Name: a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells
Uploaded: 2016-03-03T13:00:00.000+00:00
Duration: 8 min 34 s
Description: Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

Die geschickte technische Unterstützung von Jasmin Kresse wird dankbar anerkannt.

1. Differenzierung humaner ESC in Richtung Definitive Endoderm <ol><li> Kultivieren humaner embryonaler Stammzellen ( ES- Zellen) in einem Inkubator bei 37 ° C und 5% CO 2. </li><li> Mantel ein neues 6-Well-Zellkulturplatte mit 1 ml einer Basalmembranmatrix und brüten die Kultur-ware für mindestens 30 min bei RT. Für spezielle Informationen wenden Sie sich an die Anweisungen des jeweiligen Herstellers. </li><li> Bestätigen Sie, dass die kultivierten menschlichen WSR 80% -90% Konfluenz unter dem Mikroskop erreicht haben eine geringe Vergrößerung (zB, 4X). Anzusaugen, das Medium aus den Hohlräumen durch das Medium mit einer sterilen Pasteur-Glaspipette Absaugen. Waschen Sie die Zellen einmal mit phosphatgepufferter Salzlösung (PBS) -Lösung. Dazu werden 2 ml PBS in jede Vertiefung sanft die Platte schütteln und die Lösung absaugen, um tote Zellen und Zelltrümmer zu entfernen. </li><li> 1 ml der enzymfreien Passagierung Lösung Reagenz für sanfte Dissoziation von Zellclustern. Inkubieren der Zellen bei 37 ° C eind 5% CO 2 , bis die Zellen deutliche Anzeichen einer Störung in kleinen Clustern zeigen. HINWEIS: Die Inkubationszeit auf dem Reagenz hängt verwendet. Für die enzymfreie Passagierbarkeit Lösung in dem Materialien Abschnitt erwähnt, ist die Inkubationszeit etwa 7 min. </li><li> 1 ml DMEM / F-12-Medium und stören die verbleibenden Zellaggregate in einzelne Zellen durch Pipettieren nach oben und unten eine 1 ml Pipettenspitze. Verwenden, die Zellen von der Oberfläche zu spülen und die Zellen in ein Zentrifugenröhrchen übertragen. Um alle Zellen abrufen, waschen Sie jede Vertiefung mit 1 ml DMEM / F-12-Medium und fügen Sie das Medium zu dem Zentrifugenröhrchen. </li><li> Zentrifugation der Zellen 5 min bei 300 x g. Den Überstand aspirieren und resuspendieren Zellen in 5 ml ES-Zellkulturmedium 10 uM Rho-Kinase (ROCK) Inhibitor enthält. </li><li> Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer und Samen 150.000 - 400.000 Zellen pro 6-well oder in einem anderen Plattenlayout, abhängig von der ES-Zelllinie verwendet. Verwenden culture - Medium , das 10 uM ROCK Inhibitor der Apoptose und Kultur der Zellen in einem Inkubator zu vermeiden , bei 37 ° C und 5% CO 2. </li><li> Etwa 24 Stunden nach der absaugen das Medium mit einer sterilen Pasteur-Glaspipette Säen und 2 ml Primitivstreifen Induktionsmedium. Hinweis: Dieses Medium enthält Endkonzentrationen von 1% Glutamin, 0,2% FCS, 5 uM CHIR-99021 und 50 ng / ml Activin A in Advanced RPMI-1640 - Medium. Üblicherweise verwenden 2 ml Medium für den Anbau in 6-Well-Platten. </li><li> 48 Stunden nach dem Aussäen, ersetzen Sie das Medium Induktionsmedium zu Entoderm. Pflegen Sie die Zellen in diesem Medium für weitere 48 Stunden mit täglicher Mediumwechsel. HINWEIS: Dieses Medium enthält 1% Glutamin, 0,2% FCS und 50 ng / ml Activin A in Advanced RPMI-1640 - Medium. Die Zellen, die in Richtung der endgültigen endoderm begangen werden, um die Oberflächenmarker CXCR4 exprimieren. Die Färbung von CXCR4 kann verwendet werden, um die Anzahl der DE-determinierten Zellen zu quantifizieren. </li></ol><pclass = &quot;jove_title&quot;&gt; 2. Anfärben von CXCR4 + Definitive Entodermzellen für die Durchflusszytometrie-Analyse <ol><li> Für den letzten 24 Stunden, aber mindestens 1 Stunde vor der Ernte die Zellen werden 10 &amp; mgr; M ROCK-Inhibitor zu dem Kulturmedium. </li><li> Bestreichen Sie die Zellkultur-ware, die zur Wiederverwendung Impfen mit einer Basalmembranmatrix verwendet werden, das heißt, 12-Well - Platten für die qPCR - Analyse oder eine Kammer Dias für Immunfluoreszenzanfärbung. Inkubieren der Platten oder Folien für mindestens 30 min bei RT. </li><li> Anzusaugen, das Medium mit einer sterilen Pasteur-Glaspipette aus den Vertiefungen der differenzierten Zellen verwendet zum Färben und / oder sortiert werden. </li><li> 1 ml enzymfreien Passagierung Lösung Reagens zur schonenden Spaltung von Zellclustern. Inkubieren Sie die Zellen bei 37 ° C und 5% CO 2 , bis die Zellen deutliche Anzeichen einer Störung in kleinen Clustern zeigen. HINWEIS: Die Inkubationszeit auf dem Reagenz hängt verwendet. Für die enzymfreien Passagierung Lösung im Materi erwähntals Abschnitt, ist die Inkubationszeit etwa 7 min. </li><li> 1 ml DMEM / F-12-Medium und stören verbleibenden Zellaggregate in einzelne Zellen durch Pipettieren nach oben und unten eine 1 ml-Spitze mit. Verwenden, die Zellen von der Oberfläche zu spülen und die Zellen in ein Zentrifugenröhrchen übertragen. Um alle Zellen abrufen, waschen Sie jede Vertiefung mit 1 ml DMEM / F-12-Medium w / o FCS und fügen Sie das Medium zu dem Zentrifugenröhrchen. </li><li> Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer. Zellen von drei Vertiefungen einer Platte mit 6 Vertiefungen in 10-15 x 10 6 Zellen nach drei Tagen der Differenzierung führen. Zentrifugation der Zellen 5 min bei 300 x g. HINWEIS: Die genaue Zahl der erhaltenen Zellen wird auf der pluripotenten Zelllinie für die Differenzierung verwendet abhängen. </li><li> Den Überstand aspirieren und resuspendieren Zellen in PEB-Puffer 10 &amp; mgr; M ROCK-Inhibitor enthält. Verwenden von 100 &amp; mgr; l dieses Puffers für bis zu 10 7 Zellen. Fügen Sie die 10 &amp; mgr; M ROCK-Inhibitor am Tag der staining. Verwenden Sie diesen Puffer für alle Downstream-Anwendungen (bezeichnet als PEB-Puffer + RI). HINWEIS: PEB - Puffer 0,5% BSA und 2 mM EDTA in PBS enthält. Wenn mehr Zellen werden gefärbt sind, justieren Sie entsprechend den Puffervolumen. </li><li> In 10 ul eines CXCR4-APC - Antikörper pro 10 7 Zellen in 100 &amp; mgr; l, das entspricht etwa einer Verdünnung von 1:10. HINWEIS: Die Verwendung eines APC-verknüpften Antikörper ist nicht zwingend. Stattdessen kann es verwendet in Abhängigkeit von den Mikrokugeln ersetzt werden. Wenn mehr Zellen entsprechend den Antikörper Volumen gefärbt werden sind einzustellen. </li><li> Mischen Sie vorsichtig den Schlauch mit den Fingern blätterte und Inkubation bei 4 ° C im Kühlschrank für 15 min. Resuspendieren der Zellen mit 1-2 ml PEB-Puffer. Zentrifugation der Zellen 5 min bei 300 x g. </li><li> Saugen Sie den Überstand mit einer sterilen Pasteur - Glaspipette und Zellpellet in 80 ul PEB pro 10 7 Zellen und fügen Sie 20 ul anti-APC - Mikrokügelchen. HINWEIS: </strong&gt; Wenn mehr Zellen werden gefärbt sind, stellen Sie die Mikroperlen Volumen entsprechend. </li><li> Mischen Sie vorsichtig den Schlauch mit den Fingern blätterte und Inkubation bei 4 ° C im Kühlschrank für 15 min. Resuspendieren der Zellen mit 1-2 ml PEB-Puffer + RI. Zentrifugation der Zellen 5 min bei 300 x g. Absaugen den Puffer. Resuspendieren in 500 ul PEB-Puffer + RI. </li></ol> 3. Magnetische Trennung von CXCR4 + Zellen <ol><li> Legen Sie eine mittlere magnetische Säule in einem Magnetfeld nach Herstellung Anweisungen. Vorspülen der Säule mit 500 ul PEB-Puffer + RI. Tragen Sie die gesamte Zellsuspension auf die Säule. Sammeln Sie die Strömung durch, da nicht alle Zellen an die Säule binden. Achten Sie darauf, nicht die Spalten für eine optimale Wiedergewinnung von CXCR4 + Zellen zu stören. </li><li> Die Säule wird dreimal mit 500 ul PEB-Puffer + RI. Sammeln Sie die erste Strömung durch und kombinieren es mit den gesammelten Zellen aus Schritt 3.1. Entfernen Sie die Magnetsäule aus dem Magnetfeld und legen Sie sie in eingeeignete Sammelröhrchen. 1 ml PEB-Puffer + RI auf die Säule. Zum Eluieren die Zellen drücken Sie fest um den Kolben in die Säule. </li><li> Optional: Sammeln Sie alle Fluss durch Proben getrennt und verwenden 20 ul jeweils die Anzahl der CXCR4 + Zellen mittels Durchflusszytometrie analysiert. Ihre Zahl sollte mit jedem Waschschritt zurückgehen. HINWEIS: Mindestens 2 x 10 4 lebensfähig, sollte gated Zellen für zuverlässige Ergebnisse gezählt werden. </li><li> Wiederholen Sie die Schritte 3,1-3,3 mit dem gesammelten Strom durch Probe aus Schritt 3.1 und der ersten Strömung durch Probe aus Schritt 3.2 eine neue Spalte. Sie nicht die vorherige Spalte wiederverwenden. Durch die Verwendung der Kolben Luft in die Säule gedrückt werden, es blockier. </li><li> Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer. Abhängig von der Effizienz der Differenzierung von bis zu 6 x 10 6 Zellen kann zunächst und noch 1 x 10 6 Zellen sortiert werden , indem eine zweite Spalte bei 10 7 Zellen für das Verfahren. </li&gt; <li> Zentrifugieren der Zellen bei 300 xg für 5 min. Absaugen und der Überstand wird mit einer sterilen Pasteur-Glaspipette und Resuspendieren der Zellen in 1 ml Endoderm Induktionsmedium aus Schritt 1.9 mit zusätzlichen 10 &amp; mgr; M ROCK-Inhibitor. </li><li> Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer. Seed die Zellen bei einer geeigneten Dichte, dh ~ 4 x 10 5 Zellen pro Vertiefung einer 12-Well - Platte (ca. 3,6 cm 2 Fläche) oder ~ 1,5 x 10 5 Zellen pro Vertiefung eines 8-Well - Kammer-Folie. </li></ol> 4. Optional: Analyse von gereinigtem Definitive Endoderm Bevölkerung <ol><li> Für Immunfluoreszenzanfärbung fixieren die gereinigten Zellen aus Schritt 3.7 in etwa 24 Stunden nach der mit 4% Paraformaldehyd und Beize für die endgültige Endoderm (DE) und / oder Pluripotenz Markerproteine ​​Aussaat. HINWEIS: Häufig verwendete DE Marker umfassen FOXA2 und SOX17, häufig verwendete Pluripotenz Marker umfassen OCT3 / 4, NANOG und SOX2 6, 8. </li><li> for RT-qPCR-Analyse, ernten die gereinigten Zellen direkt oder 24 h nach dem Aussäen extrahieren Total-RNA und transkribieren Reverse-cDNA aus den extrahierten Gesamt-RNA-Proben. Verwenden , 10 ng cDNA als Matrize pro RT-qPCR - Reaktion (Triplikaten) 6, um die Expression von DE und Pluripotenz Markergene 8 zu analysieren. HINWEIS: Häufig verwendete Markergene werden in Schritt 4.1 erwähnt. Zyklusbedingungen sind 5 min bei 95 ° C und 40 Zyklen von 15 sec bei 95 ° C und 1 min bei 60 ° C, gefolgt von einer Schmelzkurvenanalyse. </li></ol>

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

The authors declare that they have no competing financial interests.

Derzeit verwendete Differenzierungsprotokolle ergeben sich selten 100% differenzierte Zellen. Aus Gründen, die noch einige Zellen angesprochen werden müssen widerstehen, den Differenzierungsprozess. Abhängig von der Effizienz der verwendeten Differenzierungsprotokoll und die Neigung des ESC Zeile eine bestimmte Anzahl von Rest pluripotenten Zellen häufig beobachtet werden, selbst nach der Differenzierung in die definitive Entoderm. Diese Restzellen können nachgeschaltete Differenzierungen beeinträchtigen oder weit...

Pluripotente Stammzellen wie embryonale Stammzellen (ES-Zellen) haben die Fähigkeit, in nahezu jedem Zelltyp des menschlichen Körpers zu unterscheiden. Somit können in vitro Differenzierungsprotokollen verwendet werden , um zahlreiche adulten Zelltypen wie Kardiomyozyten 1, Hepatozyten 2, beta - Zellen 3, 4 oder Lungenepithelzellen neuronalen Zellen 5 erzeugen. Dies macht WSR ein wertvolles Werkzeug für die mögliche Behandlung von verschiedenen degenerativen Erkrankungen 3. Die in vitro Differenzierung von ES- Zellen gegenüber adulten Geweben der Lunge, der Leber und der Bauchspeicheldrüse erfordert eine pseudo-Gastrulation in Zellen erinnert an die definitive Endoderm (DE) 6. Da stromabwärts Differenzierung gegenüber den zuvor erwähnten Arten somatischer Zellen wesentlich weniger effizient ist, wird eine optimale Differenzierung Endoderm gilt als geschwindigkeitsbestimmender 7. Die Zellen, die in Richtung der endoderm Linie begangen werden laufen characteristic Veränderungen in ihrem Genexpressionsprofil. Pluripotenz Master - Regulator - Gene herunterreguliert, während die Expression von anderen Transkriptionsfaktoren wie FOXA2, SOX17, HNF1B, die Mitglieder der GATA - Familie und der Oberflächenrezeptor CXCR4 hoch 6 hochreguliert wird, 8, 9. CXCR4 bekannt durch SMAD2 zu trans / 3, hinter Nodal / TGF-β - Signalisierung und SOX17 aufgrund der spezifischen Bindungsstellen in seiner Promotorregion 10. Somit ist es ein sehr geeignet in einer Reihe von Berichten verwendet Marker 6, 8, 11-13. Diese Expressions Änderungen spiegelt eine Pseudo-gastrulation Ereignis, bei dem WSR erste Merkmale eines primitiven streifenartige Zellpopulation zu erwerben und anschließend begehen in die endoderm Keimschicht 6. Allerdings sind Differenzierungsprotokolle selten 100% effizient wie wenige Zellen den Differenzierungsprozess widerstehen kann oder Differenzierung gegenüber anderen unbeabsichtigten Linien 14. Diese Zellen können sich negativ auf Influence weitere Differenzierung. Darüber hinaus bergen Rest undifferenzierten Zellen große Risiken für spätere Experimente Transplantation und kann zu teratomas 15-17 geben. So entfernen Sie können diese unerwünschten Zellen früh auf den Oberflächenmarker CXCR4 zur Reinigung von Zellen verwendet werden , die in Richtung der DE 18 verpflichtet sind. Hier beschreiben wir ein Verfahren für die positive Selektion von CXCR4 + -Zellen aus DE Differenzierungskulturen. Hierzu wird die Oberflächenmarker CXCR4 durch einen Antikörper gebunden, der dann wiederum mit magnetischen Microbeads bindet. Im Gegensatz zu den harten Bedingungen während FACS-Sortierung, die magnetisch markierten DE-ähnlichen Zellen können dann leicht in einem Benchtop-Format gereinigt werden, um eine sanfte Reinigungsverfahren verwendet wird. Dieses Protokoll stellt eine einfache Methode zur Entfernung von Zellpopulationen, die die DE Differenzierungsprozess widerstanden.

<table><tbody><tr><td>Hues8 human embryonic stem cell line</td><td>Harvard Department of stem cell &amp;amp; regenerative biology</td><td></td><td>Suitable cell line for endoderm generation</td></tr><tr><td>Hes3 human embryonic stem cell line</td><td>ES Cell International</td><td></td><td>Suitable and robust cell line for endoderm generation</td></tr><tr><td>mTeSR1</td><td>Stemcell Technologies</td><td>5850</td><td>ESC culture medium</td></tr><tr><td>FCS</td><td>Biowest</td><td>S1860</td><td></td></tr><tr><td>Advanced RPMI 1640</td><td>Life Technologies</td><td>12633012</td><td></td></tr><tr><td>CD184 (CXCR4)-APC, human</td><td>Miltenyi Biotec</td><td>130-098-357</td><td></td></tr><tr><td>anti-APC MicroBeads</td><td>Miltenyi Biotec</td><td>130-090-855&amp;nbsp;</td><td></td></tr><tr><td>OctoMACS Separator</td><td>Miltenyi Biotec</td><td>130-042-109</td><td>magnetic field</td></tr><tr><td>Y-27632</td><td>Selleck Chemicals</td><td>S1049</td><td>ROCK inhibitor</td></tr><tr><td>CHIR-99021</td><td>Tocris Bioscience</td><td>4423</td><td></td></tr><tr><td>Activin A</td><td>Peprotech</td><td>120-14</td><td></td></tr><tr><td>Gentle Cell Dissociation Reagent</td><td>Stemcell Technologies</td><td>7174</td><td>Enzyme-free passaging solution, alternative: Trypsin/EDTA</td></tr><tr><td>Matrigel*</td><td>Corning</td><td>354277</td><td>basement membrane matrix&lt;br/&gt; * solve and store in aliquots at -80 &amp;deg;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.&lt;br/&gt; Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.&lt;br/&gt; Remove the matrigel and use immediately. </td></tr><tr><td>MS Columns</td><td>Miltenyi Biotec</td><td>30-042-201</td><td></td></tr><tr><td>MACS Separator</td><td>Miltenyi Biotec</td><td>130-042-302</td><td></td></tr><tr><td>Human FOXA2 FW&lt;br/&gt;gggagcggtgaagatgga</td><td>Life Technologies</td><td>NA</td><td></td></tr><tr><td>Human FOXA2 REV&lt;br/&gt;tcatgttgctcacggaggagta</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC FW&lt;br/&gt;gaggagaaagtggaggtctggtt</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human GSC REV&lt;br/&gt;ctctgatgaggaccgcttctg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>SOX17 TaqMan assay</td><td>Applied Biosystems</td><td>Hs00751752_s1</td><td></td></tr><tr><td>Human SOX7 FW&lt;br/&gt;gatgctgggaaagtcgtggaagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human SOX7 REV&lt;br/&gt;tgcgcggccggtacttgtag</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 FW&lt;br/&gt;cttgctgcagaagtgggtggagg</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human POU5F1 REV&lt;br/&gt;ctgcagtgtgggtttcgggca</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog FW&lt;br/&gt;ccgagggcagacatcatcc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human Nanog REV&lt;br/&gt;ccatccactgccacatcttct</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP FW&lt;br/&gt;caa cag cct gcc acc tta cgc tc</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TBP REV&lt;br/&gt;agg ctg tgg ggt cag tcc agt g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A FW&lt;br/&gt;ggc agt gtt tgt aga ctt gga acc c</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human TUBA1A REV&lt;br/&gt;tgt gat aag ttg ctc agg gtg gaa g</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD FW&lt;br/&gt;agg ccg tca cca aga aca ttc a</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Human G6PD REV&lt;br/&gt;cga tga tgc ggt tcc agc cta t </td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Anti-SOX2</td><td>Santa Cruz Biotechnology</td><td>sc-17320</td><td></td></tr><tr><td>Anti-FOXA2</td><td>MerckMillipore</td><td>07-633</td><td></td></tr><tr><td>Anti-SOX17</td><td>R&amp;amp;D Systems</td><td>AF1924</td><td></td></tr></tbody></table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

Die Differenzierung Fähigkeiten von pluripotenten Stammzellen wie embryonale Stammzellen (ES-Zellen) ermöglichen eine mögliche therapeutische Anwendung für Zell-Ersatz-Therapien. Ausdifferenzierten Zelltypen könnten für die Behandlung von verschiedenen degenerativen Krankheiten verwendet werden. In vitro Differenzierung dieser Zellen gegenüber Geweben der Lunge, der Leber und der Bauchspeicheldrüse erfordert als ersten Schritt die Erzeugung von endgültigen endodermalen Zellen. Dieser Schritt ist geschwindigkeitsbestimmend für die weitere Differenzierung zu endständig gereiften Zelltypen, wie beispielsweise Insulin-produzierenden Beta-Zellen, Hepatozyten oder anderen Endoderm-abgeleiteten Zelltypen. Die Zellen, die in Richtung der endoderm Linie verpflichtet sind ausdrücken sehr eine Vielzahl von Transkriptionsfaktoren wie FOXA2, SOX17, HNF1B, die Mitglieder der GATA-Familie, und der Oberflächenrezeptor CXCR4. Allerdings Differenzierungsprotokolle sind selten 100% effizient. Hier beschreiben wir ein Verfahren zur Reinigung eines CXCR4 + Zellpopulation nach der Differenzierungin der DE durch magnetische Mikrokugeln verwendet. Diese Reinigung entfernt zusätzlich Zellen von unerwünschten Linien. Die sanfte Reinigungsverfahren ist schnell und zuverlässig und kann verwendet werden, Downstream-Anwendungen und Differenzierungen zu verbessern.

Bei der Differenzierung WSR laufen drastischen Veränderungen in der Gen und Proteinexpression. Figur 1 typische Markergene darstellt , die verwendet werden können , eine erfolgreiche Endoderm Differenzierung zu verifizieren. Prime Ziele für eine Genexpressionsanalyse sind GSC, FOXA2 und SOX17. In einer relativen Analyse der Genexpression insbesondere FOXA2 und SOX17 erhöht von&gt; 2.000 - fache , wenn si...

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Hier beschreiben wir ein Verfahren zur Reinigung von differenzierten humanen embryonalen Stammzellen, die in Richtung der endgültigen Endoderm zur Verbesserung der Downstream-Anwendungen und weitere Differenzierungen begangen werden.

Eine schnelle und effiziente Methode zur Reinigung von Entodermzellen generiert aus humanen embryonalen Stammzellen

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

a-quick-efficient-method-for-purification-endoderm-cells-generated

Research

JoVE Journal

Developmental Biology

8.3K Aufrufe.  Hannover Medical School.  Hier beschreiben wir ein Verfahren zur Reinigung von differenzierten humanen embryonalen Stammzellen, die in Richtung der endgültigen Endoderm zur Verbesserung der Downstream-Anwendungen und weitere Differenzierungen begangen werden. 

Serie: A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Isolation of Human Endothelial Cells from Normal Colon and Colorectal Carcinoma - An Improved Protocol

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In particular, endothelial cells (EC) constituting the inner surface of vessels, directly participate in oxygen delivery, nutrient supply, and removal of waste products to and from tumors, and are thereby prominently involved in the constitution of the tumor microenvironment (TME). Tumor endothelial cells (TECs) can be used as cellular biosensors of the intratumoral microenvironment established by communication between tumor and stromal cells. TECs also serve as targets of therapy. Accordingly, in culture these cells allow studies on mechanisms of response or resistance to anti-angiogenic treatment. Recently, it was found that TECs isolated from human colorectal carcinoma (CRC) exhibit memory-like effects based on the specific TME they were derived from. Moreover, these TECs actively contribute to the establishment of a specific TME by the secretion of different factors. For example, TECs in a prognostically favorable Th1-TME secrete the anti-angiogenic tumor-suppressive factor secreted protein, acidic and rich in cysteine-like 1 (SPARCL1). SPARCL1 regulates vessel homeostasis and inhibits tumor cell proliferation and migration. Hence, cultures of pure, viable TECs isolated from human solid tumors are a valuable tool for functional studies on the role of the vascular system in tumorigenesis. Here, a new up-to-date protocol for the isolation of primary EC from the normal colon as well as CRC is described. The technique is based on mechanical and enzymatic tissue digestion, immunolabeling, and fluorescence activated cell sorting (FACS)-sorting of triple-positive cells (CD31, VE-cadherin, CD105). With this protocol, viable TEC or normal endothelial cell (NEC) cultures could be isolated from colon tissues with a success rate of 62.12% when subjected to FACS-sorting (41 pure EC cultures from 66 tissue samples). Accordingly, this protocol provides a robust approach to isolate human EC cultures from normal colon and CRC.

Tumor endothelial cells are important determinants of the tumor microenvironment and the course of the disease. Here, a protocol for the isolation of pure and viable endothelial cells from human colorectal carcinoma and normal colon to be used in drug testing and pathogenesis research is described.

Isolierung der menschlichen Endothelzellen aus normalen Colon und kolorektalen Karzinom - eine verbesserte Protokoll

Primary cells isolated from human carcinomas are valuable tools to identify pathogenic mechanisms contributing to disease development and progression. In ...

Forschung

Krebsforschung

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Gewinnung menschlicher embryonaler Stammzellen durch Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Biologie

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

Effiziente Ableitung von humanen neuronalen Vorläuferzellen und Neuronen aus pluripotenten humanen embryonalen Stammzellen mit Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Neurowissenschaften

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for embryo implantation into the uterine lining of the maternal womb. Improper decidualization has been established as a root cause for implantation failure and subsequent early embryo miscarriage. Therefore, understanding the molecular mechanisms underlying decidualization is advantageous to improving the rate of successful births. In vivo based studies of artificial decidualization are often limiting due to ethical dilemmas associated with human research, as well as translational complications within animal models. As a result, in vitro assays through primary cell culture are often utilized to explore the modulation of decidualization via hormones. This study provides a detailed protocol for the isolation of HESC and subsequent artificial decidualization via the supplementation of hormones to the culturing medium. Further, this study provides a well-designed method to knockdown any gene of interest by utilizing lipid-based siRNA transfections. This protocol permits the optimization of culture purity as well as product yield, thereby maximizing the ability to utilize this model as a reliable method to understand the molecular mechanisms underlying decidualization, and the subsequent quantification of secreted agents by decidualized endometrial stromal cells.

Isolation of Human Endometrial Stromal Cells for In Vitro Decidualization

This study presents a validated and optimized procedure for the isolation and culture of human endometrial stromal cells to conduct in vitro decidualization assay. Further, this study provides a detailed method to efficiently knockdown a specific gene using siRNAs in human endometrial stromal cells.

Isolation von menschlichen endometrialen Stromazellen Zellen für In-vitro- Decidualization

The differentiation of human endometrial stromal cells (HESC) from fibroblast-like appearance into secretory decidua is a transformation required for ...

Entwicklungsbiologie

Generation of ESC-derived Mouse Airway Epithelial Cells Using Decellularized Lung Scaffolds

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and cell-matrix interactions. Due to this complexity, recapitulation of lung development in vitro to promote differentiation of stem cells to lung epithelial cells has been challenging. In this protocol, decellularized lung scaffolds are used to mimic the 3-dimensional environment of the lung and generate stem cell-derived airway epithelial cells. Mouse embryonic stem cell are first differentiated to the endoderm lineage using an embryoid body (EB) culture method with activin A. Endoderm cells are then seeded onto decellularized scaffolds and cultured at air-liquid interface for up to 21 days. This technique promotes differentiation of seeded cells to functional airway epithelial cells (ciliated cells, club cells, and basal cells) without additional growth factor supplementation. This culture setup is defined, serum-free, inexpensive, and reproducible. Although there is limited contamination from non-lung endoderm lineages in culture, this protocol only generates airway epithelial populations and does not give rise to alveolar epithelial cells. Airway epithelia generated with this protocol can be used to study cell-matrix interactions during lung organogenesis and for disease modeling or drug-discovery platforms of airway-related pathologies such as cystic fibrosis.

This protocol efficiently directs mouse embryonic stem cell-derived definitive endoderm to mature airway epithelial cells. This differentiation technique uses 3-dimensional decellularized lung scaffolds to direct lung lineage specification, in a defined, serum-free culture setting.

Die Erzeugung von ESC-derived Maus Airway epithelialen Zellen unter Verwendung von Dezellularisierte Lung Scaffolds

Lung lineage differentiation requires integration of complex environmental cues that include growth factor signaling, cell-cell interactions and ...

Biotechnik

Robust Generation of Hepatocyte-like Cells from Human Embryonic Stem Cell Populations

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical studies are substantial, therefore it is essential that more predictive toxicology screens are developed and deployed early on in drug development (Greenhough et al 2010). Human hepatocytes represent the current gold standard model for evaluating drug toxicity, but are a limited resource that exhibit variable function. Therefore, the use of immortalised cell lines and animal tissue models are routinely employed due to their abundance. While both sources are informative, they are limited by poor function, species variability and/or instability in culture (Dalgetty et al 2009). Pluripotent stem cells (PSCs) are an attractive alternative source of human hepatocyte like cells (HLCs) (Medine et al 2010). PSCs are capable of self renewal and differentiation to all somatic cell types found in the adult and thereby represent a potentially inexhaustible source of differentiated cells. We have developed a procedure that is simple, highly efficient, amenable to automation and yields functional human HLCs (Hay et al 2008 ; Fletcher et al 2008 ; Hannoun et al 2010 ; Payne et al 2011 and Hay et al 2011). We believe our technology will lead to the scalable production of HLCs for drug discovery, disease modeling, the construction of extra-corporeal devices and possibly cell based transplantation therapies.

This article will focus on the generation of human hepatic endoderm from human embryonic stem cell populations.

Robuste Generierung von Leber-ähnlichen Zellen aus humanen embryonalen Stammzell-Populationen

Despite progress in modelling human drug toxicity, many compounds fail during clinical trials due to unpredicted side effects. The cost of clinical ...

Rapid Fibroblast Removal from High Density Human Embryonic Stem Cell Cultures

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system maintains hESCs from undergoing spontaneous differentiation during cell expansion. However, this co-culture method is labor intensive, requires highly trained personnel, and yields low hESC purity4. Many laboratories have attempted to minimize the number of feeder cells in hESC cultures (i.e. incorporating matrix-coated dishes or other feeder cell types5-8). These modified culture systems have shown some promise, but have not supplanted the standard method for culturing hESCs with mitomycin C-treated mouse embyronic fibroblasts in order to retard unwanted spontaneous differentiation of the hESC cultures. Therefore, the feeder cells used in hESC expansion should be removed during differentiation experiments. Although several techniques are available for purifying the hESC colonies (FACS, MACS, or use of drug resistant vectors) from feeders, these techniques are labor intensive, costly and/or destructive to the hESC. The aim of this project was to invent a method of purification that enables the harvesting of a purer population of hESCs. We have observed that in a confluent hESC culture, the MEF population can be removed using a simple and rapid aspiration of the MEF sheet. This removal is dependent on several factors, including lateral cell-to-cell binding of MEFs that have a lower binding affinity to the styrene culture dish, and the ability of the stem cell colonies to push the fibroblasts outward during the generation of their own "niche". The hESC were then examined for SSEA-4, Oct3/4 and Tra 1-81 expression up to 10 days after MEF removal to ensure maintenance of pluripotency. Moreover, hESC colonies were able to continue growing from into larger formations after MEF removal, providing an additional level of hESC expansion.

Despite ongoing efforts to transition cultures to feeder-free conditions, the derivation and culture of human embryonic stem cells (hESC) remain largely dependent on co-cultures with mouse embryonic feeders (MEFs). Here, we show a novel methodology for rapidly removing feeders from hESC cultures prior to experimentation.

Schnelle Fibroblast Entfernung aus High Density humanen embryonalen Stammzellen Kulturen

Mouse embryonic fibroblasts (MEFs) were used to establish human embryonic stem cells (hESCs) cultures after blastocyst isolation1. This feeder system ...

Isolation of Embryonic Ventricular Endothelial Cells

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines offer significant advantages for their ease of use, these cell lines are unavailable for all potential cell types. By isolating primary cells from a specific region of interest, particularly from a transgenic mouse, more nuanced studies can be performed. The basic technique involves dissecting the organ or partial organ of interest (e.g. the heart or a specific region of the heart) and dissociating the organ to single cells. These cells are then incubated with magnetic beads conjugated to an antibody that recognizes the cell type of interest. The cells of interest can then be isolated with the use of a magnet, with a short trypsin incubation dissociating the cells from the beads. These isolated cells can then be cultured and analyzed as desired. This technique was originally designed for adult mouse organs but can be easily scaled down for use with embryonic organs, as demonstrated herein. Because our interest is in the developing coronary vasculature, we wanted to study this population of cells during specific embryonic stages. Thus, the original protocol had to be modified to be compatible with the small size of the embryonic ventricles and the low potential yield of endothelial cells at these developmental stages. Utilizing this scaled-down approach, we have assessed coronary plexus remodeling in transgenic embryonic ventricular endothelial cells.

Primary cell culture is a useful technique for analyzing specific populations of cells, particularly from transgenic mouse embryos at specific developmental stages. Herein, embryonic ventricles are dissected and dissociated, and antibody-conjugated beads recognize and separate out the endothelial cells for further analysis.

Isolierung von embryonalen ventrikuläre Endothelzellen

Cell culture has greatly enhanced our ability to assess individual populations of cells under myriad culture conditions. While immortalized cell lines ...

Matrixvergleich zur effizienten Generierung von humanen Darmorganoiden aus iPSCs

Comparative Study of Basement-Membrane Matrices for Human Stem Cell Maintenance and Intestinal Organoid Generation

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) are in the spotlight of many research areas. However, the lack of physiological cues in classical cell culture materials hinders efficient iPSC differentiation. Incorporating commercially available ECM into stem cell culture provides physical and chemical cues beneficial for cell maintenance. Animal-derived commercially available basement membrane products are composed of ECM proteins and growth factors that support cell maintenance. Since the ECM holds tissue-specific properties that can modulate cell fate, xeno-free matrices are used to stream up translation to clinical studies. While commercially available matrices are widely used in hiPSC and organoid work, the equivalency of these matrices has not been evaluated yet. Here, a comparative study of hiPSC maintenance and human intestinal organoids (hIO) generation in four different matrices: Matrigel (Matrix 1-AB), Geltrex (Matrix 2-AB), Cultrex (Matrix 3-AB), and VitroGel (Matrix 4-XF) was conducted. Although the colonies lacked a perfectly round shape, there was minimal spontaneous differentiation, with over 85% of the cells expressing the stem cell marker SSEA-4. Matrix 4-XF led to the formation of 3D round clumps. Also, increasing the concentration of supplement and growth factors in the media used to make the Matrix 4-XF hydrogel solution improved hiPSC expression of SSEA-4 by 1.3-fold. Differentiation of Matrix 2-AB -maintained hiPSC led to fewer spheroid releases during the mid-/hindgut stage compared to the other animal-derived basement membranes. Compared to others, the xeno-free organoid matrix (Matrix 4-O3) leads to larger and more mature hIO, suggesting that the physical properties of xeno-free hydrogels can be harnessed to optimize organoid generation. Altogether, the results suggest that variations in the composition of different matrices affect stages of IO differentiation. This study raises awareness about the differences in commercially available matrices and provides a guide for matrix optimization during iPSC and IO work.

Autor im Rampenlicht: Förderung der Organoidgenerierung für die Arzneimittelentwicklung mit iPSCs

Organoids have become valuable tools for disease modeling. The extracellular matrix (ECM)&#160;guides cell fate during organoid generation, and using a system that resembles the native tissue can improve model accuracy. This study compares the generation of induced pluripotent stem cells-derived human intestinal organoids in animal-derived ECM and xeno-free hydrogels.

Vergleichende Studie von Basalmembranmatrizen für die Erhaltung humaner Stammzellen und die Generierung von intestinalen Organoiden

Extracellular matrix (ECM) plays a critical role in cell behavior and development. Organoids generated from human induced pluripotent stem cells (hiPSCs) ...

Eine schnelle und effiziente Methode zur Reinigung von Entodermzellen generiert aus humanen embryonalen Stammzellen

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Isolierung der menschlichen Endothelzellen aus normalen Colon und kolorektalen Karzinom - eine verbesserte Protokoll

Gewinnung menschlicher embryonaler Stammzellen durch Immunosurgery

Effiziente Ableitung von humanen neuronalen Vorläuferzellen und Neuronen aus pluripotenten humanen embryonalen Stammzellen mit Small Molecule Induction

Isolation von menschlichen endometrialen Stromazellen Zellen für In-vitro- Decidualization

Die Erzeugung von ESC-derived Maus Airway epithelialen Zellen unter Verwendung von Dezellularisierte Lung Scaffolds

Robuste Generierung von Leber-ähnlichen Zellen aus humanen embryonalen Stammzell-Populationen

Schnelle Fibroblast Entfernung aus High Density humanen embryonalen Stammzellen Kulturen

Isolierung von embryonalen ventrikuläre Endothelzellen

Vergleichende Studie von Basalmembranmatrizen für die Erhaltung humaner Stammzellen und die Generierung von intestinalen Organoiden

Vergleichende Studie von Basalmembranmatrizen für die Erhaltung humaner Stammzellen und die Generierung von intestinalen Organoiden