The skillful technical assistance of Jasmin Kresse is gratefully acknowledged.

1. Differentiation of Human ESC towards the Definitive Endoderm
<ol>
	<li>Cultivate human embryonic stem cells (ESCs) in an incubator at 37 &#176;C and 5% CO2.</li>
	<li>Coat a new 6-well cell culture plate with 1 ml of a basement membrane matrix and incubate the culture-ware for at least 30 min at RT. For specific details please turn to the respective manufacturer&#39;s instructions.</li>
	<li>Confirm that the cultured human ESCs have reached 80%-90% confluency under the microscope using a low magnification (e.g., 4X). Aspirate the medium from the cavities by sucking off the medium with a sterile glass Pasteur pipet. Wash the cells once with phosphate buffered saline (PBS) solution. For this, add 2 ml PBS to each well softly shake the plate and suck off the solution to remove dead cells and cell debris.</li>
	<li>Add 1 ml of enzyme-free passaging solution reagent for gentle dissociation of cell clusters. Incubate the cells at 37 &#176;C and 5% CO2 until the cells show clear signs of disruption into small clusters. 
	NOTE: The incubation time depends on the reagent used. For the enzyme-free passaging solution mentioned in the materials section, incubation time is roughly 7 min.</li>
	<li>Add 1 ml DMEM/F-12 medium and disrupt the remaining cell aggregates into single cells by pipetting up and down using a 1 ml pipette tip. Use this to flush the cells from the surface and transfer the cells to a centrifugation tube. To retrieve all cells, wash each well with 1 ml of DMEM/F-12 medium and add the medium to the centrifugation tube.</li>
	<li>Centrifuge the cells for 5 min at 300 x g. Aspirate the supernatant and resuspend the cells in 5 ml ES cell culture medium containing 10 &#181;M Rho-Kinase (ROCK) inhibitor.</li>
	<li>Count the cells under the microscope using a hemocytometer and seed 150,000 - 400,000 cells per 6-well or in another plate layout, depending on the ES cell line used. Use culture medium containing 10 &#181;M ROCK inhibitor to avoid apoptosis and culture the cells in an incubator at 37 &#176;C and 5% CO2.</li>
	<li>Approximately 24 hr after seeding aspirate the medium with a sterile glass Pasteur pipet and add 2 ml of primitive streak induction medium. 
	NOTE: This medium contains final concentrations of 1% glutamine, 0.2% FCS, 5 &#181;M CHIR-99021 and 50 ng/ml activin A in Advanced RPMI-1640 medium. Commonly, use 2 ml of medium for cultivation in 6-well plates.</li>
	<li>48 hr after seeding, replace the medium to endoderm induction medium. Cultivate the cells in this medium for another 48 hr with daily medium change. 
	NOTE: This medium contains 1% glutamine, 0.2% FCS and 50 ng/ml activin A in Advanced RPMI-1640 medium. Cells that are committed towards the definitive endoderm express the surface marker CXCR4. The staining of CXCR4 can be used to quantify the number of DE-committed cells.</li>
</ol>
2. Staining of CXCR4+ Definitive Endoderm Cells for Flow Cytometry Analysis
<ol>
	<li>For the final 24 hr but at least 1 hr before harvesting the cells add 10 &#181;M ROCK inhibitor to the culture medium.</li>
	<li>Coat the cell culture-ware that will be used for re-seeding with a basement membrane matrix, i.e., 12-well plates for qPCR analysis or chamber slides for immunofluorescence staining. Incubate the plates or slides for at least 30 min at RT.</li>
	<li>Aspirate the medium with a sterile glass Pasteur pipet from the wells of the differentiated cells used for staining and/or sorting.</li>
	<li>Add 1 ml of enzyme-free passaging solution reagent for the gentle dissociation of cell clusters. Incubate the cells at 37 &#176;C and 5% CO2 until the cells show clear signs of disruption into small clusters. 
	NOTE: The incubation time depends on the reagent used. For the enzyme-free passaging solution mentioned in the materials section, incubation time is roughly 7 min.</li>
	<li>Add 1 ml DMEM/F-12 medium and disrupt remaining cell aggregates into single cells by pipetting up and down using a 1 ml tip. Use this to flush the cells from the surface and transfer the cells to a centrifugation tube. To retrieve all cells, wash each well with 1 ml of DMEM/F-12 medium w/o FCS and add the medium to the centrifugation tube.</li>
	<li>Count the cells under the microscope using a hemocytometer. Cells from three wells of a 6-well plate should result in 10-15 x 106 cells after three days of differentiation. Centrifuge the cells for 5 min at 300 x g. 
	NOTE: The exact number of obtained cells will depend on the pluripotent cell line used for the differentiation.</li>
	<li>Aspirate the supernatant and resuspend the cells in PEB buffer containing 10 &#181;M ROCK inhibitor. Use 100 &#181;l of this buffer for up to 107 cells. Add the 10 &#181;M ROCK inhibitor on the day of staining. Use this buffer for all downstream applications (referred to as PEB buffer + RI). 
	NOTE: PEB buffer contains 0.5% BSA and 2 mM EDTA in PBS. If more cells are to be stained, adjust the buffer volume accordingly.</li>
	<li>Add 10 &#181;l of a CXCR4-APC antibody per 107 cells in 100 &#181;l, this roughly represents a dilution of 1:10. 
	NOTE: The usage of an APC-linked antibody is not mandatory. Instead it can be substituted depending on the microbeads used. If more cells are to be stained adjust the antibody volume accordingly.</li>
	<li>Mix by gently flipping the tube with the fingers and incubate at 4 &#176;C in a refrigerator for 15 min. Resuspend the cells with 1-2 ml PEB buffer. Centrifuge the cells for 5 min at 300 x g.</li>
	<li>Aspirate the supernatant with a sterile glass Pasteur pipet and resuspend the cell pellet in 80 &#181;l PEB per 107 cells and add 20 &#181;l anti-APC microbeads. 
	NOTE: If more cells are to be stained, adjust the micro-bead volume accordingly.</li>
	<li>Mix by gently flipping the tube with the fingers and incubate at 4 &#176;C in a refrigerator for 15 min. Resuspend the cells with 1-2 ml PEB buffer + RI. Centrifuge the cells for 5 min at 300 x g. Aspirate the buffer. Resuspend in 500 &#181;l PEB buffer + RI.</li>
</ol>
3. Magnetic Separation of CXCR4+ Cells
<ol>
	<li>Place a medium sized magnetic column in a magnetic field as per manufacture instructions. Pre-rinse the column with 500 &#181;l PEB buffer +RI. Apply the entire cell suspension to the column. Collect the flow through as not all cells will bind to the column. Make sure not to disturb the columns for optimal retrieval of CXCR4+ cells.</li>
	<li>Wash the column three times with 500 &#181;l PEB buffer + RI. Collect the first flow through and combine it with the collected cells from Step 3.1. Remove the magnetic column from the magnetic field and place it in a suitable collection tube. Add 1 ml PEB buffer + RI onto the column. To elute the cells firmly press down the plunger into the column.</li>
	<li>Optional: Collect all flow through samples separately and use 20 &#181;l each to analyze the number of CXCR4+ cells using flow cytometry. Their number should decline with every washing step. 
	NOTE: At least 2 x 104 viable, gated cells should be counted for reliable results.</li>
	<li>Repeat Steps 3.1-3.3 with the collected-flow through sample from Step 3.1 and the first flow through sample from step 3.2 using a new column. Do not re-use the previous column. By using the plunger air is pressed into the column, which blocks it.</li>
	<li>Count the cells under the microscope using a hemocytometer. Depending on the efficiency of the differentiation up to 6 x 106 cells can be sorted initially and another 1 x 106 cells by using a second column when using 107 cells for the procedure.</li>
	<li>Centrifuge the cells at 300 x g for 5 min. Aspirate the supernatant and with a sterile glass Pasteur pipet and resuspend the cells in 1 ml endoderm induction medium from Step 1.9 with additional 10 &#181;M ROCK inhibitor.</li>
	<li>Count the cells under the microscope using a hemocytometer. Seed the cells at an appropriate density, i.e., ~ 4 x 105 cells per well of a 12-well plate (app. 3.6 cm2 surface) or ~ 1.5 x 105 cells per well of an 8-well chamber-slide.</li>
</ol>
4. Optional: Analysis of Purified Definitive Endoderm Population
<ol>
	<li>For immunofluorescence staining fix the purified cells from Step 3.7 roughly 24 hr after seeding with 4% paraformaldehyde and stain for definitive endoderm (DE) and/or pluripotency marker proteins. 
	NOTE: Commonly used DE markers include FOXA2 and SOX17, commonly used pluripotency markers include OCT3/4, NANOG and SOX26, 8.</li>
	<li>For RT-qPCR analysis, harvest the purified cells directly or 24 hr after seeding, extract total-RNA and reverse transcribe cDNA from the extracted total-RNA samples. Use 10 ng cDNA as template per RT-qPCR reaction (triplicates) to analyze the expression of DE and pluripotency marker genes6, 8. 
	NOTE: Commonly used marker genes are mentioned in Step 4.1. Cycle conditions are 5 min at 95 &#176;C and 40 cycles of 15 sec at 95 &#176;C and 1 min at 60 &#176;C, followed by melting curve analysis.</li>
</ol>

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

The authors declare that they have no competing financial interests.

Currently used differentiation protocols rarely result in 100% differentiated cells. For reasons that still have to be addressed some cells resist the differentiation process. Depending on the efficiency of the used differentiation protocol and the propensity of the ESC line a certain number of residual pluripotent cells are commonly observed even after differentiation into the definitive endoderm. These residual cells may impair downstream differentiations or further analysis such as transcriptomics, proteomics, and miR...

Pluripotent stem cells such as embryonic stem cells (ESCs) have the capability to differentiate into virtually any cell type of the human body. Thus, in vitro differentiation protocols can be used to generate numerous adult cell types such as cardiomyocytes1, hepatocytes2, beta cells3, lung epithelial4 or neuronal cells5. This makes ESCs a valuable tool for the potential treatment of various degenerative diseases3.
The in vitro differentiation of ESCs towards adult tissues of the lung, liver and pancreas requires a pseudo-gastrulation into cells reminiscent of the definitive endoderm (DE)6. Since downstream differentiation towards the aforementioned somatic cell types is significantly less efficient, an optimal endoderm differentiation is regarded as rate-limiting7. Cells that are committed towards the endoderm lineage undergo characteristic changes in their gene expression profile. Pluripotency master regulator genes are down regulated, whereas the expression of other transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family and the surface receptor CXCR4 is highly upregulated6, 8, 9. CXCR4 is known to be transactivated by SMAD2/3, downstream of Nodal/TGF-&#946; signaling and SOX17 due to specific binding sites in its promoter region10. Thus it is a very suitable marker used in a number of reports6, 8, 11-13. These expression changes reflects a pseudo-gastrulation event, in which ESCs first acquire characteristics of a primitive streak-like cell population and subsequently commit into the endoderm germ layer6.
However, differentiation protocols are rarely 100% efficient as a few cells may resist the differentiation process or differentiate towards other unintended lineages14. These cells may negatively influence further differentiation. Furthermore, residual undifferentiated cells harbor great risks for later transplantation experiments and may give rise to teratomas15-17.
To remove these unwanted cells early-on the surface marker CXCR4 can be used for the purification of cells that are committed towards the DE18. Here, we describe a method for the positive selection of CXCR4+ cells from DE differentiation cultures. For this, the surface marker CXCR4 is bound by an antibody which then in turn binds to magnetic microbeads. Unlike the harsh conditions during FACS sorting, the magnetically labeled DE-like cells can then easily be purified in a benchtop format using a gentle purification method. This protocol provides a straightforward method for the removal of cell populations that resisted the DE differentiation process.

<table><tbody><tr><td>Hues8 human embryonic stem cell line</td><td>Harvard Department of stem cell &amp;amp; regenerative biology</td><td></td><td>Suitable cell line for endoderm generation</td></tr><tr><td>Hes3 human embryonic stem cell line</td><td>ES Cell International</td><td></td><td>Suitable and robust cell line for endoderm generation</td></tr><tr><td>mTeSR1</td><td>Stemcell Technologies</td><td>5850</td><td>ESC culture medium</td></tr><tr><td>FCS</td><td>Biowest</td><td>S1860</td><td></td></tr><tr><td>Advanced RPMI 1640</td><td>Life Technologies</td><td>12633012</td><td></td></tr><tr><td>CD184 (CXCR4)-APC, human</td><td>Miltenyi Biotec</td><td>130-098-357</td><td></td></tr><tr><td>anti-APC MicroBeads</td><td>Miltenyi Biotec</td><td>130-090-855&amp;nbsp;</td><td></td></tr><tr><td>OctoMACS Separator</td><td>Miltenyi Biotec</td><td>130-042-109</td><td>magnetic field</td></tr><tr><td>Y-27632</td><td>Selleck Chemicals</td><td>S1049</td><td>ROCK inhibitor</td></tr><tr><td>CHIR-99021</td><td>Tocris Bioscience</td><td>4423</td><td></td></tr><tr><td>Activin A</td><td>Peprotech</td><td>120-14</td><td></td></tr><tr><td>Gentle Cell Dissociation Reagent</td><td>Stemcell Technologies</td><td>7174</td><td>Enzyme-free passaging solution, alternative: Trypsin/EDTA</td></tr><tr><td>Matrigel*</td><td>Corning</td><td>354277</td><td>basement membrane matrix&lt;br/&gt; * solve and store in aliquots at -80 &amp;deg;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.&lt;br/&gt; Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.&lt;br/&gt; Remove the matrigel and use immediately. </td></tr><tr><td>MS Columns</td><td>Miltenyi Biotec</td><td>30-042-201</td><td></td></tr><tr><td>MACS Separator</td><td>Miltenyi Biotec</td><td>130-042-302</td><td></td></tr><tr><td>Human FOXA2 FW&lt;br/&gt;gggagcggtgaagatgga</td><td>Life Technologies</td><td>NA</td><td></td></tr><tr><td>Human FOXA2 REV&lt;br/&gt;tcatgttgctcacggaggagta</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC FW&lt;br/&gt;gaggagaaagtggaggtctggtt</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC REV&lt;br/&gt;ctctgatgaggaccgcttctg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>SOX17 TaqMan assay</td><td>Applied Biosystems</td><td>Hs00751752_s1</td><td></td></tr><tr><td>Human SOX7 FW&lt;br/&gt;gatgctgggaaagtcgtggaagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human SOX7 REV&lt;br/&gt;tgcgcggccggtacttgtag</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 FW&lt;br/&gt;cttgctgcagaagtgggtggagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 REV&lt;br/&gt;ctgcagtgtgggtttcgggca</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog FW&lt;br/&gt;ccgagggcagacatcatcc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog REV&lt;br/&gt;ccatccactgccacatcttct</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP FW&lt;br/&gt;caa cag cct gcc acc tta cgc tc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP REV&lt;br/&gt;agg ctg tgg ggt cag tcc agt g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A FW&lt;br/&gt;ggc agt gtt tgt aga ctt gga acc c</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A REV&lt;br/&gt;tgt gat aag ttg ctc agg gtg gaa g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD FW&lt;br/&gt;agg ccg tca cca aga aca ttc a</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD REV&lt;br/&gt;cga tga tgc ggt tcc agc cta t </td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Anti-SOX2</td><td>Santa Cruz Biotechnology</td><td>sc-17320</td><td></td></tr><tr><td>Anti-FOXA2</td><td>MerckMillipore</td><td>07-633</td><td></td></tr><tr><td>Anti-SOX17</td><td>R&amp;amp;D Systems</td><td>AF1924</td><td></td></tr></tbody></table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell replacement therapies. Terminally differentiated cell types could be used for the treatment of various degenerative diseases. In vitro differentiation of these cells towards tissues of the lung, liver and pancreas requires as a first step the generation of definitive endodermal cells. This step is rate-limiting for further differentiation towards terminally matured cell types such as insulin-producing beta cells, hepatocytes or other endoderm-derived cell types. Cells that are committed towards the endoderm lineage highly express a multitude of transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family, and the surface receptor CXCR4. However, differentiation protocols are rarely 100% efficient. Here, we describe a method for the purification of a CXCR4+ cell population after differentiation into the DE by using magnetic microbeads. This purification additionally removes cells of unwanted lineages. The gentle purification method is quick and reliable and might be used to improve downstream applications and differentiations.

Upon differentiation ESCs undergo drastic changes in gene and protein expression. Figure 1 depicts typical marker genes that can be used to verify a successful endoderm differentiation. Prime targets for a gene expression analysis are GSC, FOXA2, and SOX17. In a relative gene expression analysis especially FOXA2 and SOX17 are increased by &#62; 2,000 fold when compared to undifferentiated ESCs. GSC is ...

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Here, we describe a method for the purification of differentiated human embryonic stem cells that are committed towards the definitive endoderm for the improvement of downstream applications and further differentiations.

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

a-quick-efficient-method-for-purification-endoderm-cells-generated

Research

JoVE Journal

Developmental Biology

8.4K Views.  Hannover Medical School.  Hier beschrijven we een werkwijze voor het zuiveren van gedifferentieerde menselijke embryonale stamcellen die zijn toegewijd aan de definitieve endoderm ter verbetering van downstreamtoepassingen en verdere onderverdelingen. 

Video: A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Isolation of Human Endothelial Cells from Normal Colon and Colorectal Carcinoma - An Improved Protocol

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In particular, endothelial cells (EC) constituting the inner surface of vessels, directly participate in oxygen delivery, nutrient supply, and removal of waste products to and from tumors, and are thereby prominently involved in the constitution of the tumor microenvironment (TME). Tumor endothelial cells (TECs) can be used as cellular biosensors of the intratumoral microenvironment established by communication between tumor and stromal cells. TECs also serve as targets of therapy. Accordingly, in culture these cells allow studies on mechanisms of response or resistance to anti-angiogenic treatment. Recently, it was found that TECs isolated from human colorectal carcinoma (CRC) exhibit memory-like effects based on the specific TME they were derived from. Moreover, these TECs actively contribute to the establishment of a specific TME by the secretion of different factors. For example, TECs in a prognostically favorable Th1-TME secrete the anti-angiogenic tumor-suppressive factor secreted protein, acidic and rich in cysteine-like 1 (SPARCL1). SPARCL1 regulates vessel homeostasis and inhibits tumor cell proliferation and migration. Hence, cultures of pure, viable TECs isolated from human solid tumors are a valuable tool for functional studies on the role of the vascular system in tumorigenesis. Here, a new up-to-date protocol for the isolation of primary EC from the normal colon as well as CRC is described. The technique is based on mechanical and enzymatic tissue digestion, immunolabeling, and fluorescence activated cell sorting (FACS)-sorting of triple-positive cells (CD31, VE-cadherin, CD105). With this protocol, viable TEC or normal endothelial cell (NEC) cultures could be isolated from colon tissues with a success rate of 62.12% when subjected to FACS-sorting (41 pure EC cultures from 66 tissue samples). Accordingly, this protocol provides a robust approach to isolate human EC cultures from normal colon and CRC.

Tumor endothelial cells are important determinants of the tumor microenvironment and the course of the disease. Here, a protocol for the isolation of pure and viable endothelial cells from human colorectal carcinoma and normal colon to be used in drug testing and pathogenesis research is described.

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In ...

Cancer Research

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Biology

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for embryo implantation into the uterine lining of the maternal womb. Improper decidualization has been established as a root cause for implantation failure and subsequent early embryo miscarriage. Therefore, understanding the molecular mechanisms underlying decidualization is advantageous to improving the rate of successful births. In vivo based studies of artificial decidualization are often limiting due to ethical dilemmas associated with human research, as well as translational complications within animal models. As a result, in vitro assays through primary cell culture are often utilized to explore the modulation of decidualization via hormones. This study provides a detailed protocol for the isolation of HESC and subsequent artificial decidualization via the supplementation of hormones to the culturing medium. Further, this study provides a well-designed method to knockdown any gene of interest by utilizing lipid-based siRNA transfections. This protocol permits the optimization of culture purity as well as product yield, thereby maximizing the ability to utilize this model as a reliable method to understand the molecular mechanisms underlying decidualization, and the subsequent quantification of secreted agents by decidualized endometrial stromal cells.

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

This study presents a validated and optimized procedure for the isolation and culture of human endometrial stromal cells to conduct in vitro decidualization assay. Further, this study provides a detailed method to efficiently knockdown a specific gene using siRNAs in human endometrial stromal cells.

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for ...

Generation of ESC-derived Mouse Airway Epithelial Cells Using Decellularized Lung Scaffolds

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and cell-matrix interactions. Due to this complexity, recapitulation of lung development in vitro to promote differentiation of stem cells to lung epithelial cells has been challenging. In this protocol, decellularized lung scaffolds are used to mimic the 3-dimensional environment of the lung and generate stem cell-derived airway epithelial cells. Mouse embryonic stem cell are first differentiated to the endoderm lineage using an embryoid body (EB) culture method with activin A. Endoderm cells are then seeded onto decellularized scaffolds and cultured at air-liquid interface for up to 21 days. This technique promotes differentiation of seeded cells to functional airway epithelial cells (ciliated cells, club cells, and basal cells) without additional growth factor supplementation. This culture setup is defined, serum-free, inexpensive, and reproducible. Although there is limited contamination from non-lung endoderm lineages in culture, this protocol only generates airway epithelial populations and does not give rise to alveolar epithelial cells. Airway epithelia generated with this protocol can be used to study cell-matrix interactions during lung organogenesis and for disease modeling or drug-discovery platforms of airway-related pathologies such as cystic fibrosis.

This protocol efficiently directs mouse embryonic stem cell-derived definitive endoderm to mature airway epithelial cells. This differentiation technique uses 3-dimensional decellularized lung scaffolds to direct lung lineage specification, in a defined, serum-free culture setting.

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and ...

Bioengineering

Robust Generation of Hepatocyte-like Cells from Human Embryonic Stem Cell Populations

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical studies are substantial, therefore it is essential that more predictive toxicology screens are developed and deployed early on in drug development (Greenhough et al 2010). Human hepatocytes represent the current gold standard model for evaluating drug toxicity, but are a limited resource that exhibit variable function. Therefore, the use of immortalised cell lines and animal tissue models are routinely employed due to their abundance. While both sources are informative, they are limited by poor function, species variability and/or instability in culture (Dalgetty et al 2009). Pluripotent stem cells (PSCs) are an attractive alternative source of human hepatocyte like cells (HLCs) (Medine et al 2010). PSCs are capable of self renewal and differentiation to all somatic cell types found in the adult and thereby represent a potentially inexhaustible source of differentiated cells. We have developed a procedure that is simple, highly efficient, amenable to automation and yields functional human HLCs (Hay et al 2008 ; Fletcher et al 2008 ; Hannoun et al 2010 ; Payne et al 2011 and Hay et al 2011). We believe our technology will lead to the scalable production of HLCs for drug discovery, disease modeling, the construction of extra-corporeal devices and possibly cell based transplantation therapies.

This article will focus on the generation of human hepatic endoderm from human embryonic stem cell populations.

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical ...

Rapid Fibroblast Removal from High Density Human Embryonic Stem Cell Cultures

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system maintains hESCs from undergoing spontaneous differentiation during cell expansion. However, this co-culture method is labor intensive, requires highly trained personnel, and yields low hESC purity4. Many laboratories have attempted to minimize the number of feeder cells in hESC cultures (i.e. incorporating matrix-coated dishes or other feeder cell types5-8). These modified culture systems have shown some promise, but have not supplanted the standard method for culturing hESCs with mitomycin C-treated mouse embyronic fibroblasts in order to retard unwanted spontaneous differentiation of the hESC cultures. Therefore, the feeder cells used in hESC expansion should be removed during differentiation experiments. Although several techniques are available for purifying the hESC colonies (FACS, MACS, or use of drug resistant vectors) from feeders, these techniques are labor intensive, costly and/or destructive to the hESC. The aim of this project was to invent a method of purification that enables the harvesting of a purer population of hESCs. We have observed that in a confluent hESC culture, the MEF population can be removed using a simple and rapid aspiration of the MEF sheet. This removal is dependent on several factors, including lateral cell-to-cell binding of MEFs that have a lower binding affinity to the styrene culture dish, and the ability of the stem cell colonies to push the fibroblasts outward during the generation of their own "niche". The hESC were then examined for SSEA-4, Oct3/4 and Tra 1-81 expression up to 10 days after MEF removal to ensure maintenance of pluripotency. Moreover, hESC colonies were able to continue growing from into larger formations after MEF removal, providing an additional level of hESC expansion.

Despite ongoing efforts to transition cultures to feeder-free conditions, the derivation and culture of human embryonic stem cells (hESC) remain largely dependent on co-cultures with mouse embryonic feeders (MEFs). Here, we show a novel methodology for rapidly removing feeders from hESC cultures prior to experimentation.

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system ...

Isolation of Embryonic Ventricular Endothelial Cells

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines offer significant advantages for their ease of use, these cell lines are unavailable for all potential cell types. By isolating primary cells from a specific region of interest, particularly from a transgenic mouse, more nuanced studies can be performed. The basic technique involves dissecting the organ or partial organ of interest (e.g. the heart or a specific region of the heart) and dissociating the organ to single cells. These cells are then incubated with magnetic beads conjugated to an antibody that recognizes the cell type of interest. The cells of interest can then be isolated with the use of a magnet, with a short trypsin incubation dissociating the cells from the beads. These isolated cells can then be cultured and analyzed as desired. This technique was originally designed for adult mouse organs but can be easily scaled down for use with embryonic organs, as demonstrated herein. Because our interest is in the developing coronary vasculature, we wanted to study this population of cells during specific embryonic stages. Thus, the original protocol had to be modified to be compatible with the small size of the embryonic ventricles and the low potential yield of endothelial cells at these developmental stages. Utilizing this scaled-down approach, we have assessed coronary plexus remodeling in transgenic embryonic ventricular endothelial cells.

Primary cell culture is a useful technique for analyzing specific populations of cells, particularly from transgenic mouse embryos at specific developmental stages. Herein, embryonic ventricles are dissected and dissociated, and antibody-conjugated beads recognize and separate out the endothelial cells for further analysis.

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines ...

Enrichment and Purging of Human Embryonic Stem Cells by Detection of Cell Surface Antigens Using the Monoclonal Antibodies TG30 and GCTM-2

Human embryonic stem cells (hESC) can self-renew indefinitely in vitro, and with the appropriate cues can be induced to differentiate into potentially all somatic cell lineages. Differentiated hESC derivatives can potentially be used in transplantation therapies to treat a variety of cell-degenerative diseases. However, hESC differentiation protocols usually yield a mixture of differentiated target and off-target cell types as well as residual undifferentiated cells. For the translation of differentiated hESC-derivatives from the laboratory to the clinic, it is important to be able to discriminate between undifferentiated (pluripotent) and differentiated cells, and generate methods to separate these populations. Safe application of hESC-derived somatic cell types can only be accomplished with pluripotent stem cell-free populations, as residual hESCs could induce tumors known as teratomas following transplantation. Towards this end, here we describe a methodology to detect pluripotency associated cell surface antigens with the monoclonal antibodies TG30 (CD9) and GCTM-2 via fluorescence activated cell sorting (FACS) for the identification of pluripotent TG30Hi-GCTM-2Hi hESCs using positive selection. Using negative selection with our TG30/GCTM-2 FACS methodology, we were able to detect and purge undifferentiated hESCs in populations undergoing very early-stage differentiation (TG30Neg-GCTM-2Neg). In a further study, pluripotent stem cell-free samples of differentiated TG30Neg-GCTM-2Neg cells selected using our TG30/GCTM-2 FACS protocol did not form teratomas once transplanted into immune-compromised mice, supporting the robustness of our protocol. On the other hand, TG30/GCTM-2 FACS-mediated consecutive passaging of enriched pluripotent TG30Hi-GCTM-2Hi hESCs did not affect their ability to self-renew in vitro or their intrinsic pluripotency. Therefore, the characteristics of our TG30/GCTM-2 FACS methodology provide a sensitive assay to obtain highly enriched populations of hPSC as inputs for differentiation assays and to rid potentially tumorigenic (or residual) hESC from derivative cell populations.

We describe the use of the monoclonal antibodies TG30 (CD9) and GCTM-2 for the combined detection of cell surface antigens via fluorescence activated cell sorting (FACS) for the identification and enrichment of live human embryonic stem cells (hESC) using positive selection&#160;and also the use of negative selection to purge hESCs from a mixed cell population.

Human embryonic stem cells (hESC) can self-renew indefinitely in vitro, and with the appropriate cues can be induced to differentiate into potentially all ...

Matrix Comparison for Efficient Human Intestinal Organoid Generation from iPSCs

Comparative Study of Basement-Membrane Matrices for Human Stem Cell Maintenance and Intestinal Organoid Generation

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) are in the spotlight of many research areas. However, the lack of physiological cues in classical cell culture materials hinders efficient iPSC differentiation. Incorporating commercially available ECM into stem cell culture provides physical and chemical cues beneficial for cell maintenance. Animal-derived commercially available basement membrane products are composed of ECM proteins and growth factors that support cell maintenance. Since the ECM holds tissue-specific properties that can modulate cell fate, xeno-free matrices are used to stream up translation to clinical studies. While commercially available matrices are widely used in hiPSC and organoid work, the equivalency of these matrices has not been evaluated yet. Here, a comparative study of hiPSC maintenance and human intestinal organoids (hIO) generation in four different matrices: Matrigel (Matrix 1-AB), Geltrex (Matrix 2-AB), Cultrex (Matrix 3-AB), and VitroGel (Matrix 4-XF) was conducted. Although the colonies lacked a perfectly round shape, there was minimal spontaneous differentiation, with over 85% of the cells expressing the stem cell marker SSEA-4. Matrix 4-XF led to the formation of 3D round clumps. Also, increasing the concentration of supplement and growth factors in the media used to make the Matrix 4-XF hydrogel solution improved hiPSC expression of SSEA-4 by 1.3-fold. Differentiation of Matrix 2-AB -maintained hiPSC led to fewer spheroid releases during the mid-/hindgut stage compared to the other animal-derived basement membranes. Compared to others, the xeno-free organoid matrix (Matrix 4-O3) leads to larger and more mature hIO, suggesting that the physical properties of xeno-free hydrogels can be harnessed to optimize organoid generation. Altogether, the results suggest that variations in the composition of different matrices affect stages of IO differentiation. This study raises awareness about the differences in commercially available matrices and provides a guide for matrix optimization during iPSC and IO work.

Author Spotlight: Advancing Organoid Generation for Drug Development Using iPSCs

Organoids have become valuable tools for disease modeling. The extracellular matrix (ECM)&#160;guides cell fate during organoid generation, and using a system that resembles the native tissue can improve model accuracy. This study compares the generation of induced pluripotent stem cells-derived human intestinal organoids in animal-derived ECM and xeno-free hydrogels.

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) ...

Generation of Functional Endodermal Hepatic Organoids

Organoid technology has allowed us to generate a variety of human organ-like mini structures, such as for the liver, brain, and intestine, in vitro. The remarkable advances in organoid models have recently opened a new experimental era for various applications in disease modeling, developmental biology, and drug discovery. Adult stem cells or induced&#160;pluripotent stem cell (iPSC)-derived liver organoids govern the generation of hepatocytes to use for diverse applications. Here, we present a robust and reproducible protocol for generating hepatic organoids from pluripotent stem cells. This protocol is applicable to healthy and patient-derived cells. To achieve 3D endoderm-derived hepatic organoids (eHEPOs), iPSCs were directly first differentiated into endodermal cells, and then FACS-enriched EpCAM-positive (EpCAM+) cells were used to establish hepatic organoids using the expansion medium. We provide a fast and efficient method to generate hepatic organoids within 2 weeks. The generated organoids mimic the essential properties and functions of hepatocytes, such as albumin secretion, glycogen storage, and cytochrome P450 enzyme activity. Besides the liver-specific gene expression similarities, eHEPOs comprise polarized epithelial cells with bile canaliculi in between. In addition, eHEPOs can be expanded and serial passages long term (1 year) without losing their capacity to differentiate into mature hepatocytes. Thus, eHEPOs provide an alternative source to produce functional hepatocytes.

This protocol describes the generation of fast and reproducible endodermal hepatic organoids (eHEPOs). With this protocol, eHEPOs can be produced within 2 weeks and expand long-term (more than 1 year) without losing their differentiation and functionality.

Organoid technology has allowed us to generate a variety of human organ-like mini structures, such as for the liver, brain, and intestine, in vitro. The ...

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Samenvatting

Meer video's verkennen