We thank Erin Zoller, Jessica Bene, and Lindsey Hays for input and direction in protocol development. MTW was supported in part by NIH R21 HG008186 and a Trustee Award grant from the Cincinnati Children's Hospital Research Foundation. ZHP was supported in part by T32 GM063483-13.

1. Preparation of Solutions and Reagents
<ol>
	<li>Order custom DNA oligonucleotide probes for use in EMSA and DAPA.
	<ol>
		<li>To reduce non-specific protein binding, design short oligos (between 35-45 base pairs (bp) in length)30, and place the variant of interest directly in the center flanked by its 17 bp endogenous genomic sequence. For EMSA oligos, add a 5&#39; fluorophore. For DAPA oligos, add a 5&#39; biotin tag.</li>
		<li>Order both the sense strand and its reverse complement strand. Alternatively, order duplex (pre-annealed) oligos. When naming the oligos, base the nomenclature on an established reference genome. 
		Note: &#34;Risk&#34; and &#34;non-risk&#34; designation can be disease and project specific, while &#34;reference&#34; and &#34;non-reference&#34; are more universally relevant.</li>
		<li>Upon arrival of the oligos, briefly spin down the contents and resuspend in nuclease-free water to a final concentration of 100 &#181;M. Store resuspended stock at -20 &#176;C. Protect oligos tagged with a fluorophore from light by wrapping with aluminum foil.</li>
	</ol>
	</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td>rs76562819_REF_FOR</td>
			<td>GTAATGCCTTAATGAGAGAGAGTTAGTCATCTTCTCACTTC</td>
		</tr>
		<tr>
			<td>rs76562819_REF_REV</td>
			<td>GAAGTGAGAAGATGACTAACTCTCTCTCATTAAGGCATTAC</td>
		</tr>
		<tr>
			<td>rs76562819_NONREF_FOR</td>
			<td>GTAATGCCTTAATGAGAGAGGGTTAGTCATCTTCTCACTTC</td>
		</tr>
		<tr>
			<td>rs76562819_NONREF_REV</td>
			<td>GAAGTGAGAAGATGACTAACCCTCTCTCATTAAGGCATTAC</td>
		</tr>
	</tbody>
</table>
Table 1: Example EMSA/DAPA oligonucleotide design to test a SNP for differential binding. &#34;REF&#34; stands for the reference allele, while &#34;NONREF&#34; stands for the non-reference allele. &#34;FOR&#34; stands for the forward strand, while &#34;REV&#34; indicates its complement. The SNP is seen in red. 
<ol start="2">
	<li>Prepare cytoplasmic extraction (CE) buffer with a final concentration of 10 mM HEPES (pH 7.9), 10 mM KCl, and 0.1 mM EDTA in deionized water.</li>
	<li>Prepare nuclear extraction (NE) buffer with a final concentration of 20 mM HEPES (pH 7.9), 0.4 M NaCl, and 1 mM EDTA in deionized water.</li>
	<li>Prepare annealing buffer with a final concentration of 10 mM Tris (pH 7.5-8.0), 50 mM NaCl, and 1 mM EDTA in deionized water.</li>
</ol>
2. Preparation of Nuclear Lysate from Cultured Cells
Note: This experimental protocol was optimized using B-lymphoblastoid cell lines, but has been tested in several other unrelated adherent/ suspension cell lines and works universally.
<ol>
	<li>Culture B-lymphoblastoid cells in Roswell Park Memorial Institute (RPMI) 1640 with 2 mM L-glutamine, 10% fetal bovine serum, and 1x antibiotic-antimycotic containing 100 units/ml of penicillin, 100 &#181;g/ml of streptomycin, and 250 ng/ml of amphotericin B.
	<ol>
		<li>Seed at a range of 200,000-500,000 viable cells/ml and incubate flasks at 37 &#176;C with 5% carbon dioxide in an upright position with vented or loose caps. 
		Note: The growth of B-lymphoblastoid cells slows when they reach over 1,000,000 cells/ml. Break up cell blasts by pipetting up and down several times and return cells to 200,000-500,000 cells/ml to maintain a rapid rate of growth.</li>
	</ol>
	</li>
	<li>Wash cultured cells twice with 10 ml ice cold phosphate buffered saline (PBS), spin down at 4 &#176;C, 300 x g for 5 min and remove PBS via aspiration.</li>
	<li>Count cells using a hemocytometer and resuspend pellet as 1 ml ice cold PBS per 107 cells. 
	Note: For example, if lysing 2 x 107 cells, resuspend in 2 ml PBS.</li>
	<li>Aliquot 1 ml to 1.5 ml microcentrifuge tubes so that each tube contains 107 cells in PBS. Centrifuge at 3,300 x g for 2 min 4 &#176;C and aspirate off PBS.</li>
	<li>Prior to use, add 1 mM dithiothreitol (DTT), 1x phosphatase inhibitor, and 1x protease inhibitor to a working stock of CE buffer. Resuspend cell pellet with 400 &#181;l of CE buffer and incubate on ice for 15 minutes.</li>
	<li>Add 25 &#181;l of 10% Nonidet P-40 and mix by pipetting. Centrifuge at 4 &#176;C, max speed for 3 min. Decant and discard the supernatant.</li>
	<li>Prior to use, add 1 mM DTT, 1x phosphatase inhibitor, and 1x protease inhibitor&#160;to a working stock of NE buffer. Resuspend cell pellet with 30 &#181;l of NE buffer and mix by vortexing.</li>
	<li>Incubate at 4 &#176;C in a tube rotator or on ice for 10 min. Centrifuge 3,300 x g for 2 min 4 &#176;C.</li>
	<li>Collect the clear supernatant (nuclear lysate) and aliquot before storing at -80 &#176;C to avoid multiple freeze-thaw cycles that may degrade the protein. Leave a 10 &#181;l aliquot to measure protein concentration using the bichoninic acid assay (BCA)31.</li>
</ol>
3. Electrophoretic Mobility Shift Assay (EMSA)
<ol>
	<li>Prepare Oligo Working Stock and EMSA Gel.
	<ol>
		<li>If oligos were ordered in duplex, thaw the 100 &#181;M stock and dilute 1:2,000 in annealing buffer to achieve a 50 nM working stock.</li>
		<li>If oligos were ordered single-stranded, thaw the 100 &#181;M stocks and dilute 1:10 in annealing buffer to achieve 100 nM working stocks. Combine 100 &#181;l of the 100 nM complement strand solution with each other in a microcentrifuge tube.
		<ol>
			<li>Place in a heat block at 95 &#176;C for 5 min. Turn off the heat block and allow the oligos to slowly cool down to room temperature for at least one hour prior to use.</li>
		</ol>
		</li>
		<li>Pre-run the EMSA Gel.
		<ol>
			<li>Remove the slide from a pre-cast 6% TBE gel and rinse under deionized water several times to remove any buffer from the wells. Prepare 1 L of 0.5x TBE buffer by adding 50 mL of 10x TBE to 950 ml of deionized water.</li>
			<li>Assemble the gel electrophoresis apparatus and check for leaks by filling the inner chamber with 0.5x TBE buffer. If no buffer leaks into the outer chamber, fill the outer chamber roughly two thirds of the way.</li>
			<li>Pre-run the gel at 100 V for 60 min.</li>
			<li>Flush each well with 200 &#181;l of 0.5x TBE buffer.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Prepare Binding Buffer Master Mix.
	<ol>
		<li>Prepare 10x binding buffer with a final concentration of 100 mM Tris, 500 mM KCl, 10 mM DTT; pH 7.5 in deionized water.</li>
		<li>In a microcentrifuge tube, create a master mix consisting of the reagents common to all reactions (10 &#181;l 10x binding buffer, 10 &#181;l DTT/polysorbate, 5 &#181;l Poly d(I-C), and 2.5 &#181;l salmon sperm DNA; Table 2). Prepare an additional 10% to account for volume loss due to pipetting.</li>
	</ol>
	</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>Final Conc.</td>
			<td>Rxn #1</td>
			<td>Rxn #2</td>
			<td>Rxn #3</td>
			<td>Rxn #4</td>
		</tr>
		<tr>
			<td>Ultrapure Water</td>
			<td>to 20 &#181;l vol.</td>
			<td>13.5 &#181;l</td>
			<td>11.98 &#181;l</td>
			<td>13.5&#181;l</td>
			<td>11.98 &#181;l</td>
		</tr>
		<tr>
			<td>10x Binding Buffer</td>
			<td>1x</td>
			<td>2 &#956;l</td>
			<td>2 &#956;l</td>
			<td>2 &#956;l</td>
			<td>2 &#181;l</td>
		</tr>
		<tr>
			<td>DTT/TW-20</td>
			<td>1x</td>
			<td>2 &#956;l</td>
			<td>2 &#956;l</td>
			<td>2 &#956;l</td>
			<td>2 &#956;l</td>
		</tr>
		<tr>
			<td>Salmon Sperm DNA</td>
			<td>500 ng/&#956;l</td>
			<td>0.5 &#956;l</td>
			<td>0.5 &#956;l</td>
			<td>0.5 &#956;l</td>
			<td>0.5 &#956;l</td>
		</tr>
		<tr>
			<td>1&#956;g/&#956;l Poly d(I-C)</td>
			<td>1 &#956;g</td>
			<td>1 &#956;l</td>
			<td>1 &#956;l</td>
			<td>1 &#956;l</td>
			<td>1 &#956;l</td>
		</tr>
		<tr>
			<td>Nuclear Extract (5.26 ug/&#181;l)</td>
			<td>8 &#956;g</td>
			<td>-</td>
			<td>1.52 &#956;l</td>
			<td>-</td>
			<td>1.52 &#956;l</td>
		</tr>
		<tr>
			<td>NE Buffer</td>
			<td></td>
			<td>1.52 &#956;l</td>
			<td>-</td>
			<td>1.52 &#956;l</td>
			<td>-</td>
		</tr>
		<tr>
			<td>Reference allele oligo</td>
			<td>50 fmol</td>
			<td>1 &#956;l</td>
			<td>1 &#956;l</td>
			<td>-</td>
			<td>-</td>
		</tr>
		<tr>
			<td>Non-Reference allele oligo</td>
			<td>50 fmol</td>
			<td>-</td>
			<td>-</td>
			<td>1 &#956;l</td>
			<td>1 &#956;l</td>
		</tr>
	</tbody>
</table>
Table 2: Example EMSA reaction setup. The table illustrates an example EMSA to test the hypothesis that there is genotype-dependent binding of TFs to a specific SNP.
<ol start="3">
	<li>Add nuclease-free water to each microcentrifuge tube such that the final volume following addition of all reagents will be 20 &#181;l.</li>
	<li>Add the appropriate amount (5.5 &#181;l) of master mix to each microcentrifuge tube.</li>
	<li>Add 8 &#181;g of nuclear lysate to the appropriate microcentrifuge tubes. Include tubes containing the oligo without nuclear extract as negative controls (e.g. Table 2, Rxn #1 and Rxn #3). 
	Note: The optimal amount of lysate per reaction must be determined experimentally by titration. Generally, titrating a range of 2-10 &#181;g of lysate is sufficient.</li>
	<li>Add 50 fmol of oligo to the appropriate microcentrifuge tubes. Flick to mix and briefly spin the contents to the bottom of the tube. Incubate for 20 min at room temperature. 
	Note: If attempting a supershift, incubate the lysate mixture with antibody for 20 min at room temperature prior to the addition of oligos. It is recommended to use 1 &#181;g of a ChIP-grade antibody for best results.</li>
	<li>Add 2 &#181;l of 10x Orange Loading Dye to each microcentrifuge tube. Pipette up and down to mix.</li>
	<li>Load the samples into the pre-run 6% TBE gel by pipetting up and down to mix and then expelling each sample into a separate well. Run the gel at 80 V until the orange dye has migrated 2/3 to 3/4 of the way down the gel. This should take approximately 60-75 min.</li>
	<li>Remove the gel from the plastic cassette by prying it open with a gel knife and place the gel in a container with 0.5% TBE buffer to keep it from drying out.</li>
	<li>Place the gel on the surface of an infrared and chemiluminescence imaging system, being sure to eliminate any bubbles or contaminants that will disrupt the image.</li>
	<li>Using the scanning system software, click the &#34;Acquire&#34; tab and then select &#34;Draw New&#34; to draw a box around the area corresponding to where the gel is located on the surface of the scanner.</li>
	<li>In the &#34;Channels&#34; section of the &#34;Acquire&#34; tab, select the channel corresponding to the wavelength of the fluorophore tag on the oligo. In the &#34;Scanner&#34; section, click &#34;preview&#34; to get a low-quality preview scan. Adjust the scan area by dragging the blue box surrounding the acquired preview image down to the portion of the gel to be imaged. 
	Note: For example, if using oligos labeled with a 700 nm fluorophore, make sure the &#34;700 nm&#34; channel is selected before scanning.</li>
	<li>In the &#34;Scan Controls&#34; section, select the &#34;84 &#181;M&#34; resolution option and the &#34;Medium&#34; quality option. Set the focus to offset to half the thickness of the gel. Note: For example, a 1 mm gel would use a 0.5 mm focus offset.</li>
	<li>In the &#34;Scanner&#34; section, click &#34;Start&#34; to begin the scan. 
	Note: During the scan, the brightness, contrast, and color scheme can often be adjusted manually depending on the manufacturer of the scanning system.</li>
	<li>After the scan has finished, select the &#34;Image&#34; tab and click &#34;Rotate or Flip&#34; in the &#34;Create&#34; section to correct the orientation. Save the image file by clicking &#34;Export&#34; in the main menu and then select &#34;Single Image View.&#34;</li>
</ol>
4. DNA Affinity Purification Assay (DAPA)
<ol>
	<li>Preparation of 5 &#181;M Oligo Working Stock.
	<ol>
		<li>If oligos were ordered in duplex, thaw the 100 &#181;M stock and dilute 1:20 in annealing buffer to achieve a 5 &#181;M working stock.</li>
		<li>If oligos were ordered single-stranded, thaw the 100 &#181;M stocks and dilute 1:10 in annealing buffer to achieve 10 &#181;M working stocks. Combine 10 &#181;l of the 10 &#181;M complementary strands with each other. Place in a heat block at 95 &#176;C for 5 min. Turn off the heat block and allow the oligos to slowly cool down to room temperature prior to use.</li>
	</ol>
	</li>
	<li>Before starting, warm the binding buffer, low stringency wash buffer, high stringency wash buffer, and elution buffer to room temperature. 
	Note: A final concentration of 50 ng/mL Poly d(I-C) can be added to the binding buffer, low stringency wash buffer, and high stringency wash buffer to reduce potential non-specific binding of proteins to the oligos.</li>
	<li>Prepare the binding mixtures for each variant.
	<ol>
		<li>Mix 1 volume of nuclear lysate with 2 volumes of binding buffer. 
		Note: The required amount of lysate must be determined experimentally due to varying abundance of TFs. Using between 100-250 &#181;g of nuclear lysate per column is sufficient in most cases.</li>
		<li>Add 1x phosphatase inhibitor,&#160;1x protease inhibitor, and 1x binding enhancer (optional) and mix by flicking the tube several times. 
		Note: 100x binding enhancer consists of 750 mM MgCl2 and 300mM ZnCl2. Add binding enhancer if the binding of the TF to DNA depends on cofactors or reducing agents. If this information is not known, add the binding enhancer.</li>
		<li>Add 10 &#181;l of 5 &#181;M biotinylated capture DNA (50 pmol) to each respective binding mixture. Incubate for 20 min at room temperature. 
		Note: Incubation time and temperature may vary depending on the TF. The optimal values need to be determined experimentally.</li>
	</ol>
	</li>
	<li>Add 100 &#181;l of streptavidin microbeads. Incubate for 10 min at room temperature.</li>
	<li>For each oligo probe being tested, place a binding column in the magnetic separator. Place a microcentrifuge tube directly under each binding column and apply 100 &#181;l of binding buffer to rinse the column.</li>
	<li>Pipette the contents of each binding mixture into separate columns and allow the liquid to flow completely through the column into the microcentrifuge tube before proceeding. Make sure to label the columns with the variant oligo that was used in the binding mixture. Label the flow-through samples and replace with new microcentrifuge tubes to collect the low-stringency washes.</li>
	<li>Apply 100 &#181;l of low-stringency wash buffer to the column; wait until the column reservoir is empty. Repeat wash 4x. Label the low-stringency wash samples and replace with new microcentrifuge tubes to collect the high-stringency washes.</li>
	<li>Apply 100 &#181;l of high-stringency wash buffer to the column; wait until the column reservoir is empty. Repeat wash 4x. Label the high-stringency wash samples and replace with new microcentrifuge tubes to collect the pre-elution.</li>
	<li>Add 30 &#181;l of native elution buffer to the column and let stand for 5 min. Label the pre-elution samples and replace with new microcentrifuge tubes to collect the elution. 
	Note: This does not elute the bound protein; it washes the remaining high-stringency buffer out of the column and replaces it with elution buffer to maximize the efficiency of the elution.</li>
	<li>Add an additional 50 &#181;l native elution buffer to elute the bound TFs. For a higher yield but less concentrated eluate, add an additional 50 &#181;l of native elution buffer and collect the flow-through. 
	Note: Analyze elution samples through mass spectrometry to determine the identity of the bound TFs32. Afterwards, verify the proteomic results through sodium dodecyl sulfite polyacrylamide gel electrophoresis (SDS-PAGE) followed by a Western blot33. If mass spectrometry is not available, run a silver stain using standard technique instead of a Western blot to determine the size of the protein(s) showing genotype-dependent binding. Use this information to narrow down the list of predicted TFs from the computational approaches detailed in the introduction.</li>
</ol>

<ol>
	<li>Hindorff, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potential+etiologic+and+functional+implications+of+genome-wide+association+loci+for+human+diseases+and+traits.">Potential etiologic and functional implications of genome-wide association loci for human diseases and traits.</a> Proc Natl Acad Sci U S A. 106 (23), 9362-9367 (2009).</li><li>Maurano, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+localization+of+common+disease-associated+variation+in+regulatory+DNA.">Systematic localization of common disease-associated variation in regulatory DNA.</a> Science. 337 (6099), 1190-1195 (2012).</li><li>Ward, L. D., Kellis, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interpreting+noncoding+genetic+variation+in+complex+traits+and+human+disease.">Interpreting noncoding genetic variation in complex traits and human disease.</a> Nat Biotechnol. 30 (11), 1095-1106 (2012).</li><li>Paul, D. S., Soranzo, N., Beck, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+interpretation+of+non-coding+sequence+variation:+concepts+and+challenges.">Functional interpretation of non-coding sequence variation: concepts and challenges.</a> Bioessays. 36 (2), 191-199 (2014).</li><li>Zhang, F., Lupski, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-coding+genetic+variants+in+human+disease.">Non-coding genetic variants in human disease.</a> Hum Mol Genet. , (2015).</li><li>Lee, T. I., Young, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulation+and+its+misregulation+in+disease.">Transcriptional regulation and its misregulation in disease.</a> Cell. 152 (6), 1237-1251 (2013).</li><li>Slatkin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Linkage+disequilibrium--understanding+the+evolutionary+past+and+mapping+the+medical+future.">Linkage disequilibrium--understanding the evolutionary past and mapping the medical future.</a> Nat Rev Genet. 9 (6), 477-485 (2008).</li><li>Bush, W. S., Moore, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+11:+Genome-wide+association+studies.">Chapter 11: Genome-wide association studies.</a> PLoS Comput Biol. 8 (12), e1002822 (2012).</li><li>1000 Genomes Project Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+map+of+genetic+variation+from+1,092+human+genomes.">An integrated map of genetic variation from 1,092 human genomes.</a> Nature. 491 (7422), 56-65 (2012).</li><li>Chang, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Second-generation+PLINK:+rising+to+the+challenge+of+larger+and+richer+datasets.">Second-generation PLINK: rising to the challenge of larger and richer datasets.</a> Gigascience. 4, 7 (2015).</li><li>Purcell, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PLINK:+a+tool+set+for+whole-genome+association+and+population-based+linkage+analyses.">PLINK: a tool set for whole-genome association and population-based linkage analyses.</a> Am J Hum Genet. 81 (3), 559-575 (2007).</li><li>ENCODE Project Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Crawford, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+mapping+of+DNase+hypersensitive+sites+using+massively+parallel+signature+sequencing+(MPSS).">Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS).</a> Genome Res. 16 (1), 123-131 (2006).</li><li>Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposition+of+native+chromatin+for+fast+and+sensitive+epigenomic+profiling+of+open+chromatin,+DNA-binding+proteins+and+nucleosome+position.">Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position.</a> Nat Methods. 10 (12), 1213-1218 (2013).</li><li>Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FAIRE+Formaldehyde-Assisted+Isolation+of+Regulatory+Elements)+isolates+active+regulatory+elements+from+human+chromatin.">FAIRE Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin.</a> Genome Res. 17 (6), 877-885 (2007).</li><li>Kent, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+genome+browser+at+UCSC.">The human genome browser at UCSC.</a> Genome Res. 12 (6), 996-1006 (2002).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Martens, J. H., Stunnenberg, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLUEPRINT:+mapping+human+blood+cell+epigenomes.">BLUEPRINT: mapping human blood cell epigenomes.</a> Haematologica. 98 (10), 1487-1489 (2013).</li><li>Liu, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cistrome:+an+integrative+platform+for+transcriptional+regulation+studies.">Cistrome: an integrative platform for transcriptional regulation studies.</a> Genome Biol. 12 (8), R83 (2011).</li><li>Griffon, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+public+ChIP-seq+experiments+reveals+a+complex+multi-cell+regulatory+landscape.">Integrative analysis of public ChIP-seq experiments reveals a complex multi-cell regulatory landscape.</a> Nucleic Acids Res. 43 (4), e27 (2015).</li><li>Staudt, L. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lymphoid-specific+protein+binding+to+the+octamer+motif+of+immunoglobulin+genes.">A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes.</a> Nature. 323 (6089), 640-643 (1986).</li><li>Singh, H., Sen, R., Baltimore, D., Sharp, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nuclear+factor+that+binds+to+a+conserved+sequence+motif+in+transcriptional+control+elements+of+immunoglobulin+genes.">A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes.</a> Nature. 319 (6049), 154-158 (1986).</li><li>Weirauch, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+and+inference+of+eukaryotic+transcription+factor+sequence+specificity.">Determination and inference of eukaryotic transcription factor sequence specificity.</a> Cell. 158 (6), 1431-1443 (2014).</li><li>Ward, L. D., Kellis, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HaploReg:+a+resource+for+exploring+chromatin+states,+conservation,+and+regulatory+motif+alterations+within+sets+of+genetically+linked+variants.">HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants.</a> Nucleic Acids Res. 40 (Database issue), D930-D934 (2012).</li><li>Boyle, A. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotation+of+functional+variation+in+personal+genomes+using+RegulomeDB.">Annotation of functional variation in personal genomes using RegulomeDB.</a> Genome Res. 22 (9), 1790-1797 (2012).</li><li>Hume, M. A., Barrera, L. A., Gisselbrecht, S. S., Bulyk, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniPROBE,+update+2015:+new+tools+and+content+for+the+online+database+of+protein-binding+microarray+data+on+protein-DNA+interactions.">UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions.</a> Nucleic Acids Res. 43 (Database issue), D117-D122 (2015).</li><li>Mathelier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JASPAR+2014:+an+extensively+expanded+and+updated+open-access+database+of+transcription+factor+binding+profiles.">JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles.</a> Nucleic Acids Res. 42 (Database issue), 142-147 (2014).</li><li>Smith, M. F., Delbary-Gossart, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+Mobility+Shift+Assay+(EMSA).">Electrophoretic Mobility Shift Assay (EMSA).</a> Methods Mol Med. 50, 249-257 (2001).</li><li>Franza, B. R., Josephs, S. F., Gilman, M. Z., Ryan, W., Clarkson, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+cellular+proteins+recognizing+the+HIV+enhancer+using+a+microscale+DNA-affinity+precipitation+assay.">Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay.</a> Nature. 330 (6146), 391-395 (1987).</li><li>. BCA Protein Assay Kit: User Guide Available from: <a target="_blank" href="https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf">https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf</a> (2014)</li><li>Wijeratne, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phosphopeptide+separation+using+radially+aligned+titania+nanotubes+on+titanium+wire.">Phosphopeptide separation using radially aligned titania nanotubes on titanium wire.</a> ACS Appl Mater Interfaces. 7 (21), 11155-11164 (2015).</li><li>Silva, J. M., McMahon, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Fastest+Western+in+Town:+A+Contemporary+Twist+on+the+Classic+Western+Blot+Analysis.">The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis.</a> J. Vis. Exp. (84), (2014).</li><li>Lu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lupus+Risk+Variant+Increases+pSTAT1+Binding+and+Decreases+ETS1+Expression.">Lupus Risk Variant Increases pSTAT1 Binding and Decreases ETS1 Expression.</a> Am J Hum Genet. 96 (5), 731-739 (2015).</li><li>Ramana, C. V., Chatterjee-Kishore, M., Nguyen, H., Stark, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complex+roles+of+Stat1+in+regulating+gene+expression.">Complex roles of Stat1 in regulating gene expression.</a> Oncogene. 19 (21), 2619-2627 (2000).</li><li>Fillebeen, C., Wilkinson, N., Pantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+Mobility+Shift+Assay+(EMSA)+for+the+Study+of+RNA-Protein+Interactions:+The+IRE/IRP+Example.">Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example.</a> J. Vis. Exp. (94), e52230 (2014).</li><li>Heng, T. S., Painter, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunological+Genome+Project,+C.+The+Immunological+Genome+Project:+networks+of+gene+expression+in+immune+cells.">Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells.</a> Nat Immunol. 9 (10), 1091-1094 (2008).</li><li>Wu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioGPS:+an+extensible+and+customizable+portal+for+querying+and+organizing+gene+annotation+resources.">BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources.</a> Genome Biol. 10 (11), R130 (2009).</li><li>Wu, C., Macleod, I., Su, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioGPS+and+MyGene.info:+organizing+online,+gene-centric+information.">BioGPS and MyGene.info: organizing online, gene-centric information.</a> Nucleic Acids Res. 41 (Database issue), D561-D565 (2013).</li><li>Wang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+features+and+chromatin+structure+around+the+genomic+regions+bound+by+119+human+transcription+factors.">Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors.</a> Genome Res. 22 (9), 1798-1812 (2012).</li><li>Holden, N. S., Tacon, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Principles+and+problems+of+the+electrophoretic+mobility+shift+assay.">Principles and problems of the electrophoretic mobility shift assay.</a> J Pharmacol Toxicol Methods. 63 (1), 7-14 (2011).</li><li>Xu, J., Liu, H., Park, J. S., Lan, Y., Jiang, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Osr1+acts+downstream+of+and+interacts+synergistically+with+Six2+to+maintain+nephron+progenitor+cells+during+kidney+organogenesis.">Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis.</a> Development. 141 (7), 1442-1452 (2014).</li><li>Yang, T. -. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genevar:+a+database+and+Java+application+for+the+analysis+and+visualization+of+SNP-gene+associations+in+eQTL+studies.">Genevar: a database and Java application for the analysis and visualization of SNP-gene associations in eQTL studies.</a> Bioinformatics. 26 (19), 2474-2476 (2010).</li><li>Fort, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+liver+enhancer+in+the+fibrinogen+gene+cluster.">A liver enhancer in the fibrinogen gene cluster.</a> Blood. 117 (1), 276-282 (2011).</li><li>Solberg, N., Krauss, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Luciferase+assay+to+study+the+activity+of+a+cloned+promoter+DNA+fragment.">Luciferase assay to study the activity of a cloned promoter DNA fragment.</a> Methods Mol Biol. 977, 65-78 (2013).</li><li>Rahman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+repressor+element+in+the+5'-untranslated+region+of+human+Pax5+exon+1A.">A repressor element in the 5'-untranslated region of human Pax5 exon 1A.</a> Gene. 263 (1-2), 59-66 (2001).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Human+Genome+Engineering+via+Cas9.">RNA-Guided Human Genome Engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li></ol>

The authors have nothing to disclose.

Although advances in sequencing and genotyping technologies have greatly enhanced our capacity to identify genetic variants associated with disease, our ability to understand the functional mechanisms impacted by these variants is lagging. A major source of the problem is that many disease-associated variants are located in n on-coding regions of the genome, which likely affect harder-to-predict mechanisms controlling gene expression. Here, we present a protocol based on the EMSA and DAPA techniques, valuable molecular t...

Sequencing and genotyping based studies, including Genome-Wide Association Studies (GWAS), candidate locus studies, and deep-sequencing studies, have identified many genetic variants that are statistically associated with a disease, trait, or phenotype. Contrary to early predictions, most of these variants (85-93%) are located in non-coding regions and do not change the amino acid sequence of proteins1,2. Interpreting the function of these non-coding variants and determining the biological mechanisms connecting them to the associated disease, trait, or phenotype has proven challenging3-6. We have developed a general strategy to identify the molecular mechanisms that link variants to an important intermediate phenotype &#160;&#8211; gene expression. This pipeline is specifically designed to identify modulation of TF binding by genetic variants. This strategy combines computational approaches and molecular biology techniques aimed to predict biological effects of candidate variants in silico, and verify these predictions empirically (Figure 1).
<img alt="Figure 1" src="/files/ftp_upload/54093/54093fig1.jpg" /> 
Figure 1: Strategic approach for the analysis of non-coding genetic variants. Steps that are not included in the detailed protocol associated with this manuscript are shaded in grey. <a href="https://www.jove.com/files/ftp_upload/54093/54093fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
In many cases, it is important to begin by expanding the list of variants to include all those in high linkage-disequilibrium (LD) with each statistically associated variant. LD is a measure of non-random association of alleles at two different chromosomal positions, which can be measured by the r2 statistic7. r2 is a measure of the linkage disequilibrium between two variants, with an r2 = 1 denoting perfect linkage between two variants. Alleles in high LD are found to co-segregate on the chromosome across ancestral populations. Current genotyping arrays do not include all known variants in the human genome. Instead, they exploit the LD within the human genome and include a subset of the known variants that act as proxies for other variants within a particular region of LD8. Thus, a variant without any biological consequence may be associated with a particular disease because it is in LD with the causal variant-the variant with a meaningful biological effect. Procedurally, it is recommended to convert the latest release of the 1,000 genomes project9 variant call files (vcf) into binary files compatible with PLINK10,11, an open-source tool for whole genome association analysis. Subsequently, all other genetic variants with LD r2 &#62;0.8 with each input genetic variant can be identified as candidates. It is important to use the appropriate reference population for this step- e.g., if a variant was identified in subjects of European ancestry, data from subjects of similar ancestry should be used for LD expansion.
LD expansion often results in dozens of candidate variants, and it is likely that only a small fraction of these contribute to disease mechanism. Often, it is infeasible to experimentally examine each of these variants individually. It is therefore useful to leverage the thousands of publically available functional genomic datasets as a filter to prioritize the variants. For example, the ENCODE consortium12 has performed thousands of ChIP-seq experiments describing the binding of TFs and co-factors, and histone marks in a wide range of contexts, along with chromatin accessibility data from technologies such as DNase-seq13, ATAC-seq14, and FAIRE-seq15. Databases and web servers such as the UCSC Genome Browser16, Roadmap Epigenomics17, Blueprint Epigenome18, Cistrome19, and ReMap20 provide free access to data produced by these and other experimental techniques across a wide range of cell types and conditions. When there are too many variants to examine experimentally, these data can be used to prioritize those located within likely regulatory regions in relevant cell and tissue types. Further, in cases where a variant is within a ChIP-seq peak for a specific protein, these data can provide potential leads as to the specific TF(s) or co-factors whose binding might be affecting.
Next, the resulting prioritized variants are screened experimentally to validate predicted genotype-dependent protein binding using EMSA21,22. EMSA measures the change in the migration of the oligo on a non-reducing TBE gel. Fluorescently labeled oligo is incubated with the nuclear lysate, and binding of nuclear factors will retard the movement of the oligo on the gel. In this manner, oligo that has bound more nuclear factors will present as a stronger fluorescent signal upon scanning. Notably, EMSA does not require predictions about the specific proteins whose binding will be affected.
Once variants are identified that are located within predicted regulatory regions and are capable of differentially binding nuclear factors, computational methods are employed to predict the specific TF(s) whose binding they might affect. We prefer to use CIS-BP23,24, RegulomeDB25, UniProbe26, and JASPAR27. Once candidate TFs are identified, these predictions can be specifically tested using antibodies against these TFs (EMSA-supershifts and DAPA-Westerns). An EMSA-supershift involves the addition of a TF-specific antibody to the nuclear lysate and oligo. A positive result in an EMSA-supershift is represented as a further shift in the EMSA band, or a loss of the band (reviewed in reference28). In the complementary DAPA, a 5&#39;-biotinylated oligo duplex containing the variant and the 20 base-pair flanking nucleotides are incubated with nuclear lysate from relevant cell type(s) to capture any nuclear factors specifically binding the oligos. The oligo duplex-nuclear factor complex is immobilized by streptavidin microbeads in a magnetic column. The bound nuclear factors are collected directly through elution29,48. Binding predictions can then be assessed by a Western blot using antibodies specific for the protein. In cases where there are no obvious predictions, or too many predictions, the elutions from variant pull-downs of the DAPA experiments can be sent to a proteomics core to identify candidate TFs using mass-spectrometry, which can subsequently be validated using these previously described methods.
In the remainder of the article, the detailed protocol for EMSA and DAPA analysis of genetic variants is provided.

<table><tbody><tr><td>Custom DNA Oligonucleotides</td><td>Integrated DNA Technologies</td><td></td><td>http://www.idtdna.com/site/order/oligoentry</td></tr><tr><td>Potassium Chloride</td><td>Fisher Scientific</td><td>BP366-500</td><td>KCl, for CE buffer</td></tr><tr><td>HEPES (1 M)</td><td>Fisher Scientific</td><td>15630-080</td><td>For CE and NE buffer</td></tr><tr><td>EDTA (0.5M), pH 8.0</td><td>Life Technologies</td><td>R1021</td><td>For CE, NE, and annealing buffer</td></tr><tr><td>Sodium Chloride</td><td>Fisher Scientific</td><td>BP358-1</td><td>NaCl, for NE buffer</td></tr><tr><td>Tris-HCl (1M), pH 8.0</td><td>Invitrogen</td><td>BP1756-100</td><td>For annealing buffer</td></tr><tr><td>Phosphate Buffered Saline (1x)</td><td>Fisher Scientific</td><td>MT21040CM</td><td>PBS, for cell wash</td></tr><tr><td>DL-Dithiothreitol solution (1 M)</td><td>Sigma</td><td>646563</td><td>Reducing agent</td></tr><tr><td>Protease Inhibitor Cocktail</td><td>Thermo Scientific</td><td>87786</td><td>Prevents catabolism of TFs</td></tr><tr><td>Phosphatase Inhibitor Cocktail&amp;nbsp;</td><td>Thermo Scientific</td><td>78420</td><td>Prevents dephosphorylation of TFs</td></tr><tr><td>Nonidet P-40 Substitute</td><td>IBI Scientific</td><td>IB01140</td><td>NP-40, for nuclear extraction</td></tr><tr><td>BCA Protein Assay Kit</td><td>Thermo Scientific</td><td>23225</td><td>For measuring protein concentration</td></tr><tr><td>Odyssey EMSA Buffer Kit</td><td>Licor</td><td>829-07910</td><td>Contains all necessary EMSA buffers</td></tr><tr><td>TBE Gels, 6%, 12 Wells</td><td>Invitrogen</td><td>EC6265BOX</td><td>For EMSA</td></tr><tr><td>TBE Buffer (10x)</td><td>Thermo Scientific</td><td>B52</td><td>For EMSA</td></tr><tr><td>FactorFinder Starting Kit</td><td>Miltenyi Biotec</td><td>130-092-318</td><td>Contains all necessary DAPA buffers</td></tr><tr><td>Licor Odyssey CLx</td><td>Licor</td><td></td><td>Recommended scanner for DAPA/EMSA</td></tr><tr><td>Antibiotic-Antimycotic</td><td>Gibco</td><td>15240-062</td><td>Contains 10,000 units/ml of penicillin, 10,000 &amp;micro;g/ml of streptomycin, and 25 &amp;micro;g/ml of Fungizone&amp;reg; Antimycotic</td></tr><tr><td>Fetal Bovine Serum</td><td>Gibco</td><td>26140-079</td><td>FBS, for culture media</td></tr><tr><td>RPMI 1640 Medium</td><td>Gibco</td><td>22400-071</td><td>Contains L-glutamine and 25 mM HEPES</td></tr></tbody></table>

screening for functional non-coding genetic variants using electrophoretic mobility shift assay (emsa) and dna-affinity precipitation assay (dapa)

Population and family-based genetic studies typically result in the identification of genetic variants that are statistically associated with a clinical disease or phenotype. For many diseases and traits, most variants are non-coding, and are thus likely to act by impacting subtle, comparatively hard to predict mechanisms controlling gene expression. Here, we describe a general strategic approach to prioritize non-coding variants, and screen them for their function. This approach involves computational prioritization using functional genomic databases followed by experimental analysis of differential binding of transcription factors (TFs) to risk and non-risk alleles. For both electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genetic variants, a synthetic DNA oligonucleotide (oligo) is used to identify factors in the nuclear lysate of disease or phenotype-relevant cells. For EMSA, the oligonucleotides with or without bound nuclear factors (often TFs) are analyzed by non-denaturing electrophoresis on a tris-borate-EDTA (TBE) polyacrylamide gel. For DAPA, the oligonucleotides are bound to a magnetic column and the nuclear factors that specifically bind the DNA sequence are eluted and analyzed through mass spectrometry or with a reducing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blot analysis. This general approach can be widely used to study the function of non-coding genetic variants associated with any disease, trait, or phenotype.

In this section, representative results of what to expect are provided when performing an EMSA or DAPA, and the variability with regards to the quality of lysate is characterized. For example, it has been suggested that freezing and thawing protein samples multiple times may result in denaturation. In order to explore the reproducibility of EMSA analysis in the context of these &#34;freeze-thaw&#34; cycles, two 35 bp oligos differing at one genetic variant were incubated with a single bat...

Watch this Scientific Journal Video about Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay EMSA and DNA-affinity Precipitation Assay DAPA at JoVE.com

Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay EMSA and DNA-affinity Precipitation Assay DAPA

We present a strategic plan and protocol for identifying non-coding genetic variants affecting transcription factor (TF) DNA binding. A detailed experimental protocol is provided for electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genotype-dependent TF DNA binding.

Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA)

Population and family-based genetic studies typically result in the identification of genetic variants that are statistically associated with a clinical ...

screening-for-functional-non-coding-genetic-variants-using

Research

JoVE Journal

Biology

12.9K Views.  Cincinnati Children's Hospital. We present a strategic plan and protocol for identifying non-coding genetic variants affecting transcription factor (TF) DNA binding. A detailed experimental protocol is provided for electrophoretic mobility shift assay (EMSA) and DNA affinity precipitation assay (DAPA) analysis of genotype-dependent TF DNA binding.

Video: Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay EMSA and DNA-affinity Precipitation Assay DAPA

An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2G73E proteins) as a biological example.

We describe here an optimized protocol of fluorescent Electrophoretic Mobility Shift Assays (fEMSA) using purified SOX-2 proteins together with infrared fluorescent dye-labeled DNA probes as a case study to tackle an important biological question.

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. ...

Biochemistry

Candidate Gene Testing in Clinical Cohort Studies with Multiplexed Genotyping and Mass Spectrometry

Complex diseases are often underpinned by multiple common genetic variants that contribute to disease susceptibility. Here, we describe a cost-effective tag single nucleotide polymorphism (SNP) approach using a multiplexed genotyping assay with mass spectrometry, to investigate gene pathway associations in clinical cohorts. We investigate the food allergy candidate locus Interleukin13 (IL13) as an example. This method efficiently maximizes the coverage by taking advantage of shared linkage disequilibrium (LD) within a region. Selected LD SNPs are then designed into a multiplexed assay, enabling up to 40 different SNPs to be analyzed simultaneously, boosting cost-effectiveness. Polymerase chain reaction (PCR) is used to amplify the target loci, followed by single nucleotide extension, and the amplicons are then measured using matrix-assisted laser desorption/ionization-time of flight(MALDI-TOF) mass spectrometry. The raw output is analyzed with the genotype calling software, using stringent quality control definitions and cut-offs, and high probability genotypes are determined and output for data analysis.

Identification of genetic variants contributing to complex human disease allows us to identify novel mechanisms. Here, we demonstrate a multiplex genotyping approach to candidate genes or gene pathway analysis that maximizes the coverage at low cost and is amenable to cohort-based studies.

Complex diseases are often underpinned by multiple common genetic variants that contribute to disease susceptibility. Here, we describe a cost-effective ...

Genetics

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Detection and Monitoring of Tumor Associated Circulating DNA in Patient Biofluids

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular sub-classification and temporal monitoring of tumor response to therapy. Here, we describe our dPCR-based method for the detection of tumor somatic mutations in cell free DNA (cfDNA), readily available in&#160;patient biofluids. Although limited in the number of mutations that can be tested for in each assay, this method provides a high level of sensitivity and specificity. Monitoring of mutation abundance, as calculated by MAF, allows for the evaluation of tumor response to therapy, thereby providing a much-needed supplement to radiographic imaging.

Here, we present a protocol to detect tumor somatic mutations in circulating DNA present in patient biological fluids (biofluids). Our droplet digital polymerase chain reaction (dPCR)-based method enables quantification of the tumor mutation allelic frequency (MAF), facilitating a minimally invasive complement to diagnosis and temporal monitoring of tumor response.

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular ...

Cancer Research

A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5&#8217; untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene promoter. Conventionally, capillary electrophoresis fragment analysis on a genetic analyzer is used for the sizing of the CGG repeats of FMR1, but additional Southern blot analysis is required for exact measurement when the repeat number is higher than 200. Here, we present an accurate and robust polymerase chain reaction (PCR)-based method for quantification of the CGG repeats of FMR1. The first step of this test is PCR amplification of the repeat sequences in the 5&#8217;UTR of the FMR1 promoter using a Fragile X PCR kit, followed by purification of the PCR products and fragment sizing on a microfluidic capillary electrophoresis instrument, and subsequent interpretation of the number of CGG repeats by referencing standards with known repeats using the analysis software. This PCR-based assay is reproducible and capable of identifying the full range of CGG repeats of FMR1 promoters, including those with a repeat number of more than 200 (classified as full mutation), 55 to 200 (premutation), 46 to 54 (intermediate), and 10 to 45 (normal). It is a cost-effective method that facilitates classification of the FXS and Fragile X-associated disorders with robustness and rapid reporting time.

An accurate and robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in the Fragile X mental retardation-1 gene facilitates molecular diagnosis and screening of Fragile X syndrome and Fragile X-related disorders with shorter turn-around time and investment in equipment.

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5&#8217; ...

Naked-Eye Detection of Rare Point Mutations in DNA

The protocol describes a naked-eye colorimetric test for the detection of somatic point mutations in an excess of wild type DNA. The future foreseen application of the method is the identification of rare mutations in circulating cell-free DNA from liquid biopsies, with a relevance in cancer diagnostics and stratification of oncological patients for personalized therapy. As a proof of concept, the test has been designed to detect the BRAFV600E mutation in the BRAF gene, which is important to identify the sub-group of melanoma patients that can benefit from targeted therapies with BRAF inhibitors. However, this colorimetric test can be easily generalized to other somatic mutations of clinical relevance due to the use of universal detection probes, thus providing strong potential in oncological diagnostics.
The test detects 0.5% of BRAFV600E in an excess of BRAFWT DNA, which matches the sensitivity of some commercial instrumental assays. Such sensitivity is clinically relevant for diagnostic purposes, allowing the early identification of drug-sensitive patients. In contrast to commercial assays based on real-time PCR, this test requires minimal instrumentation and processing, as it can be performed on DNA amplified with a standard PCR (or isothermal techniques) and provides a naked-eye readout with a one-tube reaction of a few steps in only one hour. At present, the test has been used only on synthetic DNA samples. However, the latter have been designed to mimic a real sample amplified from circulating cell-free DNA, to favor the translation of the test to clinical diagnostics.

This protocol permits the naked-eye identification of point mutated DNA in a 200-fold excess of wild type DNA molecules, by exploiting gold nanoparticles and paramagnetic microparticles.

The protocol describes a naked-eye colorimetric test for the detection of somatic point mutations in an excess of wild type DNA. The future foreseen ...

Genome-Scale Screening to Identify and Compare Therapeutic Targets in Tumors

Genetic Profiling and Genome-Scale Dropout Screening to Identify Therapeutic Targets in Mouse Models of Malignant Peripheral Nerve Sheath Tumor

Malignant Peripheral Nerve Sheath Tumors (MPNSTs) are derived from Schwann cells or their precursors. In patients with the tumor susceptibility syndrome neurofibromatosis type 1 (NF1), MPNSTs are the most common malignancy and the leading cause of death. These rare and aggressive soft-tissue sarcomas offer a stark future, with 5-year disease-free survival rates of 34-60%. Treatment options for individuals with MPNSTs are disappointingly limited, with disfiguring surgery being the foremost treatment option. Many once-promising therapies such as tipifarnib, an inhibitor of Ras signaling, have failed clinically. Likewise, phase II clinical trials with erlotinib, which targets the epidermal growth factor (EFGR), and sorafenib, which targets the vascular endothelial growth factor receptor (VEGF), platelet-derived growth factor receptor (PDGF), and Raf, in combination with standard chemotherapy, have also failed to produce a response in patients. 
In recent years, functional genomic screening methods combined with genetic profiling of cancer cell lines have proven useful for identifying essential cytoplasmic signaling pathways and the development of target-specific therapies. In the case of rare tumor types, a variation of this approach known as cross-species comparative oncogenomics is increasingly being used to identify novel therapeutic targets. In cross-species comparative oncogenomics, genetic profiling and functional genomics are performed in genetically engineered mouse (GEM) models and the results are then validated in the rare human specimens and cell lines that are available. 
This paper describes how to identify candidate driver gene mutations in human and mouse MPNST cells using whole exome sequencing (WES). We then describe how to perform genome-scale shRNA screens to identify and compare critical signaling pathways in mouse and human MPNST cells and identify druggable targets in these pathways. These methodologies provide an effective approach to identifying new therapeutic targets in a variety of human cancer types.

Author Spotlight: Finding New Therapeutic Targets for Malignant Peripheral Nerve Sheath Tumor Through Genome-Scale shRNA Screens 

We have developed a cross-species comparative oncogenomics approach utilizing genomic analyses and functional genomic screens to identify and compare therapeutic targets in tumors arising in genetically engineered mouse models and the corresponding human tumor type.

Malignant Peripheral Nerve Sheath Tumors (MPNSTs) are derived from Schwann cells or their precursors. In patients with the tumor susceptibility syndrome ...

An Allele-specific Gene Expression Assay to Test the Functional Basis of Genetic Associations

The number of significant genetic associations with common complex traits is constantly increasing. However, most of these associations have not been understood at molecular level. One of the mechanisms mediating the effect of DNA variants on phenotypes is gene expression, which has been shown to be particularly relevant for complex traits1.
This method tests in a cellular context the effect of specific DNA sequences on gene expression. The principle is to measure the relative abundance of transcripts arising from the two alleles of a gene, analysing cells which carry one copy of the DNA sequences associated with disease (the risk variants)2,3. Therefore, the cells used for this method should meet two fundamental genotypic requirements: they have to be heterozygous both for DNA risk variants and for DNA markers, typically coding polymorphisms, which can distinguish transcripts based on their chromosomal origin (Figure 1). DNA risk variants and DNA markers do not need to have the same allele frequency but the phase (haplotypic) relationship of the genetic markers needs to be understood. It is also important to choose cell types which express the gene of interest. This protocol refers specifically to the procedure adopted to extract nucleic acids from fibroblasts but the method is equally applicable to other cells types including primary cells.
DNA and RNA are extracted from the selected cell lines and cDNA is generated. DNA and cDNA are analysed with a primer extension assay, designed to target the coding DNA markers4. The primer extension assay is carried out using the MassARRAY (Sequenom)5 platform according to the manufacturer's specifications. Primer extension products are then analysed by matrix-assisted laser desorption/ionization time of-flight mass spectrometry (MALDI-TOF/MS). Because the selected markers are heterozygous they will generate two peaks on the MS profiles. The area of each peak is proportional to the transcript abundance and can be measured with a function of the MassARRAY Typer software to generate an allelic ratio (allele 1: allele 2) calculation. The allelic ratio obtained for cDNA is normalized using that measured from genomic DNA, where the allelic ratio is expected to be 1:1 to correct for technical artifacts. Markers with a normalised allelic ratio significantly different to 1 indicate that the amount of transcript generated from the two chromosomes in the same cell is different, suggesting that the DNA variants associated with the phenotype have an effect on gene expression. Experimental controls should be used to confirm the results.

Genetic associations often remain unexplained at a functional level. This method aims to assess the effect of phenotype-associated genetic markers on gene expression by analyzing cells heterozygous for transcribed SNPs. The technology allows accurate measurement by MALDI-TOF mass spectrometry to quantify allele-specific primer extension products.

The number of significant genetic associations with common complex traits is constantly increasing. However, most of these associations have not been ...

Electrophoretic Mobility Shift Assay (EMSA)

The electrophoretic mobility shift assay (EMSA) is a biochemical procedure used to elucidate binding between proteins and nucleic acids. In this assay a radiolabeled nucleic acid and test protein are mixed. Binding is determined via gel electrophoresis which separates components based on mass, charge, and conformation.
This video shows the concepts of EMSA and a general procedure, including gel and protein preparation, binding, electrophoresis, and detection. Applications covered in this video include the analysis of chromatin-remodeling enzymes, a modified EMSA that incorporates biontinylation, and the study of binding sites of bacterial response regulators.
<div class="chapter_text" id="script_0">
EMSA, the electrophoretic mobility shift assay, also known as the gel shift assay, is a versatile and sensitive biochemical procedure. EMSA elucidates binding between proteins and nucleic acids by detecting a shift in bands in gel electrophoresis.
This video describes the principles of EMSA, provides a general procedure, and discusses some applications.
</div>
<div class="chapter_text" id="script_1">
DNA replication, transcription, and repair, as well as RNA processing are all critical biochemical processes. They all involve binding between proteins and nucleic acids. Many serious diseases and disorders are associated with modifications in this binding. EMSA is a technique for qualitatively determining whether a specific protein binds to a specific nucleic acid. First, the nucleic acid is labeled, usually with radioactive phosphorus-32, to create a probe. Then the test protein and nucleic acid probe are mixed. When a protein binds to a nucleic acid probe, the resulting complex has greater mass and a different conformation than the nucleic acid alone.
Once bound, the complexes are analyzed with&#160;gel electrophoresis. In this technique, an electric field forces macromolecules to migrate through a gel matrix. The components separate based on mass, charge, and conformation. Electrophoresis can separate protein-DNA complexes from unbound probes. Since they have different masses and conformations, they will migrate through the gel at different rates and separate. The separation is easily detected, thanks to the presence of the radioactive phosphorus, and proves the protein successfully binds to the given nucleic acid. To verify the identification of the protein, a &#34;supershift assay&#34; uses an antibody with a known affinity to the protein. This has the added benefit of further shifting the complex, increasing resolution.
Now that we&#39;ve seen the principles, let&#39;s see it in the lab.
</div>
<div class="chapter_text" id="script_2">
To begin the procedure, the protein must be isolated. To do this, molecular biology techniques are used to express the protein in cells, and then purify.
The nucleic acid is amplified and labeled to create a probe. Labeling is done through incubation for 10 min with dCTP containing radioactive phosphorus-32. A radiation-safe workbench and protective equipment are required.
The gel is then prepared. The gel needs to be non-denaturing, to prevent the protein from altering conformation and potentially unbinding from the probe during electrophoresis. Polyacrylamide gels have pore sizes of 5 to 20 nm and are useful for short probes up to 100 base pairs in length. Agarose gels have pore sizes of 70-700 nm and are useful for larger probes.
</div>
<div class="chapter_text" id="script_3">
With the protein and nucleic acid probe now prepared, we proceed to binding. A TRIS buffer solution is prepared and the protein and probe are added. The pH should be similar to physiological conditions, and salt concentration sufficient to prevent the protein from forming weak bonds with non-target nucleic acids. The reaction proceeds for 20-30 min at 4 &#176;C.
The next step is electrophoresis. A buffer of low ionic strength and a pH similar to that used in the binding reaction is utilized. It yields a &#34;caging effect&#34; that stabilizes complexes, increases mobility, and reduces heat generation. After electrophoresis, the components of the gel are transferred onto filter paper. In a dark room, the filter paper is then exposed to film. If the protein binds to the probe, two distinct labeled regions will be visible in the transfer. One representing the complex, and a separate one representing the unbound probe. The separation demonstrates that the protein successfully bound to the nucleic acid.
</div>
<div class="chapter_text" id="script_4">
Now that we&#39;ve seen the basic procedure, let&#39;s look at some applications.
Chromatin is the tightly packed complex of DNA and proteins found eukaryotic cells. Chromatin-remodeling enzymes modify the structure to open the DNA to transcription. As this changes the mobility of the complex, EMSA can be used to explore the binding activity of the enzyme.
An alternate approach to labeling takes advantage of the interaction between DNA and the methyltransferase enzyme. A cofactor can be modified to bind permanently to DNA via methyltransferase. Rather than labeling with phosphorus-32, the cofactor is conjugated to biotin, which is advantageous because it&#39;s not radioactive.&#160;Because the cofactor is site-specific in its attachment, it&#8217;s relevant to genotyping, methylation detection, and gene delivery. The biotinilated nucleic acids are detected through ultraviolet fluorescence.
When environmental stimuli activate histidine kinases, a &#8220;response regulator&#8221; is phosphorylated. This in turn binds to DNA, affecting transcription, which can be studied by EMSA.&#160;For instance, a response regulator in Desulfovibrio vulgaris was demonstrated to bind to the gene of interest. EMSA was used to verify that the binding took place.
</div>
<div class="chapter_text" id="script_5">
You&#39;ve just watched JoVE&#39;s video on the electrophoretic mobility shift assay. You should now understand its principles of operation, the steps in its procedure, and its major operating parameters.
Thanks for watching!
</div>

Electrophoretic Mobility Shift Assay EMSA

The electrophoretic mobility shift assay (EMSA) is a biochemical procedure used to elucidate binding between proteins and nucleic acids. In this assay a ...

Education

JoVE Science Education

Chemistry

Electrophoretic Mobility Shift Assay for Detection of Transcription Factor-DNA Complexes

Source: Hsieh, Y. W. et al., <a href="https://app.jove.com/v/54863">An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides.</a> J. Vis. Exp. (2016)
In this video, we demonstrate the electrophoretic mobility shift assay to detect protein-DNA interactions using infrared fluorescent-labeled DNA probes. When the protein binds to the DNA probe, it forms a large complex that migrates slowly on and appears as a shifted band on the gel.

Source: Hsieh, Y. W. et al., An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides. J. ...

Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA)

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video