Die geschickte technische Unterstützung von Jasmin Kresse wird dankbar anerkannt.

1. Differenzierung humaner ESC in Richtung Definitive Endoderm <ol><li> Kultivieren humaner embryonaler Stammzellen ( ES- Zellen) in einem Inkubator bei 37 ° C und 5% CO 2. </li><li> Mantel ein neues 6-Well-Zellkulturplatte mit 1 ml einer Basalmembranmatrix und brüten die Kultur-ware für mindestens 30 min bei RT. Für spezielle Informationen wenden Sie sich an die Anweisungen des jeweiligen Herstellers. </li><li> Bestätigen Sie, dass die kultivierten menschlichen WSR 80% -90% Konfluenz unter dem Mikroskop erreicht haben eine geringe Vergrößerung (zB, 4X). Anzusaugen, das Medium aus den Hohlräumen durch das Medium mit einer sterilen Pasteur-Glaspipette Absaugen. Waschen Sie die Zellen einmal mit phosphatgepufferter Salzlösung (PBS) -Lösung. Dazu werden 2 ml PBS in jede Vertiefung sanft die Platte schütteln und die Lösung absaugen, um tote Zellen und Zelltrümmer zu entfernen. </li><li> 1 ml der enzymfreien Passagierung Lösung Reagenz für sanfte Dissoziation von Zellclustern. Inkubieren der Zellen bei 37 ° C eind 5% CO 2 , bis die Zellen deutliche Anzeichen einer Störung in kleinen Clustern zeigen. HINWEIS: Die Inkubationszeit auf dem Reagenz hängt verwendet. Für die enzymfreie Passagierbarkeit Lösung in dem Materialien Abschnitt erwähnt, ist die Inkubationszeit etwa 7 min. </li><li> 1 ml DMEM / F-12-Medium und stören die verbleibenden Zellaggregate in einzelne Zellen durch Pipettieren nach oben und unten eine 1 ml Pipettenspitze. Verwenden, die Zellen von der Oberfläche zu spülen und die Zellen in ein Zentrifugenröhrchen übertragen. Um alle Zellen abrufen, waschen Sie jede Vertiefung mit 1 ml DMEM / F-12-Medium und fügen Sie das Medium zu dem Zentrifugenröhrchen. </li><li> Zentrifugation der Zellen 5 min bei 300 x g. Den Überstand aspirieren und resuspendieren Zellen in 5 ml ES-Zellkulturmedium 10 uM Rho-Kinase (ROCK) Inhibitor enthält. </li><li> Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer und Samen 150.000 - 400.000 Zellen pro 6-well oder in einem anderen Plattenlayout, abhängig von der ES-Zelllinie verwendet. Verwenden culture - Medium , das 10 uM ROCK Inhibitor der Apoptose und Kultur der Zellen in einem Inkubator zu vermeiden , bei 37 ° C und 5% CO 2. </li><li> Etwa 24 Stunden nach der absaugen das Medium mit einer sterilen Pasteur-Glaspipette Säen und 2 ml Primitivstreifen Induktionsmedium. Hinweis: Dieses Medium enthält Endkonzentrationen von 1% Glutamin, 0,2% FCS, 5 uM CHIR-99021 und 50 ng / ml Activin A in Advanced RPMI-1640 - Medium. Üblicherweise verwenden 2 ml Medium für den Anbau in 6-Well-Platten. </li><li> 48 Stunden nach dem Aussäen, ersetzen Sie das Medium Induktionsmedium zu Entoderm. Pflegen Sie die Zellen in diesem Medium für weitere 48 Stunden mit täglicher Mediumwechsel. HINWEIS: Dieses Medium enthält 1% Glutamin, 0,2% FCS und 50 ng / ml Activin A in Advanced RPMI-1640 - Medium. Die Zellen, die in Richtung der endgültigen endoderm begangen werden, um die Oberflächenmarker CXCR4 exprimieren. Die Färbung von CXCR4 kann verwendet werden, um die Anzahl der DE-determinierten Zellen zu quantifizieren. </li></ol><pclass = &quot;jove_title&quot;&gt; 2. Anfärben von CXCR4 + Definitive Entodermzellen für die Durchflusszytometrie-Analyse <ol><li> Für den letzten 24 Stunden, aber mindestens 1 Stunde vor der Ernte die Zellen werden 10 &amp; mgr; M ROCK-Inhibitor zu dem Kulturmedium. </li><li> Bestreichen Sie die Zellkultur-ware, die zur Wiederverwendung Impfen mit einer Basalmembranmatrix verwendet werden, das heißt, 12-Well - Platten für die qPCR - Analyse oder eine Kammer Dias für Immunfluoreszenzanfärbung. Inkubieren der Platten oder Folien für mindestens 30 min bei RT. </li><li> Anzusaugen, das Medium mit einer sterilen Pasteur-Glaspipette aus den Vertiefungen der differenzierten Zellen verwendet zum Färben und / oder sortiert werden. </li><li> 1 ml enzymfreien Passagierung Lösung Reagens zur schonenden Spaltung von Zellclustern. Inkubieren Sie die Zellen bei 37 ° C und 5% CO 2 , bis die Zellen deutliche Anzeichen einer Störung in kleinen Clustern zeigen. HINWEIS: Die Inkubationszeit auf dem Reagenz hängt verwendet. Für die enzymfreien Passagierung Lösung im Materi erwähntals Abschnitt, ist die Inkubationszeit etwa 7 min. </li><li> 1 ml DMEM / F-12-Medium und stören verbleibenden Zellaggregate in einzelne Zellen durch Pipettieren nach oben und unten eine 1 ml-Spitze mit. Verwenden, die Zellen von der Oberfläche zu spülen und die Zellen in ein Zentrifugenröhrchen übertragen. Um alle Zellen abrufen, waschen Sie jede Vertiefung mit 1 ml DMEM / F-12-Medium w / o FCS und fügen Sie das Medium zu dem Zentrifugenröhrchen. </li><li> Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer. Zellen von drei Vertiefungen einer Platte mit 6 Vertiefungen in 10-15 x 10 6 Zellen nach drei Tagen der Differenzierung führen. Zentrifugation der Zellen 5 min bei 300 x g. HINWEIS: Die genaue Zahl der erhaltenen Zellen wird auf der pluripotenten Zelllinie für die Differenzierung verwendet abhängen. </li><li> Den Überstand aspirieren und resuspendieren Zellen in PEB-Puffer 10 &amp; mgr; M ROCK-Inhibitor enthält. Verwenden von 100 &amp; mgr; l dieses Puffers für bis zu 10 7 Zellen. Fügen Sie die 10 &amp; mgr; M ROCK-Inhibitor am Tag der staining. Verwenden Sie diesen Puffer für alle Downstream-Anwendungen (bezeichnet als PEB-Puffer + RI). HINWEIS: PEB - Puffer 0,5% BSA und 2 mM EDTA in PBS enthält. Wenn mehr Zellen werden gefärbt sind, justieren Sie entsprechend den Puffervolumen. </li><li> In 10 ul eines CXCR4-APC - Antikörper pro 10 7 Zellen in 100 &amp; mgr; l, das entspricht etwa einer Verdünnung von 1:10. HINWEIS: Die Verwendung eines APC-verknüpften Antikörper ist nicht zwingend. Stattdessen kann es verwendet in Abhängigkeit von den Mikrokugeln ersetzt werden. Wenn mehr Zellen entsprechend den Antikörper Volumen gefärbt werden sind einzustellen. </li><li> Mischen Sie vorsichtig den Schlauch mit den Fingern blätterte und Inkubation bei 4 ° C im Kühlschrank für 15 min. Resuspendieren der Zellen mit 1-2 ml PEB-Puffer. Zentrifugation der Zellen 5 min bei 300 x g. </li><li> Saugen Sie den Überstand mit einer sterilen Pasteur - Glaspipette und Zellpellet in 80 ul PEB pro 10 7 Zellen und fügen Sie 20 ul anti-APC - Mikrokügelchen. HINWEIS: </strong&gt; Wenn mehr Zellen werden gefärbt sind, stellen Sie die Mikroperlen Volumen entsprechend. </li><li> Mischen Sie vorsichtig den Schlauch mit den Fingern blätterte und Inkubation bei 4 ° C im Kühlschrank für 15 min. Resuspendieren der Zellen mit 1-2 ml PEB-Puffer + RI. Zentrifugation der Zellen 5 min bei 300 x g. Absaugen den Puffer. Resuspendieren in 500 ul PEB-Puffer + RI. </li></ol> 3. Magnetische Trennung von CXCR4 + Zellen <ol><li> Legen Sie eine mittlere magnetische Säule in einem Magnetfeld nach Herstellung Anweisungen. Vorspülen der Säule mit 500 ul PEB-Puffer + RI. Tragen Sie die gesamte Zellsuspension auf die Säule. Sammeln Sie die Strömung durch, da nicht alle Zellen an die Säule binden. Achten Sie darauf, nicht die Spalten für eine optimale Wiedergewinnung von CXCR4 + Zellen zu stören. </li><li> Die Säule wird dreimal mit 500 ul PEB-Puffer + RI. Sammeln Sie die erste Strömung durch und kombinieren es mit den gesammelten Zellen aus Schritt 3.1. Entfernen Sie die Magnetsäule aus dem Magnetfeld und legen Sie sie in eingeeignete Sammelröhrchen. 1 ml PEB-Puffer + RI auf die Säule. Zum Eluieren die Zellen drücken Sie fest um den Kolben in die Säule. </li><li> Optional: Sammeln Sie alle Fluss durch Proben getrennt und verwenden 20 ul jeweils die Anzahl der CXCR4 + Zellen mittels Durchflusszytometrie analysiert. Ihre Zahl sollte mit jedem Waschschritt zurückgehen. HINWEIS: Mindestens 2 x 10 4 lebensfähig, sollte gated Zellen für zuverlässige Ergebnisse gezählt werden. </li><li> Wiederholen Sie die Schritte 3,1-3,3 mit dem gesammelten Strom durch Probe aus Schritt 3.1 und der ersten Strömung durch Probe aus Schritt 3.2 eine neue Spalte. Sie nicht die vorherige Spalte wiederverwenden. Durch die Verwendung der Kolben Luft in die Säule gedrückt werden, es blockier. </li><li> Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer. Abhängig von der Effizienz der Differenzierung von bis zu 6 x 10 6 Zellen kann zunächst und noch 1 x 10 6 Zellen sortiert werden , indem eine zweite Spalte bei 10 7 Zellen für das Verfahren. </li&gt; <li> Zentrifugieren der Zellen bei 300 xg für 5 min. Absaugen und der Überstand wird mit einer sterilen Pasteur-Glaspipette und Resuspendieren der Zellen in 1 ml Endoderm Induktionsmedium aus Schritt 1.9 mit zusätzlichen 10 &amp; mgr; M ROCK-Inhibitor. </li><li> Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer. Seed die Zellen bei einer geeigneten Dichte, dh ~ 4 x 10 5 Zellen pro Vertiefung einer 12-Well - Platte (ca. 3,6 cm 2 Fläche) oder ~ 1,5 x 10 5 Zellen pro Vertiefung eines 8-Well - Kammer-Folie. </li></ol> 4. Optional: Analyse von gereinigtem Definitive Endoderm Bevölkerung <ol><li> Für Immunfluoreszenzanfärbung fixieren die gereinigten Zellen aus Schritt 3.7 in etwa 24 Stunden nach der mit 4% Paraformaldehyd und Beize für die endgültige Endoderm (DE) und / oder Pluripotenz Markerproteine ​​Aussaat. HINWEIS: Häufig verwendete DE Marker umfassen FOXA2 und SOX17, häufig verwendete Pluripotenz Marker umfassen OCT3 / 4, NANOG und SOX2 6, 8. </li><li> for RT-qPCR-Analyse, ernten die gereinigten Zellen direkt oder 24 h nach dem Aussäen extrahieren Total-RNA und transkribieren Reverse-cDNA aus den extrahierten Gesamt-RNA-Proben. Verwenden , 10 ng cDNA als Matrize pro RT-qPCR - Reaktion (Triplikaten) 6, um die Expression von DE und Pluripotenz Markergene 8 zu analysieren. HINWEIS: Häufig verwendete Markergene werden in Schritt 4.1 erwähnt. Zyklusbedingungen sind 5 min bei 95 ° C und 40 Zyklen von 15 sec bei 95 ° C und 1 min bei 60 ° C, gefolgt von einer Schmelzkurvenanalyse. </li></ol>

<ol>
	<li>Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+Highly+Purified+Cardiomyocytes+from+Human+Induced+Pluripotent+Stem+Cells+Using+Small+Molecule-modulated+Differentiation+and+Subsequent+Glucose+Starvation.">Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation.</a> J Vis Exp. (97), (2015).</li><li>Sgodda, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+hepatic+differentiation+strategies+for+human+induced+pluripotent+stem+cells.">Improved hepatic differentiation strategies for human induced pluripotent stem cells.</a> Curr Mol Med. 13 (5), 842-855 (2013).</li><li>Naujok, O., Burns, C., Jones, P. M., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin-producing+surrogate+beta-cells+from+embryonic+stem+cells:+are+we+there+yet.">Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet.</a> Mol Ther. 19 (10), 1759-1768 (2011).</li><li>Katsirntaki, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+sublineage+specification+of+pluripotent+stem+cells:+effect+of+dexamethasone+plus+cAMP-elevating+agents+and+keratinocyte+growth+factor.">Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor.</a> Tissue Eng Part A. 21 (3-4), 669-682 (2015).</li><li>Abranches, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+differentiation+of+embryonic+stem+cells+in+vitro:+a+road+map+to+neurogenesis+in+the+embryo.">Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo.</a> PLoS One. 4 (7), e6286 (2009).</li><li>Naujok, O., Diekmann, U., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+generation+of+definitive+endoderm+from+human+embryonic+stem+cells+is+initially+independent+from+activin+A+but+requires+canonical+Wnt-signaling.">The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling.</a> Stem Cell Rev. 10 (4), 480-493 (2014).</li><li>D'Amour, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat Biotechnol. 24 (11), 1392-1401 (2006).</li><li>Diekmann, U., Lenzen, S., Naujok, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+and+efficient+protocol+for+human+pluripotent+stem+cell+differentiation+into+the+definitive+endoderm+based+on+dispersed+single+cells.">A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells.</a> Stem Cells Dev. 24 (2), 190-204 (2015).</li><li>Kim, P. T., Ong, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+definitive+endoderm+from+mouse+embryonic+stem+cells.">Differentiation of definitive endoderm from mouse embryonic stem cells.</a> Results Probl Cell Differ. 55, 303-319 (2012).</li><li>Katoh, M., Katoh, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomic+analyses+of+CXCR4:+transcriptional+regulation+of+CXCR4+based+on+TGFbeta,+Nodal,+Activin+signaling+and+POU5F1,+FOXA2,+FOXC2,+FOXH1,+SOX17,+and+GFI1+transcription+factors.">Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors.</a> Int J Oncol. 36 (2), 415-420 (2010).</li><li>Nostro, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+signaling+through+TGFbeta+family+members+and+WNT+regulates+patterning+and+pancreatic+specification+of+human+pluripotent+stem+cells.">Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells.</a> Development. 138 (5), 861-871 (2011).</li><li>Rezania, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+into+functional+islets+capable+of+treating+pre-existing+diabetes+in+mice.">Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice.</a> Diabetes. 61 (8), 2016-2029 (2012).</li><li>Bruin, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maturation+and+function+of+human+embryonic+stem+cell-derived+pancreatic+progenitors+in+macroencapsulation+devices+following+transplant+into+mice.">Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice.</a> Diabetologia. 56 (9), 1987-1998 (2013).</li><li>Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Residual+undifferentiated+cells+during+differentiation+of+induced+pluripotent+stem+cells+in+vitro+and+in+vivo.">Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo.</a> Stem Cells Dev. 21 (4), 521-529 (2012).</li><li>Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Teratoma+formation+by+human+embryonic+stem+cells:+evaluation+of+essential+parameters+for+future+safety+studies.">Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies.</a> Stem Cell Res. 2 (3), 198-210 (2009).</li><li>Herberts, C. A., Kwa, M. S., Hermsen, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Risk+factors+in+the+development+of+stem+cell+therapy.">Risk factors in the development of stem cell therapy.</a> J Transl Med. 9, 29 (2011).</li><li>Naujok, O., Kaldrack, J., Taivankhuu, T., J&#246;rns, A., Lenzen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+removal+of+undifferentiated+embryonic+stem+cells+from+differentiation+cultures+through+HSV1+thymidine+kinase+and+ganciclovir+treatment.">Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment.</a> Stem Cell Rev. 6 (3), 450-461 (2010).</li><li>Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+FACS+approach+isolates+hESC+derived+endoderm+using+transcription+factors.">A new FACS approach isolates hESC derived endoderm using transcription factors.</a> PLoS One. 6 (3), 17536 (2011).</li></ol>

The authors declare that they have no competing financial interests.

Derzeit verwendete Differenzierungsprotokolle ergeben sich selten 100% differenzierte Zellen. Aus Gründen, die noch einige Zellen angesprochen werden müssen widerstehen, den Differenzierungsprozess. Abhängig von der Effizienz der verwendeten Differenzierungsprotokoll und die Neigung des ESC Zeile eine bestimmte Anzahl von Rest pluripotenten Zellen häufig beobachtet werden, selbst nach der Differenzierung in die definitive Entoderm. Diese Restzellen können nachgeschaltete Differenzierungen beeinträchtigen oder weit...

Pluripotente Stammzellen wie embryonale Stammzellen (ES-Zellen) haben die Fähigkeit, in nahezu jedem Zelltyp des menschlichen Körpers zu unterscheiden. Somit können in vitro Differenzierungsprotokollen verwendet werden , um zahlreiche adulten Zelltypen wie Kardiomyozyten 1, Hepatozyten 2, beta - Zellen 3, 4 oder Lungenepithelzellen neuronalen Zellen 5 erzeugen. Dies macht WSR ein wertvolles Werkzeug für die mögliche Behandlung von verschiedenen degenerativen Erkrankungen 3. Die in vitro Differenzierung von ES- Zellen gegenüber adulten Geweben der Lunge, der Leber und der Bauchspeicheldrüse erfordert eine pseudo-Gastrulation in Zellen erinnert an die definitive Endoderm (DE) 6. Da stromabwärts Differenzierung gegenüber den zuvor erwähnten Arten somatischer Zellen wesentlich weniger effizient ist, wird eine optimale Differenzierung Endoderm gilt als geschwindigkeitsbestimmender 7. Die Zellen, die in Richtung der endoderm Linie begangen werden laufen characteristic Veränderungen in ihrem Genexpressionsprofil. Pluripotenz Master - Regulator - Gene herunterreguliert, während die Expression von anderen Transkriptionsfaktoren wie FOXA2, SOX17, HNF1B, die Mitglieder der GATA - Familie und der Oberflächenrezeptor CXCR4 hoch 6 hochreguliert wird, 8, 9. CXCR4 bekannt durch SMAD2 zu trans / 3, hinter Nodal / TGF-β - Signalisierung und SOX17 aufgrund der spezifischen Bindungsstellen in seiner Promotorregion 10. Somit ist es ein sehr geeignet in einer Reihe von Berichten verwendet Marker 6, 8, 11-13. Diese Expressions Änderungen spiegelt eine Pseudo-gastrulation Ereignis, bei dem WSR erste Merkmale eines primitiven streifenartige Zellpopulation zu erwerben und anschließend begehen in die endoderm Keimschicht 6. Allerdings sind Differenzierungsprotokolle selten 100% effizient wie wenige Zellen den Differenzierungsprozess widerstehen kann oder Differenzierung gegenüber anderen unbeabsichtigten Linien 14. Diese Zellen können sich negativ auf Influence weitere Differenzierung. Darüber hinaus bergen Rest undifferenzierten Zellen große Risiken für spätere Experimente Transplantation und kann zu teratomas 15-17 geben. So entfernen Sie können diese unerwünschten Zellen früh auf den Oberflächenmarker CXCR4 zur Reinigung von Zellen verwendet werden , die in Richtung der DE 18 verpflichtet sind. Hier beschreiben wir ein Verfahren für die positive Selektion von CXCR4 + -Zellen aus DE Differenzierungskulturen. Hierzu wird die Oberflächenmarker CXCR4 durch einen Antikörper gebunden, der dann wiederum mit magnetischen Microbeads bindet. Im Gegensatz zu den harten Bedingungen während FACS-Sortierung, die magnetisch markierten DE-ähnlichen Zellen können dann leicht in einem Benchtop-Format gereinigt werden, um eine sanfte Reinigungsverfahren verwendet wird. Dieses Protokoll stellt eine einfache Methode zur Entfernung von Zellpopulationen, die die DE Differenzierungsprozess widerstanden.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Hues8 human embryonic stem cell line</td>
			<td >Harvard Department of stem cell &#38; regenerative biology</td>
			<td >NA</td>
			<td >Suitable cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >Hes3 human embryonic stem cell line</td>
			<td >ES Cell International</td>
			<td >NA</td>
			<td >Suitable and robust cell line for endoderm generation</td>
		</tr>
		<tr >
			<td >mTeSR1</td>
			<td >Stemcell Technologies</td>
			<td >5850</td>
			<td >ESC culture medium</td>
		</tr>
		<tr >
			<td >FCS</td>
			<td >Biowest</td>
			<td >S1860</td>
			<td ></td>
		</tr>
		<tr >
			<td >Advanced RPMI 1640</td>
			<td >Life Technologies</td>
			<td >12633012</td>
			<td ></td>
		</tr>
		<tr >
			<td >CD184 (CXCR4)-APC, human</td>
			<td >Miltenyi Biotec</td>
			<td >130-098-357</td>
			<td ></td>
		</tr>
		<tr >
			<td >anti-APC MicroBeads</td>
			<td >Miltenyi Biotec</td>
			<td >130-090-855&#160;</td>
			<td ></td>
		</tr>
		<tr >
			<td >OctoMACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-109</td>
			<td >magnetic field</td>
		</tr>
		<tr >
			<td >Y-27632</td>
			<td >Selleck Chemicals</td>
			<td >S1049</td>
			<td >ROCK inhibitor</td>
		</tr>
		<tr >
			<td >CHIR-99021</td>
			<td >Tocris Bioscience</td>
			<td >4423</td>
			<td ></td>
		</tr>
		<tr >
			<td >Activin A</td>
			<td >Peprotech</td>
			<td >120-14</td>
			<td ></td>
		</tr>
		<tr >
			<td >Gentle Cell Dissociation Reagent</td>
			<td >Stemcell Technologies</td>
			<td >7174</td>
			<td >Enzyme-free passaging solution, alternative: Trypsin/EDTA</td>
		</tr>
		<tr >
			<td >Matrigel*</td>
			<td >Corning</td>
			<td >354277</td>
			<td >basement membrane matrix 
			 * solve and store in aliquots at -80 &#176;C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12. 
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature. 
Remove the matrigel and use immediately.
			</td>
		</tr>
		<tr >
			<td >MS Columns</td>
			<td >Miltenyi Biotec</td>
			<td >30-042-201</td>
			<td ></td>
		</tr>
		<tr >
			<td >MACS Separator</td>
			<td >Miltenyi Biotec</td>
			<td >130-042-302</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 FW gggagcggtgaagatgga</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human FOXA2 REV tcatgttgctcacggaggagta</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC FW gaggagaaagtggaggtctggtt</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human GSC REV ctctgatgaggaccgcttctg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >SOX17 TaqMan assay</td>
			<td >Applied Biosystems</td>
			<td >Hs00751752_s1</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 FW gatgctgggaaagtcgtggaagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human SOX7 REV tgcgcggccggtacttgtag</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 FW cttgctgcagaagtgggtggagg</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human POU5F1 REV ctgcagtgtgggtttcgggca</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog FW ccgagggcagacatcatcc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human Nanog REV ccatccactgccacatcttct</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP FW caa cag cct gcc acc tta cgc tc</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TBP REV agg ctg tgg ggt cag tcc agt g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A FW ggc agt gtt tgt aga ctt gga acc c</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human TUBA1A REV tgt gat aag ttg ctc agg gtg gaa g</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD FW agg ccg tca cca aga aca ttc a</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Human G6PD REV cga tga tgc ggt tcc agc cta t
</td>
			<td >Life Technologies</td>
			<td >NA</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX2</td>
			<td >Santa Cruz Biotechnology</td>
			<td >sc-17320</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-FOXA2</td>
			<td >MerckMillipore</td>
			<td >07-633</td>
			<td ></td>
		</tr>
		<tr >
			<td >Anti-SOX17</td>
			<td >R&#38;D Systems</td>
			<td >AF1924</td>
			<td ></td>
		</tr>
	
		<tr >
			<td ></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr >
			<td >NA = not applicable</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

a quick and efficient method for the purification of endoderm cells generated from human embryonic stem cells

Die Differenzierung Fähigkeiten von pluripotenten Stammzellen wie embryonale Stammzellen (ES-Zellen) ermöglichen eine mögliche therapeutische Anwendung für Zell-Ersatz-Therapien. Ausdifferenzierten Zelltypen könnten für die Behandlung von verschiedenen degenerativen Krankheiten verwendet werden. In vitro Differenzierung dieser Zellen gegenüber Geweben der Lunge, der Leber und der Bauchspeicheldrüse erfordert als ersten Schritt die Erzeugung von endgültigen endodermalen Zellen. Dieser Schritt ist geschwindigkeitsbestimmend für die weitere Differenzierung zu endständig gereiften Zelltypen, wie beispielsweise Insulin-produzierenden Beta-Zellen, Hepatozyten oder anderen Endoderm-abgeleiteten Zelltypen. Die Zellen, die in Richtung der endoderm Linie verpflichtet sind ausdrücken sehr eine Vielzahl von Transkriptionsfaktoren wie FOXA2, SOX17, HNF1B, die Mitglieder der GATA-Familie, und der Oberflächenrezeptor CXCR4. Allerdings Differenzierungsprotokolle sind selten 100% effizient. Hier beschreiben wir ein Verfahren zur Reinigung eines CXCR4 + Zellpopulation nach der Differenzierungin der DE durch magnetische Mikrokugeln verwendet. Diese Reinigung entfernt zusätzlich Zellen von unerwünschten Linien. Die sanfte Reinigungsverfahren ist schnell und zuverlässig und kann verwendet werden, Downstream-Anwendungen und Differenzierungen zu verbessern.

Bei der Differenzierung WSR laufen drastischen Veränderungen in der Gen und Proteinexpression. Figur 1 typische Markergene darstellt , die verwendet werden können , eine erfolgreiche Endoderm Differenzierung zu verifizieren. Prime Ziele für eine Genexpressionsanalyse sind GSC, FOXA2 und SOX17. In einer relativen Analyse der Genexpression insbesondere FOXA2 und SOX17 erhöht von&gt; 2.000 - fache , wenn si...

Watch this Scientific Journal Video about A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells at JoVE.com

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Hier beschreiben wir ein Verfahren zur Reinigung von differenzierten humanen embryonalen Stammzellen, die in Richtung der endgültigen Endoderm zur Verbesserung der Downstream-Anwendungen und weitere Differenzierungen begangen werden.

Eine schnelle und effiziente Methode zur Reinigung von Entodermzellen generiert aus humanen embryonalen Stammzellen

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

a-quick-efficient-method-for-purification-endoderm-cells-generated

Research

JoVE Journal

Developmental Biology

8.3K Aufrufe.  Hannover Medical School.  Hier beschreiben wir ein Verfahren zur Reinigung von differenzierten humanen embryonalen Stammzellen, die in Richtung der endgültigen Endoderm zur Verbesserung der Downstream-Anwendungen und weitere Differenzierungen begangen werden. 

Serie: A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Efficient Derivation of Retinal Pigment Epithelium Cells from Stem Cells

No cure has been discovered for age-related macular degeneration (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex multifactorial disease with an unknown etiology, although it is largely thought to occur due to death or dysfunction of the retinal pigment epithelium (RPE), a monolayer of cells that underlies the retina and provides critical support for photoreceptors. RPE cell replacement strategies may hold great promise for providing therapeutic relief for a large subset of AMD patients, and RPE cells that strongly resemble primary human cells (hRPE) have been generated in multiple independent labs, including our own. In addition, the uses for iPS-RPE are not limited to cell-based therapies, but also have been used to model RPE diseases. These types of studies may not only elucidate the molecular bases of the diseases, but also serve as invaluable tools for developing and testing novel drugs. We present here an optimized protocol for directed differentiation of RPE from stem cells. Adding nicotinamide and either Activin A or IDE-1, a small molecule that mimics its effects, at specific time points, greatly enhances the yield of RPE cells. Using this technique we can derive large numbers of low passage RPE in as early as three months.

Stem cell-derived retinal pigment epithelium (RPE) cells may be used for multiple applications including cell-based therapies for retinal degeneration, disease modeling, and drug studies. Here we present a simple protocol for reproducibly deriving RPE from stem cells.

Effiziente Ableitung von Retinapigmentepithel-Zellen aus Stammzellen

No cure has been discovered for age-related macular degeneration  (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex ...

Forschung

Entwicklungsbiologie

The Production of Pluripotent Stem Cells from Mouse Amniotic Fluid Cells Using a Transposon System

Induced pluripotent stem (iPS) cells are generated from mouse and human somatic cells by forced expression of defined transcription factors using different methods. Here, we produced iPS cells from mouse amniotic fluid cells, using a non-viral-based transposon system. All obtained iPS cell lines exhibited characteristics of pluripotent cells, including the ability to differentiate toward derivatives of all three germ layers in vitro and in vivo. This strategy opens up the possibility of using cells from diseased fetuses to develop new therapies for birth defects.

In this study, we generate induced pluripotent stem cells from mouse amniotic fluid cells, using a non-viral-based transposon system.

Die Herstellung von pluripotenten Stammzellen aus Maus Fruchtwasserzellen ein Transposon-System verwenden

Induced pluripotent stem (iPS) cells are generated from mouse and human somatic cells by forced expression of defined transcription factors using ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality microscopic images is not entirely dependent upon the quality of the microscope, but also upon the methods of tissue processing, which often involve multiple critical actions or steps. Furthermore, mesenchymal cell types in the skin and other tissues represent a new challenge for tissue preparation and imaging. Here, we present a complete process, from tissue harvest to microscopy. Our technique, called &#34;horizontal whole mount,&#34; is one that novices can quickly become proficient in and that allows for antigen preservation and detection in 60-300 &#181;m-thick sections cut with a cryostat. Sections of this thickness provide enhanced visualization of tissue microarchitecture in a three-dimensional environment. In addition, the protocol preserves mesenchymal cells in a manner that enhances image quality when compared to standard cryostat or paraffin sections, thereby increasing the efficacy and reliability of immunostaining. We believe that this protocol will benefit all laboratories that visualize skin, and possibly other tissues and organs.

This work presents a novel processing and imaging protocol for thick, three-dimensional tissue cross-section analysis that enables the full exploitation of confocal imaging modalities. This protocol preserves antigenicity and represents a robust system to analyze skin histology and potentially other tissue types.

Horizontale Ganze Mount: Ein neuartiges Verarbeitungs- und Imaging-Protokoll für dickes, dreidimensionales Gewebequerschnitt der Haut

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing a detailed and thorough protocol is to clearly demonstrate each step and to make this readily available to researchers in the field. This protocol results in a homogenous layer of RPE with minimal or no manual dissection needed. The method presented here has been shown to be effective for induced pluripotent stem cells (iPSC) and human embryonic stem cells. Additionally, we describe methods for cryopreservation of intermediate cell banks that allow long-term storage. RPE generated using this protocol might be useful for iPSC disease-in-a-dish modeling or clinical application.

This protocol describes how to produce retinal pigment epithelial cells (RPE) from pluripotent stem cells. The method uses a combination of growth factors and small molecules to direct the differentiation of stem cells into immature RPE in fourteen days and mature, functional RPE after three months.

Schnelle, gezielte Differenzierung der retinalen Pigment epithelialen Zellen aus menschlichen embryonalen oder induzierte pluripotente Stammzellen

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

Single-cell Photoconversion in Living Intact Zebrafish

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause disease when disrupted. Scientists have developed clever techniques to investigate characteristics and natural dynamics of these cells within intact tissue by expressing fluorescent proteins in subsets of cells. However, at times, experiments require more selected visualization of cells within the tissue, sometimes at the single-cell or population-of-cells manner. To achieve this and visualize single cells within a population of cells, scientists have utilized single-cell photoconversion of fluorescent proteins. To demonstrate this technique, we show here how to direct UV light to an Eos-expressing cell of interest in an intact, living zebrafish. We then image those photoconverted Eos+ cells 24 h later to determine how they changed in the tissue. We describe two techniques: single cell photoconversion and photoconversions of populations of cell. These techniques can be used to visualize cell-cell interactions, cell-fate and differentiation, and cell migrations, making it a technique that is applicable in numerous biological questions.

Here, we present a protocol to show how cell photoconversion is achieved through UV exposure to specific areas expressing the fluorescent protein, Eos, in living animals.

Einzellige Ladungszustand im lebendigen intakten Zebrafisch

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and chromosome dynamics. While the germline is an excellent model, the analysis is often two dimensional due to the time and labor required for three-dimensional analysis. Major readouts in such studies are the number/position of nuclei and protein distribution within the germline. Here, we present a method to perform automated analysis of the germline using confocal microscopy and computational approaches to determine the number and position of nuclei in each region of the germline. Our method also analyzes germline protein distribution that enables the three-dimensional examination of protein expression in different genetic backgrounds. Further, our study shows variations in cytoskeletal architecture in distinct regions of the germline that may accommodate specific spatial developmental requirements. Finally, our method enables automated counting of the sperm in the spermatheca of each germline. Taken together, our method enables rapid and reproducible phenotypic analysis of the C. elegans germline.

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

We present an automated method for three-dimensional reconstruction of the Caenorhabditis elegans germline. Our method determines the number and position of each nucleus within the germline and analyses germline protein distribution and cytoskeletal structure.

Computergestützte Analyse der Keimbahn Caenorhabditis Elegans , die Verteilung der Kerne, Proteine und das Zytoskelett zu studieren

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Efficient and Scalable Directed Differentiation of Clinically Compatible Corneal Limbal Epithelial Stem Cells from Human Pluripotent Stem Cells

Corneal limbal epithelial stem cells (LESCs) are responsible for continuously renewing the corneal epithelium, and thus maintaining corneal homeostasis and visual clarity. Human pluripotent stem cell (hPSC)-derived LESCs provide a promising cell source for corneal cell replacement therapy. Undefined, xenogeneic culture and differentiation conditions cause variation in research results and impede the clinical translation of hPSC-derived therapeutics. This protocol provides a reproducible and efficient method for hPSC-LESC differentiation under xeno- and feeder cell-free conditions. Firstly, monolayer culture of undifferentiated hPSC on recombinant laminin-521 (LN-521) and defined hPSC medium serves as a foundation for robust production of high-quality starting material for differentiations. Secondly, a rapid and simple hPSC-LESC differentiation method yields LESC populations in only 24 days. This method includes a four-day surface ectodermal induction in suspension with small molecules, followed by adherent culture phase on LN-521/collagen IV combination matrix in defined corneal epithelial differentiation medium. Cryostoring and extended differentiation further purifies the cell population and enables banking of the cells in large quantities for cell therapy products. The resulting high-quality hPSC-LESCs provide a potential novel treatment strategy for corneal surface reconstruction to treat limbal stem cell deficiency (LSCD).

This protocol introduces a simple two-step method for differentiating corneal limbal epithelial stem cells from human pluripotent stem cells under xeno- and feeder cell-free culture conditions. The cell culture methods presented here enable cost-efficient, large-scale production of clinical quality cells applicable to corneal cell therapy use.

Effiziente und skalierbare gerichtete Differenzierung von klinisch kompatibel Hornhaut limbischen epithelialen Stammzellen aus menschlichen pluripotenten Stammzellen

Corneal limbal epithelial stem cells (LESCs) are responsible for continuously renewing the corneal epithelium, and thus maintaining corneal homeostasis ...

Efficient Differentiation of Human Pluripotent Stem Cells into Liver Cells

The liver detoxifies harmful substances, secretes vital proteins, and executes key metabolic activities, thus sustaining life. Consequently, liver failure&#8212;which can be caused by chronic alcohol intake, hepatitis, acute poisoning, or other insults&#8212;is a severe condition that can culminate in bleeding, jaundice, coma, and eventually death. However, approaches to treat liver failure, as well as studies of liver function and disease, have been stymied in part by the lack of a plentiful supply of human liver cells. To this end, this protocol details the efficient differentiation of human pluripotent stem cells (hPSCs) into hepatocyte-like cells, guided by a developmental roadmap that describes how liver fate is specified across six consecutive differentiation steps. By manipulating developmental signaling pathways to promote liver differentiation and to explicitly suppress the formation of unwanted cell fates, this method efficiently generates populations of human liver bud progenitors and hepatocyte-like cells by days 6 and 18 of PSC differentiation, respectively. This is achieved through the temporally-precise control of developmental signaling pathways, exerted by small molecules and growth factors in a serum-free culture medium. Differentiation in this system occurs in monolayers and yields hepatocyte-like cells that express characteristic hepatocyte enzymes and have the ability to engraft a mouse model of chronic liver failure. The ability to efficiently generate large numbers of human liver cells in vitro has ramifications for treatment of liver failure, for drug screening, and for mechanistic studies of liver disease.

This protocol details a monolayer, serum-free method to efficiently generate hepatocyte-like cells from human pluripotent stem cells (hPSCs) in 18 days. This entails six steps as hPSCs sequentially differentiate into intermediate cell-types such as the primitive streak, definitive endoderm, posterior foregut and liver bud progenitors before forming hepatocyte-like cells.

Effiziente Differenzierung menschlicher pluripotenter Stammzellen in Leberzellen

The liver detoxifies harmful substances, secretes vital proteins, and executes key metabolic activities, thus sustaining life. Consequently, liver ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

In vitro-Generation der Somiten Derivate aus menschlichen induzierten Zellen pluripotenten Stammzellen

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

A Static Self-Directed Method for Generating Brain Organoids from Human Embryonic Stem Cells

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a three-dimensional system. Here we present a relatively straightforward and inexpensive method that yields brain organoids. In this protocol human pluripotent stem cells are broken into small clusters instead of single cells and grown in basic media without a heterologous basement membrane matrix or exogenous growth factors, allowing the intrinsic developmental cues to shape the organoid&#39;s growth. This simple system produces a diversity of brain cell types including glial and microglial cells, stem cells, and neurons of the forebrain, midbrain, and hindbrain. Organoids generated from this protocol also display hallmarks of appropriate temporal and spatial organization demonstrated by brightfield images, histology, immunofluorescence and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). Because these organoids contain cell types from various parts of the brain, they can be utilized for studying a multitude of diseases. For example, in a recent paper we demonstrated the use of organoids generated from this protocol for studying the effects of hypoxia on the human brain. This approach can be used to investigate an array of otherwise difficult to study conditions such as neurodevelopmental handicaps, genetic disorders, and neurologic diseases.

This protocol was generated as a means to produce brain organoids in a simplified, low cost manner without exogenous growth factors or basement membrane matrix while still maintaining the diversity of brain cell types and many features of cellular organization.

Eine statische selbstgesteuerte Methode zur Generierung von Hirnorganoiden aus menschlichen embryonalen Stammzellen

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a ...