 대조군과 음성 대조군 피펫 스페어 세 추가. 0.5 또는 1.5 ml의 피펫 플립 탑 microcentrifuge 관을. </li></ol> 3. 에이 메리아 LAMP 분석 <ol><li> 피펫 23 μL 에이 메리아 종 별 BST DNA 중합 효소 / LAMP는 0으로 mastermix.5 ml의 microcentrifuge 관. </li><li> 25 μL의 최종 반응 볼륨을 만들고, (섹션 1에서 제조) 2 μL의 DNA 템플릿을 추가합니다. </li><li> 하나의 반응 (양성 대조군)에 2 μL 에이 메리아 종 고유의 게놈 DNA를 추가합니다. 반응 (대조군)에 2 μL를 분자 수준의 물을 추가합니다. 주 : 종 특이 게놈 DNA를 사용할 수없는 경우 또는 이전의 긍정적 LAMP 표준 PCR 산물 대신 사용될 수있다. </li><li> 30 분 동안 62 O C 수조 또는 열차 단 부화. 반응이 즉시 판독하지 않을 경우에 선택적으로 10 분 동안 80 O C로 가온하여 BST DNA 중합 효소를 탈 활성화. </li></ol> 4. LAMP 분석 판독 <ol><li> 배양의 결론에 실내 조명 아래 눈에 의해 각 반응의 색상을 평가합니다. 부정적인 결과, 긍정적 인 결과는 하늘 (20) 청색으로 색에 보라색 분홍색으로 나타납니다. </li><li> 선택적으로, LABORAT의 LAMP 분석 결과를 확인1 X 트리스 / 붕산염 / EDTA (TBE) 버퍼에 2 % 아가 로스 겔을 이용하여 아가 로스 겔 전기 영동 한 μL DNA 겔 로딩 완충액으로 5 μL LAMP 반응 생성물을 혼합하여 모리 (5 μL 당 핵산 염색을 이용 중고 묻은 50 ㎖ 아가로 오스). 단편 크기 계산을 할 수 있도록 겔의 1 차선 1KB 분자 크기의 DNA 사다리의 5 μl를 추가합니다. </li></ol>

<ol>
	<li>Chapman, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+selective+review+of+advances+in+coccidiosis+research.">A selective review of advances in coccidiosis research.</a> Adv Parasitol. 83, 93-171 (2013).</li><li>Shirley, M. W., Smith, A. L., Tomley, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+avian+Eimeria+with+an+emphasis+on+their+control+by+vaccination.">The biology of avian Eimeria with an emphasis on their control by vaccination.</a> Adv Parasitol. 60, 285-330 (2005).</li><li>Fornace, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Occurrence+of+Eimeria+species+parasites+on+small-scale+commercial+chicken+farms+in+Africa+and+indication+of+economic+profitability.">Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability.</a> PLoS ONE. 8 (12), e84254 (2013).</li><li>Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+analysis+of+Eimeria+spp.+populations+in+relation+to+performance+levels+of+broiler+chicken+farms+in+Arkansas+and+North+Carolina.">Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina.</a> J Parasitol. 95 (4), 871-880 (2009).</li><li>Peek, H. W., Landman, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coccidiosis+in+poultry:+anticoccidial+products,+vaccines+and+other+prevention+strategies.">Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies.</a> Vet Q. 31 (3), 143-161 (2011).</li><li>Johnson, J., Reid, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anticoccidial+drugs:+lesion+scoring+techniques+in+battery+and+floor-pen+experiments+with+chickens.">Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens.</a> Exp Parasitol. 28 (1), 30-36 (1970).</li><li>Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+survey+of+the+economic+impact+of+subclinical+Eimeria+infections+in+broiler+chickens+in+Norway.">A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway.</a> Avian Pathol. 37 (3), 333-341 (2008).</li><li>Procunier, J., Fernando, M., Barta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+and+strain+differentiation+of+Eimeria+spp.+of+the+domestic+fowl+using+DNA+polymorphisms+amplified+by+arbitrary+primers.">Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers.</a> Parasitology Research. 79 (2), 98-102 (1993).</li><li>Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+diagnostic+PCR+assay+for+the+detection+and+discrimination+of+four+pathogenic+Eimeria+species+of+the+chicken.">Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken.</a> Avian Pathol. 27 (5), 490-497 (1998).</li><li>Vrba, V., Blake, D. P., Poplstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+real-time+PCR+assays+for+detection+and+quantification+of+all+seven+Eimeria+species+that+infect+the+chicken.">Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken.</a> Vet Parasitol. 174 (3-4), 183-190 (2010).</li><li>Morris, G. M., Gasser, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotechnological+advances+in+the+diagnosis+of+avian+coccidiosis+and+the+analysis+of+genetic+variation+in+Eimeria.">Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria.</a> Biotechnol Adv. 24 (6), 590-603 (2006).</li><li>Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Investing in animal health research to alleviate poverty. , (2002).</li><li>Nagamine, K., Hase, T., Notomi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accelerated+reaction+by+loop-mediated+isothermal+amplification+using+loop+primers).">Accelerated reaction by loop-mediated isothermal amplification using loop primers).</a> Mol Cell Probes. 16 (3), 223-229 (2002).</li><li>Notomi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+of+DNA.">Loop-mediated isothermal amplification of DNA.</a> Nucleic Acids Res. 28 (12), E63 (2000).</li><li>Kaneko, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+enterotoxigenic+Clostridium+perfringens+in+meat+samples+by+using+molecular+methods.">Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.</a> Appl Environ Microbiol. 77 (21), 7526-7532 (2011).</li><li>Karanis, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+preliminary+evaluation+of+a+loop-mediated+isothermal+amplification+procedure+for+sensitive+detection+of+cryptosporidium+oocysts+in+fecal+and+water+samples.">Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples.</a> Appl Environ Microbiol. 73 (17), 5660-5662 (2007).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+Infectious+bursal+disease+virus+by+reverse+transcription+loop-mediated+isothermal+amplification+assay.">Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay.</a> J Vet Diagn Invest. 21 (6), 841-843 (2009).</li><li>Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+(LAMP)+assays+for+the+species-specific+detection+of+Eimeria+that+infect+chickens.">Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.</a> BMC Vet Res. 7 (1), 67 (2011).</li><li>Long, P., Joyner, L., Millard, B., Norton, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+guide+to+laboratory+techniques+used+in+the+study+and+diagnosis+of+avian+coccidiosis.">A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis.</a> Folia Veterinaria Latina. 6 (3), 201-217 (1976).</li><li>Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colorimetric+detection+of+loop-mediated+isothermal+amplification+reaction+by+using+hydroxy+naphthol+blue.">Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue.</a> BioTechniques. 46 (3), 167-172 (2009).</li><li>Arakawa, A., Baba, E., Fukata, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+tenella+infection+enhances+Salmonella+typhimurium+infection+in+chickens.">Eimeria tenella infection enhances Salmonella typhimurium infection in chickens.</a> Poult Sci. 60 (10), 2203-2209 (1981).</li><li>Blake, D. P., Smith, A. L., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplified+fragment+length+polymorphism+analyses+of+Eimeria+spp.:+an+improved+process+for+genetic+studies+of+recombinant+parasites.">Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites.</a> Parasitol Res. 90 (6), 473-475 (2003).</li><li>Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+Campylobacter+spp.+in+chicken+fecal+samples+by+real-time+PCR.">Detection of Campylobacter spp. in chicken fecal samples by real-time PCR.</a> J Clin Microbiol. 42 (11), 5125-5132 (2004).</li><li>Raj, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR-based+quantification+of+Eimeria+genomes:+a+method+to+outweigh+underestimation+of+genome+numbers+due+to+PCR+inhibition.">Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition.</a> Avian Pathol. 42 (4), 304-308 (2013).</li><li>Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+maxima:+the+influence+of+host+genotype+on+parasite+reproduction+as+revealed+by+quantitative+real-time+PCR.">Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR.</a> Int J Parasitol. 36 (1), 97-105 (2006).</li><li>Beck, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+approaches+to+diversity+of+populations+of+apicomplexan+parasites.">Molecular approaches to diversity of populations of apicomplexan parasites.</a> Int J Parasitol. 39 (2), 175-189 (2009).</li></ol>

The authors declare that they have no competing financial interests.

The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~&#163;0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment. 
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25. 
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.

글로벌 닭고기 생산은 개발 도상국이 선진국에서 목격 거의 4 배 확장 호스팅으로 10 배 이상 지난 50 년간 증가했다 <a href="http://www.faostat.org">(www.faostat.org을)</a> . 세계 식량 안보에 닭 생산의 관련성이 성장함에 따라 너무 너무 닭에 심각한 질병을 일으킬 수있는 병원체의 프로필을 가지고있다. 하나의 좋은 예는 장 질환 콕시듐증 일이 발생할 수 있습니다 에이 메리아 종, 유비쿼터스 원생 동물 기생충이다. 닭이 사육되는 곳마다 하나 이상의 에이 메리아 종은 2-4 일반적인 될 가능성이 있습니다. 선진국 에이 메리아 주로 저항 (5)의 영향을 최소화하기 위해 셔틀을 회전하거나 프로그램을 이용, 화학 요법에 의해 제어된다. 라이브 백신은 또한 새 값 비용을 정당화하기에 충분한 시스템에 사용된다 (예를 들면, 사진, 층 및 일부 육계 사육 5). resu으로임상 콕시듐증은 종종 잘 제어 이러한 조치의 LT, 준 임상 적 감염이 5 일반적인 않는다. 개발 도상국의 예방 접종에 드문 약물 응용 프로그램은 자주 덜 알렸다. 결과적으로 서브 임상 및 임상 콕시듐증은 더 일반적이고 중요한 경제적 영향 (3)을 발휘한다. 가장 널리 사용되는 채점 시스템의 경우에도 저자가 어떤 종은 &quot;이 같은 절차는 어떤하지만 중등도 감염을 시도할지 여부를 의심 보인다&quot;고 댓글을 달았하지만 eimerian 감염의 진단은 전통적으로 사후 득점 병변에 의존하고있다 (6). 형태 겹치는 전문가 6,7 제외한 모든 혼동 할 수 있지만 보충 증거, 배설물이나 쓰레기 샘플 환경에 강한 oocyst 수명주기 단계의 미세한 감지를 통해 수집 할 수 있습니다. 중합 효소 연쇄 반응을 이용하여 분자 대안 (PCR), 랜덤 amplificatio다형성 DNA PCR (RAPD-PCR) 및 정량 PCR 기술의 n은 최대 20 년 8 ~ 10 사용할 수 있었지만, 지금까지 그들은 인기를 끌고 못했다. 상대 비용과 전문 실험실 장비 또는 처리에 대한 요구 사항은 종종 주관적이고 기술적으로 까다로운 이전 pathology-의 자연과 현미경 기반이 10,11 접근에도 불구하고, 자신의 흡수를 제한했다. 이러한 제한은 빈곤에 콕시듐증의 영향 (12) 비례 적으로 더 클 수있다 등 동남 아시아 등 세계의 가난한 지역의 많은 과장 될 수있다. 응답하여, 에이 메리아 종 특이 진단법 및 신규 간단 민감하지만, 비용 효과에 대한 명백한 요구되고있다. 루프 - 매개 등온 증폭 (LAMP)는 다량의 DNA를 증폭 할 수있는 DNA 폴리머 라 구동 기술을 조제 쉽다. 가장 중요한 것은, LAMP는 BST의 DNA 폴리머 a를 사용SE 대신 13,14 열 사이클에 대한 요구없이 단일의 일정한 온도에서 DNA 증폭을 용이하게 통상적으로 사용 된 PCR의 Taq DNA 중합 효소. LAMP는 가장 기본적인 실험실에서 또는 현장에서 적용 할 의무가있다. 많은 PCR 억제제, 높은 감도 및 특이성에 대하여 저항 특징 인, LAMP 세이 감염성 점액낭 질환 바이러스, 및 클로스 트리 디움 퍼프 린 젠스 15-17 포자충 등 병원균의 광범위한 개발되었다. 응답에서 닭을 감염 일곱 에이 메리아 종의 각 특정 LAMP 분석의 패널 (18)을 개발 한 새로운 비용 효율적인 에이 메리아 종 별 진단 요구하는. 새로운 분석을위한 응용 프로그램은 가난한 경제 PE와 에이 메리아의 최대 또는 메리아의 necatrix으로 종의 관계를 주어진 특정 값의 모니터링 기생충 발생을 포함3,4 rformance. 다른 응용 프로그램은 농장의 항 콕시듐 전략, 준 임상 적 감염이나 임상 적 질환과 농장에 메리아로 인한 위험의 평가 진단의 효능을 평가하는 것을 포함한다.

<table border="0" cellpadding="0" cellspacing="0" width="889">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Name</td>
			<td style="width:161px;">Company</td>
			<td style="width:139px;">Catalogue number</td>
			<td style="width:295px;">Comments</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNAlater</td>
			<td style="width:161px;">Ambion</td>
			<td style="width:139px;">AM7024</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ethanol</td>
			<td style="width:161px;">VWR Chemicals</td>
			<td style="width:139px;">20821.321</td>
			<td style="width:295px;">Caution, highly flammable</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">100 x Tris-EDTA (TE) buffer concentrate</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">T9285</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Chelex 100 resin</td>
			<td style="width:161px;">Bio-Rad</td>
			<td style="width:139px;">142-1253</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Molecular grade water</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">10977035</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTAACATTTCGCTTCACGGAC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATGAGCAAGTGGAACACCTTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TAAGGTTACACCCGTGGAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCATGCACAAAGCGACTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GGCCATCAAGTTCCATGAGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCAACCTCCTGAGTGTGGTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAACGCTCGAACATGGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CTTCTCCACAGACCCAGAGGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACTACGGAAAAGTGCGTAGCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTTCCTCCCTTCTGAAAACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAGTCACTGCTGATGTACCAAA 
			AG-GAACTATGCCGCTTTCCCCTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CAAGCCTACGCGGACATC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TTATGCAGCTGGGTCAACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACGATAGCCAAGACACGTAAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCCCGTGATAAGAGTAGGAACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCGGGTCGTGAGATTTAAATT 
			AT-GGAAGATCAGGACGGGCACT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTCAGTTGATGAACAAGCGA 
			GA-TGCGCCTCTAGAATCAAGACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCCATGCATCCCCTTGTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGTGGGCACAGATTGATTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TGGCTTTCCCGCGTACC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGGCCCAACACAAAGACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCTTGAGTTTTAAGCTATGCA 
			CA-GACCCAAGCAGCTCACCAA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCTGTAACTTGGGACGTTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAACAGCCGGAGCCTCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCCTTGTATGTTGCTGTTTCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCGCACGAATCTGAATCACAC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATCTCCTCAAAGACTTTCGCGT 
			A-GCGCTTGGCTATATCCATAGG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAATAGCATTGCCAGGTGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCCACTGTCATTAATATTGC 
			TGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTTGTGAAGGTCAGCGTG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTGAGTCCATACGTACTTCCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCACTGCTATGGAAAGTCAC 
			AC-CATAACTGGCATGCAGGGGT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTGGCCCGAAAGTTGTGAA 
			GA-CGTCAGAAATTGCTGCCCAAT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCATGTGCAGTTGAAGACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCAAATGTATCTGCTAGTTATA 
			TTAACAAG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x ThermoPol reaction buffer</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">B9004S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:295px;">MgSO4</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">M7506</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">dNTPs</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">U1330</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Betaine solution (5 M)</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">B0300</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Bst polymerase</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">M0275S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Hydroxynaphthol blue</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">33936</td>
			<td style="width:295px;">Dissolved in molecular grade water.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">UltraPure agarose</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">16500-500</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x Tris/Borate/EDTA (TBE) buffer</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">AM9863</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Blue/Orange DNA loading dye (x6)</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">G1881</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">GeneRuler 1Kb DNA ladder</td>
			<td style="width:161px;">Thermo Scientific</td>
			<td style="width:139px;">SM0313</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SafeView nucleic acid stain</td>
			<td style="width:161px;">NBS Biologicals</td>
			<td style="width:139px;">NBS-SV</td>
			<td style="width:295px;"></td>
		</tr>
	</tbody>
</table>

loop-mediated isothermal amplification (lamp) assays for the species-specific detection of eimeria that infect chickens

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm&#8217;s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

분석 검증 검증 동안 각 에이 메리아 종 특이 LAMP 분석은 호스트 제어로서 닭뿐만 아니라, 닭 게놈 DNA를 감염 일곱 에이 메리아 종을 나타내는 순수한 DNA 샘플의 패널을 사용하여 시험 하였다. 아가로 오스 겔 전기 영동은 각각의 분석을 해결하는 데 사용없이 호스트 교차 반응 (18)와 절대 종 특이성을 입증했다. 다음에, 10 배 일련 희석 시리즈 게놈 DNA는 하나 내지 열 게놈 사본 (18)의 분석 감도 한계를 공개 정제 에이 메리아 tenella를 사용하여 제조. 상한은 최고 농도 (100,000 게놈 부) (18)를 포함한 포지티브까지 달성 결과로 결정되지 않았다. 필드 샘플 응용 프로그램 에이 메리아 시험용 샘플을 수집 (p)의 결과로서 추려, 죽은 닭으로부터 유래 될 가능성OOR 건강 또는 하나 사이에 세 가지의 가능성이 표본의 크기를 나타내는, 감시 건강 감시 학살 할 때 루틴의 일부. 감시 프로그램의 일환으로 미국의 육계 농장에서 수집 한 세 마리의 새를 테스트하는 것은 장 샘플 3 세트 얻었다. 각 에이 메리아 종 (표 1)에 대한 선호 장 사이트를 우선 순위, 종 특이 LAMP 분석의 응용 프로그램을 대상으로 한 지표로 블루 hydroxynaphthol (그림 2A)를 사용하여 테스트 한 모든 조류에 eimerian 감염의 시각적 식별을 허용했다. hydroxynaphthol 블루를 사용하는 경우 음의 LAMP 반응을 달성 색상은 핑크 보라색에 이르기까지 다양하지만, 항상 긍정적 인 결과에 의해 달성 푸른 구별된다 할 수 있습니다. 아가로 오스 겔 전기 영동으로 확인이 비교 결과 (그림 2B)를 제공했다. 현장 적용시 사용자는 일곱 종에 대해 전체 화면을 적용하도록 선택하거나 같은 우선 순위 만 종을 대상으로 할 수있다중요하거나 알려진 농장에서 순환 또는 주변 지역합니다. 에이 메리아의 발생이 새로운 테스트의 편의를 위해 요구 사항을 강조위한 PCR 기반 접근 방식의 고장 진단으로 설립 될 수 있습니다. LAMP는 PCR보다 간단 준비와 처리를 제공하지만, 조류 당 여러 장 사이트를 테스트 할 수있는 요구 사항은 실망 남아있다. 하나 이상의 LAMP 분석법으로 테스트 할 수있는 조류 당 단일 풀링 된 DNA 시료의 생산은 더 매력적이 될 가능성이 높다. 각 장 사이트가 개별적으로 처리했을 때와 동일한 결과 (도 2 일곱 LAMP 분석법으로 시험을 위해, 표 1에 기재된 DNA 준비 전에 풀링 특정 장내 사이트들 각각으로부터 수집 된 물질을 나타내는 조류 하나씩 풀링 된 샘플을 제공 처리 ) 그림 3과 비교. <img alt="그림 1" src=&quot;/files/ftp_upload/52552/52552fig1.jpg&quot;/&gt; 닭을 감염 에이 메리아 종 기생충의 LAMP 감지 그림 1. 장내 샘플링 사이트는. 각 에이 메리아 종의 대상이 장 영역은 E. (점선 검은 선 사이의 숫자로 표시 샘플링 선호하는 사이트와, 색 선으로 강조 acervulina : 노랑 / 1, E.의 브루 네티 : 핑크 / 2, E. 최대 값 : 블루 / 3, E. mitis가 각각 1 주 씩으로 : 레드 / 5, E.의 praecox : 오렌지 / 4, E.의 necatrix 녹색 / 6 E. tenella를 : 회색 / 7). <a href="https://www.jove.com/files/ftp_upload/52552/52552fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/52552/52552fig2.jpg" /> eimerian 감염의 그림 2. 램프 진단 이리저리푸른 하늘 반응은 긍정적이었다 핑크 반응에 보라색이 부정적이고, (B) 아가로 오스 겔 전기 영동 경우 m 세 상업 육계. LAMP 반응은, (A)를 사용하여 블루 hydroxynaphthol 해결. 샘플링 사이트는 장내 기생충 각 종 표 1에 나타내었다. A = E. acervulina, B = E. 브루 네티, 엄마 = E. 최대, 미 = E. mitis가 각각 1 주 씩으로, N = E. necatrix, P = E. praecox 및 T = E. 돌 가사리. 레인 1 GeneRuler 1KB DNA 사다리가 포함되어 있습니다. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/52552/52552fig3.jpg" /> eimerian 감염의 그림 3. 램프 진단은 세 개의 분리 된 상업 육계에서 샘플을 풀링 사용. 램프 REAC을TIONS는 하늘색 반응은 긍정적이었다 핑크 반응에 보라색이 부정적 hydroxynaphthol 파란색을 사용하여 해결. A = E. acervulina, B = E. 브루 네티, 엄마 = E. 최대, 미 = E. mitis가 각각 1 주 씩으로, N = E. necatrix, P = E. praecox 및 T = E. 돌 가사리. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 샘플 사이트 </td><td> 에이 메리아 종 분석 (대부분) </td></tr><tr><td> 십이지장 (D) </td><td> E.의 acervulina, E.의 praecox </td></tr><tr><td> 공장 / 회장의 * (J / I) </td><td> E. 최대, E.의 necatrix </td></tr><tr><td> Caeca (C) </td><td> E.의 necatrix, E. tenella를 </td></tr><tr><td> 터미널 회장 (TI) </td><td> E.의 브루 네티, E. mitis가 각각 1 주 씩으로 </td></tR&gt; <tr><td> 풀링 된 샘플 (P) </td><td> E.의 acervulina, E.의 브루 네티, E. 최대, E. mitis가 각각 1 주 씩으로, E.의 necatrix, E.의 praecox, E. tenella를 </td></tr></tbody></table> 후보 에이 메리아 종 분석 표 1. 장내 영역 별 선택. 지역의 선택은 그림 1에 도시 된 바와 같이 각각의 에이 메리아 종에 따라 다릅니다 샘플링합니다. 풀링 된 샘플은 다음 DNA의 준비를 위해 결합 된 네 개의 특정 사이트에서 수집 된 자료를 포함한다. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 프라이머 * </td><td> 주식 농도 (μM) </td><td> 볼륨 (μL) </td></tr><tr><td> 물 </td><td> - </td><td> (60) </td></tr><tr><td> 앞으로 내부 프라이머 (FIP) </td><td> (100) </td><td> (40) </td></tr><tr><td> 이전 버전과의 내부 PRI의메르 (BIP) </td><td> (100) </td><td> (40) </td></tr><tr><td> 앞으로 외부 프라이머 (F3) </td><td> (100) </td><td> (10) </td></tr><tr><td> 이전 버전과의 외부 프라이머 (B3) </td><td> (100) </td><td> (10) </td></tr><tr><td> 루프 전달 (LF) </td><td> (100) </td><td> (20) </td></tr><tr><td> 이전 버전과의 루프 (LB) </td><td> (100) </td><td> (20) </td></tr><tr><td> 합계 </td><td></td><td> (200) </td></tr></tbody></table> LAMP 프라이머 프리믹스 표 2. 준비. LAMP의 프라이머 프리믹스를 준비하는 데 필요한 구성 요소와 비율. 표시된 볼륨은 100 LAMP 반응에 대한 것입니다. * 자료에 도시 된 바와 같이 프라이머의 정체성 Barkway 등 (2011) 18. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> 주식 진한 없음 </td><td> 최종 반응 진한 없음 </td><td> 반응 당 볼륨 (μL) </td></tr><tr><td> DDW </td><td> - </td><td> - </td><td> 10.1 </td></tr><tr><td> ThermoPol 버퍼 </td><td> 10 × </td><td> 1 개 </td><td> 2.5 </td></tr><tr><td> 황산 </td><td> 100 mM의 </td><td> 2 mM의 </td><td> 0.5 </td></tr><tr><td> 프라이머 믹스 * </td><td colspan="2"> 표 2 </td><td> 2.5 </td></tr><tr><td> 의 dNTPs </td><td> 25 mM의 </td><td> 400 μM의 </td><td> 0.4 </td></tr><tr><td> 베타 </td><td> 5 M </td><td> 1 M </td><td> (5) </td></tr><tr><td> Hydroxynaphthol 블루 </td><td> 3 mM의 </td><td> 120 μM </td><td> (1) </td></tr><tr><td> BST DNA 중합 효소 </td><td> 8000 U / ㎖ </td><td> 8 U </td><td> (1) </td></tr><tr><td> 합계 </td><td></td><td></td><td> (23) </td></tr></tbody></table> LAM 표 3. 준비P 반응 mastermix. * 에이 메리아 종 특이.

Watch this Scientific Journal Video about Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens at JoVE.com

Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

의 종 특이 검출을위한 루프 - 매개 등온 증폭 (LAMP) 분석 실험<em&gt; 에이 메리아</em&gt; 닭을 감염이

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the ...

loop-mediated-isothermal-amplification-lamp-assays-for-species

Research

JoVE Journal

Immunology and Infection

Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens

26.9K 조회수.  Royal Veterinary College, London. Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

비디오: Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in situ hybridization (FISH) for rapid culture-independent detection of Salmonella spp. Cell-charged tapes can also be placed face-down on selective agar for solid-phase enrichment prior to detection. Alternatively, low-volume liquid enrichments (liquid surface miniculture) can be performed on the surface of the tape in non-selective broth, followed by FISH and analysis via flow cytometry. To begin, sterile adhesive tape is brought into contact with fresh produce, gentle pressure is applied, and the tape is removed, physically extracting microbes present on these surfaces. Tapes are mounted sticky-side up onto glass microscope slides and the sampled cells are fixed with 10% formalin (30 min) and dehydrated using a graded ethanol series (50, 80, and 95%; 3 min each concentration). Next, cell-charged tapes are spotted with buffer containing a Salmonella-targeted DNA probe cocktail and hybridized for 15 - 30 min at 55&deg;C, followed by a brief rinse in a washing buffer to remove unbound probe. Adherent, FISH-labeled cells are then counterstained with the DNA dye 4',6-diamidino-2-phenylindole (DAPI) and results are viewed using fluorescence microscopy. For solid-phase enrichment, cell-charged tapes are placed face-down on a suitable selective agar surface and incubated to allow in situ growth of Salmonella microcolonies, followed by FISH and microscopy as described above. For liquid surface miniculture, cell-charged tapes are placed sticky side up and a silicone perfusion chamber is applied so that the tape and microscope slide form the bottom of a water-tight chamber into which a small volume (&le; 500 &mu;L) of Trypticase Soy Broth (TSB) is introduced. The inlet ports are sealed and the chambers are incubated at 35 - 37&deg;C, allowing growth-based amplification of tape-extracted microbes. Following incubation, inlet ports are unsealed, cells are detached and mixed with vigorous back and forth pipetting, harvested via centrifugation and fixed in 10% neutral buffered formalin. Finally, samples are hybridized and examined via flow cytometry to reveal the presence of Salmonella spp. As described here, our "tape-FISH" approach can provide simple and rapid sampling and detection of Salmonella on tomato surfaces. We have also used this approach for sampling other types of fresh produce, including spinach and jalape&ntilde;o peppers.

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple adhesive-tape-based approach for sampling of tomato and other fresh produce surfaces, followed by rapid whole cell detection of Salmonella using fluorescence in situ hybridization (FISH).

접착제 테이프 기반의 샘플링 및 형광의 조합 현장에서</em의 신속한 감지를 위해> 하이브 리다이 제이션 살모넬라균 신선한 농산물에 대한

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

연구

면역학 및 감염병학

Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below 50-75 copies/ml) is necessary to gain insight to viral dynamics and virus host interactions in patients who naturally control the infection and those who are on combination antiretroviral therapy (cART). 
Here we describe how to amplify viral genomes by single genome sequencing (the SGS protocol) 13, 19 and how to accurately quantify HIV-1 RNA in patients with low viral loads (the single-copy assay (SCA) protocol) 12, 20. 
The single-copy assay is a real-time PCR assay with sensitivity depending on the volume of plasma being assayed. If a single virus genome is detected in 7 ml of plasma, then the RNA copy number is reported to be 0.3 copies/ml. The assay has an internal control testing for the efficiency of RNA extraction, and controls for possible amplification from DNA or contamination. Patient samples are measured in triplicate.
The single-genome sequencing assay (SGS), now widely used and considered to be non-labor intensive 3, 7, 12, 14, 15,is a limiting dilution assay, in which endpoint diluted cDNA product is spread over a 96-well plate. According to a Poisson distribution, when less than 1/3 of the wells give product, there is an 80% chance of the PCR product being resultant of amplification from a single cDNA molecule. SGS has the advantage over cloning of not being subjected to resampling and not being biased by PCR-introduced recombination 19. However, the amplification success of SCA and SGS depend on primer design. Both assays were developed for HIV-1 subtype B, but can be adapted for other subtypes and other regions of the genome by changing primers, probes, and standards.

Quantifying levels of HIV-1 RNA in plasma and sequencing single HIV-1 genomes from individuals with viral loads below the limit of detection (50-75 copies/ml) is difficult. Here we describe how to extract and quantify plasma viral RNA using a real time PCR assay that reliably measures HIV-1 RNA down to 0.3 copies/ml and how to amplify viral genomes by single genome sequencing, from samples with very low viral loads.

표준 임상 Assays에 의해 탐지의 한도 이하 바이러스성로드와 HIV 감염된 개인의 확장 및 HIV - 1 RNA를 Quantifying

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below ...

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

Bluetongue 바이러스에 대한 항 바이러스제 소설의 식별에 대한 분석

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense against gram-negative bacterium Salmonella typhimurium. Salmonella establishes persistent infection in the intestine of C. elegans and results in early death of infected animals. A number of immunity mechanisms have been identified in C. elegans to defend against Salmonella infections. Autophagy, an evolutionarily conserved lysosomal degradation pathway, has been shown to limit the Salmonella replication in C. elegans and in mammals. Here, a protocol is described to infect C. elegans with Salmonella typhimurium, in which the worms are exposed to Salmonella for a limited time, similar to Salmonella infection in humans. Salmonella infection significantly shortens the lifespan of C. elegans. Using the essential autophagy gene bec-1 as an example, we combined this infection method with C. elegans RNAi feeding approach and showed this protocol can be used to examine the function of C. elegans host genes in defense against Salmonella infection. Since C. elegans whole genome RNAi libraries are available, this protocol makes it possible to comprehensively screen for C. elegans genes that protect against Salmonella and other intestinal pathogens using genome-wide RNAi libraries.

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

C. elegans has emerged as a new genetic model to study host-pathogen interactions. Here we describe a protocol to infect C. elegans with Salmonella typhimurium coupled with the double-strand RNAi interference technique to examine the role of host genes in defense against Salmonella infection.

감염 프로토콜<em&gt; 예쁜 꼬마 선충</em&gt;와<em&gt; 살모넬라 티피 뮤 리움 (Salmonella typhimurium)</em

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

초기 바이러스 성 항목 식별을위한 분석 실험 및 항 바이러스 화합물의 평가

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Qualitative and Quantitative Assays for Detection and Characterization of Protein Antimicrobials

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods to screen for target enzymes prior to investing greater research effort and resources. The goal of this protocol is to demonstrate two complementary assays for conducting these initial evaluations. The microslide diffusion assay provides an initial or simple detection screen to enable the qualitative and rapid assessment of proteolytic activity against an array of both viable and heat-killed bacterial target substrates. As a counterpart, the increased sensitivity and reproducibility of the dye-release assay provides a quantitative platform for evaluating and comparing environmental influences affecting the hydrolytic activity of protein antimicrobials. The ability to label specific heat-killed cell culture substrates with Remazol brilliant blue R dye expands this capability to tailor the dye-release assay to characterize enzymatic activity of interest.

Here, we present protocols to rapidly screen and characterize enzymes for antimicrobial activity. The microslide diffusion assay and the dye-release assay utilize target bacterial substrates for qualitative and quantitative enzymatic activity evaluation.

정성 및 정량 검출을위한 시험 법 및 단백질 항생제 특성

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. burnetii DNA in cell cultures and clinical samples. PCR requires specialized equipment and extensive end user training, and therefore, it is not suitable for routine work especially in a resource-constrained area. We have developed a loop-mediated isothermal amplification (LAMP) assay to detect the presence of C. burnetii in patient samples. This method is performed at a single temperature around 60 &#176;C in a water bath or heating block. The sensitivity of this LAMP assay is very similar to PCR with a detection limit of about 25 copies per reaction. This report describes the preparation of the reaction using lyophilized reagents and visualization of results using hydroxynaphthol blue (HNB) or a UV lamp with fluorescent intercalating dye in the reaction. The LAMP reagents were lyophilized and stored at room temperature (RT) for one month without loss of detection sensitivity. This LAMP assay is particularly robust because the reaction mixture preparation does not involve complex steps. This method is ideal for use in resource-limited settings where Q fever is endemic.

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

We described here a simple loop-mediated isothermal amplification (LAMP) method using lyophilized reagents for the detection of C. burnetii in patient samples.

의 탐지를위한 동결 건조 루프 - 매개 등온 증폭 시약의 개발<em&gt; Coxiella burnetii의</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Assays for Studying the Role of Vitronectin in Bacterial Adhesion and Serum Resistance

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin acquisition at the bacterial cell surface plays in resistance to the host immune system. Flow cytometry experiments identified human plasma vitronectin as a ligand for the bacterial receptor outer membrane protein H of Haemophilus influenzae type f. An enzyme-linked immunosorbent assay was employed to characterize the protein-protein interactions between purified recombinant protein H and vitronectin, and binding affinity was assessed using bio-layer interferometry. The biological importance of the binding of vitronectin to protein H at the bacterial cell surface in evasion of the host immune response was confirmed using a serum resistance assay with normal and vitronectin-depleted human serum. The importance of vitronectin in bacterial adherence was analyzed using glass slides with and without vitronectin coating, followed by Gram staining. Finally, bacterial adhesion to human alveolar epithelial cell monolayers was investigated. The protocols described here can be easily adapted to the study of any bacterial species of interest.

This report describes protocols for characterizing interactions between bacterial outer membrane proteins and the human complement regulator vitronectin. The protocols can be used to study the binding reactions and biological function of vitronectin in any bacterial species.

세균성 접착 및 혈 청 저항에 Vitronectin의 역할을 공부에 대 한 분석

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin ...

Detection of Antibodies That Neutralize the Cellular Uptake of Enzyme Replacement Therapies with a Cell-based Assay

The administration of enzyme replacement therapies (ERTs) and other biologic therapies to patients may elicit an anti-drug immune response. The characterization of these anti-drug antibodies (ADA), especially those that may neutralize the biological activity of the drug, termed neutralizing antibodies (NAbs), is crucial in understanding the effects of these antibodies on the drug&#39;s pharmacological profile. This protocol describes a cell-based flow cytometry method to detect factors that neutralize the cellular uptake of a representative lysosomal ERT in human matrix. The protocol consists of three procedures: screening, a confirmatory step, and titer assays to detect, identify, and establish the relative level of neutralizing antibody titer in subject samples.
In this method, samples are first mixed with the fluorophore-conjugated ERT product, then incubated with cells [e.g., human T lymphocytes (Jurkat cells)] that express a cell-surface cation-independent mannose 6-phosphate receptor (CI-M6PR), and finally, analyzed with a flow cytometer. A sample without NAbs will result in the uptake of the fluorophore-conjugated ERT product via CI-M6PR, whereas, the presence of NAbs will bind to the drug and interfere with the CI-M6PR binding and uptake. The amount of the fluorophore-conjugated ERT internalized by the Jurkat cells is measured by flow cytometry and evaluated as the percentage (%) signal inhibition compared to the response obtained in the presence of a representative drug-na&#239;ve matrix. In the confirmatory step, the samples are pre-incubated with ERT-conjugated magnetic beads to deplete drug-specific factors that bind to the drug (such as NAbs) prior to an incubation with cells. Samples that screen and confirm positive for drug-specific NAbs in the assay are then serially diluted to generate an antibody titer. Semi-quantitative antibody titers may be correlated with measurements of drug safety and efficacy.

Here we present a cell-based flow cytometry method to detect neutralizing antibodies or other factors that interfere with the cellular uptake of enzyme replacement therapies in a human matrix, such as cerebral spinal fluid (CSF) or human serum.

세포 기반 분석 결과와 효소 대체 요법의 세포질 통풍 관을 중화 하는 항 체의 검출

The administration of enzyme replacement therapies (ERTs) and other biologic therapies to patients may elicit an anti-drug immune response. The ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

살 모 넬 라 종의 심사에 대 한 높은 처리 플랫폼 /Shigella 종

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

의 종 특이 검출을위한 루프 - 매개 등온 증폭 (LAMP) 분석 실험

요약

더 많은 비디오 탐색

이 비디오의 챕터

접착제 테이프 기반의 샘플링 및 형광의 조합 현장에서 하이브 리다이 제이션 살모넬라균* 신선한 농산물에 대한*

표준 임상 Assays에 의해 탐지의 한도 이하 바이러스성로드와 HIV 감염된 개인의 확장 및 HIV - 1 RNA를 Quantifying

Bluetongue 바이러스에 대한 항 바이러스제 소설의 식별에 대한 분석

감염 프로토콜

초기 바이러스 성 항목 식별을위한 분석 실험 및 항 바이러스 화합물의 평가

정성 및 정량 검출을위한 시험 법 및 단백질 항생제 특성

의 탐지를위한 동결 건조 루프 - 매개 등온 증폭 시약의 개발

세균성 접착 및 혈 청 저항에 Vitronectin의 역할을 공부에 대 한 분석

세포 기반 분석 결과와 효소 대체 요법의 세포질 통풍 관을 중화 하는 항 체의 검출

살 모 넬 라 종의 심사에 대 한 높은 처리 플랫폼 /Shigella 종

의 종 특이 검출을위한 루프 - 매개 등온 증폭 (LAMP) 분석 실험

요약

더 많은 비디오 탐색

이 비디오의 챕터

접착제 테이프 기반의 샘플링 및 형광의 조합 현장에서 하이브 리다이 제이션 살모넬라균 신선한 농산물에 대한

표준 임상 Assays에 의해 탐지의 한도 이하 바이러스성로드와 HIV 감염된 개인의 확장 및 HIV - 1 RNA를 Quantifying

Bluetongue 바이러스에 대한 항 바이러스제 소설의 식별에 대한 분석

감염 프로토콜

초기 바이러스 성 항목 식별을위한 분석 실험 및 항 바이러스 화합물의 평가

정성 및 정량 검출을위한 시험 법 및 단백질 항생제 특성

의 탐지를위한 동결 건조 루프 - 매개 등온 증폭 시약의 개발

세균성 접착 및 혈 청 저항에 Vitronectin의 역할을 공부에 대 한 분석

세포 기반 분석 결과와 효소 대체 요법의 세포질 통풍 관을 중화 하는 항 체의 검출

살 모 넬 라 종의 심사에 대 한 높은 처리 플랫폼 /Shigella 종

접착제 테이프 기반의 샘플링 및 형광의 조합 현장에서 하이브 리다이 제이션 살모넬라균* 신선한 농산물에 대한*