This work is partly supported by grants DA024558, DA30896, DA033892, and DA021471 from the NIDA/NIH to CD. We also acknowledge the RCMI grant G12MD007586, the Vanderbilt CTSA grant UL1RR024975, the Meharry Translational Research Center (MeTRC) CTSA grant U54 RR026140 from the NCRR/NIH, the U54 grant MD007593 from the NIMHD/NIH, and the Tennessee CFAR grant P30 AI110527.

1. Virus Production
NOTE: To generate high titers of infectious HIV-1, transfect the Human Embryonic Kidney (HEK) cell line 293T with an infectious HIV-1 molecular clone using an activated dendrimer-based transfection reagent. It has been observed that the calcium phosphate transfection method yields comparable results.
<ol>
	<li>In a Biosafety Level 2 (BSL2) lab, seed 3 x 106 293T cells per 10 cm dish in 8 mL of Dulbecco&#39;s Modified Eagle Medium (DMEM) supplemented with 10% Fetal Bovine Serum (FBS), penicillin, and streptomycin. Culture the cells in an incubator set at 37 &#176;C and 5% CO2 O/N.</li>
	<li>The next day, for transfecting cells in each 10 cm dish, dilute 8 &#181;g of pNL4-3 plasmid DNA (see Materials Table) to a final volume of 300 &#181;L of DMEM lacking serum and antibiotics. Add 80&#160;&#181;L of the transfection reagent, mix well by pipetting, and incubate at RT&#160;for 5 - 10 min for transfection complex formation.</li>
	<li>Remove the medium from the dishes by aspiration and add 7 mL per dish of fresh DMEM containing serum and antibiotics.</li>
	<li>Add 1 mL of DMEM containing serum and antibiotics to the transfection complex, mix by pipetting, and add this mixture to the cells. Gently swirl the dish to facilitate even distribution of the transfection complexes.</li>
	<li>Immediately transfer the cells to the BSL3 lab, place in an incubator set at 37 &#176;C and 5% CO2, and culture the cells for 48 h.</li>
	<li>Collect the virus-containing tissue culture supernatant using a pipette and then transfer it to a centrifuge tube. Centrifuge at 300 x g for 5 min to pellet the cells and debris, and then filter the supernatant through a 0.45&#160;&#181;m pore-size syringe filter.</li>
	<li>To eliminate any carryover plasmid DNA in this cell-free virus preparation, treat with DNase 1 (20 &#181;g/mL) at 37 &#176;C for 1 h.</li>
	<li>To quantify the HIV-1 titer, use the p24-specific Enzyme-linked Immunosorbent Assay (ELISA), as it is a rapid and amenable method for routine use22. 
	NOTE: It should be noted that the p24 ELISA measures the physical titer (number of virus particles). Alternatively, measuring the virus-associated RT activity (exogenous RT assay) or virus infectivity (TZM-bl indicator cell line-based infectivity assays) will provide exclusive readout of infectious virus particles.</li>
</ol>
2. Virus Infection of Sup-T1 Cells (BSL3 Lab)
<ol>
	<li>In a BSL2 lab, maintain Sup-T1 cells between 1.0 x 106 and 2.0 x 106&#160;cells/mL in Roswell Park Memorial Institute (RPMI) medium supplemented with 10% heat-inactivated FBS, penicillin, and streptomycin (split ratio of 1:2 every 2 - 3 d). Pool the Sup-T1 cells from the culture flasks, mix well by pipetting, and determine the viable cell count by using a hemocytometer and the trypan blue exclusion staining method.
	<ol>
		<li>Prepare the required number of aliquots of 80 x 106 cells (per virus infection) in 50&#160;mL conical centrifuge tubes.</li>
		<li>Centrifuge the cells in a swinging-bucket rotor&#160;at 500 x g and 25 &#176;C for 5 min. Without removing the cell culture medium, transfer the tubes containing pelleted cells to the BSL3 lab for further processing. Carefully aspirate the cell culture medium from the tube without disturbing the cell pellet.</li>
	</ol>
	</li>
	<li>Add an appropriate amount of DNase I-treated virus inoculum to the cells in the tube and mix well by gentle pipetting. For 80 x 106 cells, use 30 mL of DNase I-treated virus (50 &#181;g of p24-equivalent virus). 
	NOTE: Isolation of functional PICs requires infecting the target cells with very high multiplicities of infection (MOI).</li>
	<li>Distribute the mixture evenly between two 6-well tissue culture plates (i.e.&#160;12 x 2.5-mL aliquots; use 2 plates per infection).</li>
	<li>For spinoculation, place the culture plates in plate carriers and centrifuge using a swinging bucket rotor at 480 x g and 25 &#176;C for 2 h.</li>
	<li>Incubate the spinoculated cells at 37 &#176;C and 5% CO2 for 5 h.</li>
</ol>
3. Harvesting and Lysis of Infected Cells (BSL3 lab)
<ol>
	<li>Pool the cells corresponding to each infection from the culture plates into a 50&#160;mL conical centrifuge tube (~30 mL in total).</li>
	<li>Harvest the cells by centrifugation at 300 x g and 25 &#176;C for 10 min. Carefully aspirate the supernatant from the tube (alternatively, use a pipette).</li>
	<li>To remove any residual viral particles, wash each cell pellet by adding 2 mL of buffer K-/- (150 mM KCl, 20 mM HEPES, pH 7.6, 5 mM MgCl2) and centrifuging the sample at 300 x g and 25 &#176;C for 10 min. Then, without disturbing the pellet, carefully remove the supernatant by aspiration or by using a pipette.</li>
	<li>Repeat step 3.3.</li>
	<li>Carefully remove any residual buffer by using a micropipette. Resuspend each cell pellet in 2 mL of ice-cold lysis buffer K+/+ (Buffer K-/- supplemented with 0.025% digitonin, 1 mM DTT, 20 &#181;g/mL aprotinin), mix contents by gentle pipetting, and transfer to a 2&#160;mL microcentrifuge tube.</li>
</ol>
4. Preparation of Cytoplasmic PICs (BSL3 lab)
<ol>
	<li>Rock the samples on a rotary shaker at RT for 10 min.</li>
	<li>Centrifuge the samples, with the rotor precooled to 4 &#176;C, at 1,500 x g and 4 &#176;C for 4 min.</li>
	<li>Without disturbing the pellet, carefully transfer the supernatant to a fresh microcentrifuge tube and centrifuge at 16,000 x g and 4 &#176;C for 1 min.</li>
	<li>Carefully transfer the supernatant to a fresh microcentrifuge tube. Add RNase A (20 mg/mL) to a final concentration of 20 &#181;g/mL (2 &#181;L for 2 mL of PICs) and incubate the contents at RT for 30 min (no rocking).</li>
	<li>Add sucrose (60% w/v in buffer K-/-) to a final concentration of 7% and mix well by gentle pipetting. Prepare aliquots (e.g., 200 &#181;L) of the PICs in microcentrifuge tubes, flash-freeze in liquid nitrogen, and place in a -80 &#176;C freezer for long-term storage.</li>
</ol>
5. In Vitro&#160;Integration (IVI) Assays Using HIV-1 PICs
<ol>
	<li>Prepare the target DNA used in the IVI assay by amplifying a 2.0 kb region from the phiX174 plasmid DNA with PCR using custom-made primers, phiX174-F and phiX174-R.
	<ol>
		<li>Assemble the PCR mixture as described in Table 1. Perform PCR in a thermal cycler using the thermal cycling conditions recommended in Table 2. Gel-purify the PCR product using a gel-purification kit (following manufacturer-recommended protocol), and store the purified target DNA as aliquots at -80 &#176;C until use.</li>
	</ol>
	</li>
	<li>Add 600 ng of target DNA to 200-&#181;L aliquot of PICs, mix well, and incubate at 37 &#176;C for 45 min. 
	Note: IVI reactions omitting target DNA or including an integrase inhibitor (e.g., Raltegravir) are recommended control reactions.</li>
	<li>Stop the IVI reaction by adding SDS, EDTA, and proteinase K to final concentrations of 0.5%, 8 mM, and 0.5 mg/mL, respectively. Mix the reaction contents thoroughly and incubate overnight at 56 &#176;C.</li>
	<li>The next day, purify the total DNA from the IVI reaction by phenol/chloroform extraction and ethanol precipitation. Carry out all centrifugation steps at 16,000 x g and RT.</li>
	<li>Add an equal volume of phenol to the deproteinized sample, mix vigorously by vortexing, and centrifuge for 2 min. Carefully remove the upper aqueous phase and transfer it to a fresh tube.</li>
	<li>Repeat step 5.5. Transfer the upper aqueous phase to a fresh tube.</li>
	<li>Add an equal volume of 1:1 phenol:chloroform mixture, mix vigorously by vortexing, and centrifuge for 2 min. Transfer the upper aqueous phase to a fresh tube.</li>
	<li>Add an equal volume of chloroform, mix vigorously by vortexing, and centrifuge for 2 min. Transfer the upper aqueous phase to a fresh tube.</li>
	<li>To precipitate DNA, add glycogen to a final concentration of 0.1 &#181;g/&#181;L, 3 M of sodium acetate to a final concentration of 0.3 M, and 2.5 volumes of 100% ethanol (ice-cold). Vortex to mix, centrifuge briefly to collect the contents, and place the tube at -80 &#176;C O/N.</li>
	<li>The next day, centrifuge the sample for 30 min at 16,000 x g and 4 &#176;C for 30 min. Carefully remove the supernatant without disturbing the pellet.</li>
	<li>Add 500 &#181;L of 80% ethanol (ice-cold) to the pellet and centrifuge at 16,000 x g and 4 &#176;C for 10 min. Air-dry the DNA pellet at RT and thoroughly resuspend in 50 &#181;L of nuclease-free water. Store the DNA samples at -20 &#176;C.</li>
</ol>
6. PCR Assays for Quantifying PIC Activity
NOTE: The copy number of HIV-1 DNA integrated into the target DNA is quantified by a nested PCR strategy that employs 2 sets of primers and 2 sequential rounds of PCR.
<ol>
	<li>Perform the first-round conventional PCR using primers targeting the viral LTR and the phiX174 DNA (LTR and phiX174 primers, respectively) to amplify the junctions of the integrated HIV-1 DNA.
	<ol>
		<li>Assemble the first-round PCR mixture as described in Table 3. Assemble a master mix of all components excluding the template DNA, dispense 45-&#181;L aliquots into separate PCR tubes, and add 5 &#181;L of template DNA or nuclease-free water (control).</li>
		<li>Perform PCR in a thermal cycler using the thermal cycling conditions recommended in Table 4.</li>
	</ol>
	</li>
	<li>Perform the second-round qPCR using primers that flank a short region of the viral LTR (LTR-R and LTR-U primers) to selectively amplify the integrated vDNA sequences from the first-round PCR products. To determine the integrated vDNA copy numbers, generate a standard curve by using 10x serial dilutions of known copy numbers (e.g., 100&#160;- 108) of the HIV-1 molecular clone.
	<ol>
		<li>Assemble the second-round qPCR mixture as described in Table 5. Assemble a master mix of all components excluding the template DNA, carefully dispense 25&#160;&#181;L aliquots into the appropriate number of wells in a 96-well PCR reaction plate, and then add 5 &#181;L of the unpurified first-round PCR products or nuclease-free water (control). Perform all qPCR reactions in triplicate.</li>
		<li>Load the PCR plate into the real-time PCR instrument and perform qPCR using the cycling conditions recommended in Table 6.</li>
		<li>Analyze the data using a suitable software.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Sattentau, Q. J., Weiss, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CD4+antigen:+physiological+ligand+and+HIV+receptor.">The CD4 antigen: physiological ligand and HIV receptor.</a> Cell. 52 (5), 631-633 (1988).</li><li>Wilen, C. B., Tilton, J. C., Doms, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+HIV+entry.">Molecular mechanisms of HIV entry.</a> Adv Exp Med Biol. 726, 223-242 (2012).</li><li>Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nucleoprotein+complex+mediates+the+integration+of+retroviral+DNA.">A nucleoprotein complex mediates the integration of retroviral DNA.</a> Genes Dev. 3 (4), 469-478 (1989).</li><li>Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+nuclear+import+of+human+immunodeficiency+virus+type+1+preintegration+complexes.">Active nuclear import of human immunodeficiency virus type 1 preintegration complexes.</a> Proc Natl Acad Sci. 9 (14), 6580-6584 (1992).</li><li>Hansen, M. S., Smith, G. J., Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+complexes+derived+from+HIV+vectors+for+rapid+assays+in+vitro.">Integration complexes derived from HIV vectors for rapid assays in vitro.</a> Nature biotechnol. 17 (6), 578-582 (1999).</li><li>Farnet, C. M., Haseltine, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+human+immunodeficiency+virus+type+1+DNA+in+vitro.">Integration of human immunodeficiency virus type 1 DNA in vitro.</a> Proc Natl Acad Sci. 87 (11), 4164-4168 (1990).</li><li>Fujiwara, T., Mizuuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration:+structure+of+an+integration+intermediate.">Retroviral DNA integration: structure of an integration intermediate.</a> Cell. 54 (4), 497-504 (1988).</li><li>Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+integration+of+retroviral+DNA+in+vitro.">Correct integration of retroviral DNA in vitro.</a> Cell. 49 (3), 347-356 (1987).</li><li>Lewinski, M. K., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration--mechanism+and+consequences.">Retroviral DNA integration--mechanism and consequences.</a> Adv Genet. 55, 147-181 (2005).</li><li>Engelman, A., Mizuuchi, K., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-1+DNA+integration:+mechanism+of+viral+DNA+cleavage+and+DNA+strand+transfer.">HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer.</a> Cell. 67 (6), 1211-1221 (1991).</li><li>Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+of+retroviral+integration.">Genetics of retroviral integration.</a> Ann rev gen. 26, 527-544 (1992).</li><li>Panganiban, A. T., Temin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+terminal+nucleotides+of+retrovirus+DNA+are+required+for+integration+but+not+virus+production.">The terminal nucleotides of retrovirus DNA are required for integration but not virus production.</a> Nature. 306 (5939), 155-160 (1983).</li><li>Bieniasz, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell+biology+of+HIV-1+virion+genesis.">The cell biology of HIV-1 virion genesis.</a> Cell host microbe. 5 (6), 550-558 (2009).</li><li>Sherman, P. A., Fyfe, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+immunodeficiency+virus+integration+protein+expressed+in+Escherichia+coli+possesses+selective+DNA+cleaving+activity.">Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity.</a> Proc Natl Acad Sci. 87 (13), 5119-5123 (1990).</li><li>Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+avian+retroviral+integration+protein+cleaves+the+terminal+sequences+of+linear+viral+DNA+at+the+in+vivo+sites+of+integration.">The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration.</a> J Virol. 63 (12), 5319-5327 (1989).</li><li>Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+in+vitro+assay+for+HIV+DNA+integration.">A rapid in vitro assay for HIV DNA integration.</a> Nucl acid res. 19 (10), 2729-2734 (1991).</li><li>Bushman, F. D., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activities+of+human+immunodeficiency+virus+(HIV)+integration+protein+in+vitro:+specific+cleavage+and+integration+of+HIV+DNA.">Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA.</a> Proc Natl Acad Sci. 88 (4), 1339-1343 (1991).</li><li>Pauza, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+bases+are+deleted+from+the+termini+of+HIV-1+linear+DNA+during+integrative+recombination.">Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination.</a> Virology. 179 (2), 886-889 (1990).</li><li>Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+analysis+of+HIV-1+preintegration+complexes.">Isolation and analysis of HIV-1 preintegration complexes.</a> Meth Mol Biol. 485, 135-149 (2009).</li><li>Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+HIV-1+preintegration+complexes.">Quantitative analysis of HIV-1 preintegration complexes.</a> Methods. 47 (4), 283-290 (2009).</li><li>Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cocaine+modulates+HIV-1+integration+in+primary+CD4++T+cells:+implications+in+HIV-1+pathogenesis+in+drug-abusing+patients.">Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients.</a> J Leuk Biol. 97 (4), 779-790 (2015).</li><li>Wehrly, K., Chesebro, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p24+antigen+capture+assay+for+quantification+of+human+immunodeficiency+virus+using+readily+available+inexpensive+reagents.">p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents.</a> Methods. 12 (4), 288-293 (1997).</li></ol>

The authors declare no competing financial and nonfinancial interests.

Biochemical analyses of retroviral PICs have provided critical insights into the mechanism of retroviral DNA integration. Measurement of the integration activity of retroviral PICs can be achieved by plaque formation assay, Southern blot analysis, and nested qPCR. The experimental strategy of plaque assay is laborious and utilizes an indirect method to measure integration6,7,18. Southern blot-based assays measure integration dir...

HIV-1 replication in the target cell involves multiple steps, broadly grouped into two phases: early and late events. The early events begin when HIV-1 sequentially binds to the target cell surface receptor CD4 and one of the two co-receptors (CCR5 or CXCR4)1. Consequently, the virus-cell membranes fuse, and the viral capsid (CA) core is released into the cytoplasm2. The CA core contains the viral genomic single-stranded RNA (ssRNA) and several proteins, both viral and cellular in origin. The CA-associated viral proteins include Reverse Transcriptase (RT) and integrase (IN), two enzymes that mediate critical steps during early events in viral replication. The RT and IN function in the context of nucleoprotein complexes, namely the Reverse Transcription Complex (RTC) and the pre-integration complex (PIC), respectively3,4,5,6. The ends of the viral ssRNA genome harbor terminal repeat (R) elements adjacent to the unique sequences U5 (at the 5&#39; end) and U3 (at the 3&#39; end). The RTC converts the viral ssRNA genome into a double-stranded (ds) DNA copy (vDNA). This reverse transcription process also results in duplication of the U5 and U3 sequences, thus generating long terminal repeats (LTR) at both ends of the vDNA7,8. Subsequently, the PIC-associated IN catalyzes two sequential biochemical reactions that enable the integration of the vDNA into the host chromosome9,10,11. First, in the cytoplasm, IN multimers engage both LTRs12 and cleave a dinucleotide from each of the 3&#39;-terminal ends. This 3&#39;-end processing generates a hydroxyl group at each 3&#39;-end (CAOH) of the vDNA. Next, PIC traffics to the nucleus, wherein IN uses the vDNA CAOH as a nucleophile to cut both strands of the chromosomal DNA in a staggered fashion. Simultaneously, IN coordinately splices both ends of the vDNA to the resulting phosphodiester bonds on opposite strands of the chromosomal DNA. Following this strand transfer step, the host cell machinery removes the two unpaired nucleotides at the 5&#39; ends of the vDNA and repairs the ensuing single-stranded gaps at the junction of the integration site. The early events thus culminate with the establishment of an integrated DNA copy (provirus) of the HIV-1 genome. The provirus provides a suitable environment for efficient viral gene expression, which initiates later events, including the expression of the virus-encoded proteins; assembly of the immature virus; and budding, release, and maturation into infectious virions13.
Purified recombinant retroviral IN is competent to carry out, in vitro, both 3&#39;-end processing and strand transfer activities on exogenously supplied LTR-like substrate DNA. Biochemical studies using such purified recombinant IN have revealed critical aspects of vDNA integration14,15,16,17. However, unlike in natural infection, this in vitro biochemical reaction does not support concerted integration of both ends of the substrate DNA into the target DNA. In contrast, retroviral PICs isolated from acutely infected cells concertedly integrate both ends of the endogenous vDNA into heterologous target DNA. This led to the widespread adoption and subsequent refinements of In Vitro&#160;Integration (IVI) assays using isolated native PICs.
In the first reported retroviral IVI assay, cytoplasmic extracts from cells infected with a recombinant Murine Leukemia Virus (MLV) harboring the E. coli supF gene in its LTR served as the source of IN activity, and the DNA of a mutant lambda phage defective in lytic growth was exogenously supplied as the target DNA. Successful integration of the recombinant MLV DNA copy into the phage DNA and the ensuing supF expression led to restoration of the plaque-forming ability of the recombinant phages. However, this experimental strategy is laborious and measures integration in an indirect manner. To address such caveats, a Southern blot-based indirect end-labeling assay, which quantifies the PIC-associated IVI activity as a measure of the endogenous vDNA integrated into exogenous linearized bacteriophage phiX174 DNA, was developed6,7,18. Though this method provides a direct measure of integration events, relatively high amounts of PIC preparation are required, which remains a technically challenging endeavor. To circumvent this, nested PCR-based assays requiring only modest amounts of PICs were developed4,5,19.
In this report, we describe an updated version of a nested PCR-based in vitro method devised to recapitulate the HIV-1 PIC-mediated integration activity occurring during natural infection. This method uses the cytoplasmic extracts of HIV-1-infected target cells as a source of endogenous PIC activity, which is measured with a real-time quantitative&#160;Polymerase Chain Reaction (qPCR). The procedures for isolating PICs and measuring their integration activities are adapted, with modifications, from protocols published by the Engelman laboratory20. In this method, the PIC-associated integration activity is initiated by providing an exogenous linear target DNA21, and the DNA products resulting from this integration reaction are purified and used as the starting material for subsequent PCR-based quantification. In the first-round conventional PCR, the viral-target DNA junctions are amplified by using appropriate primers. In the second-round qPCR, LTR-specific primers are used to specifically enrich the vDNA population from the first-round PCR products. Please see the protocol section for a detailed description of this method.
In vitro studies with retroviral PICs have led to significant advances in our understanding of the mechanism of retroviral DNA integration and in the development of IN inhibitors. Based on the recent increased focus on mapping HIV-1 integration sites, determining the role of viral and host factors in HIV-1 integration, and developing new antiviral drugs towards combating drug resistance, we envisage an increased interest in and widespread use of IVI assays, like the one described in this report. This, in turn, will lead to future refinements in the method, thereby diversifying the scope of its applications.

<table><tbody><tr><td>&lt;p&gt;Fetal Bovine Serum (FBS)&lt;/p&gt;</td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;10437-028&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Heat-inactivated Fetal Bovine Serum (Hi-FBS)&lt;/p&gt;</td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;10438-026&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Dulbecco&amp;rsquo;s modified Eagle&amp;rsquo;s medium (DMEM)&lt;/p&gt; &lt;p&gt;&lt;/p&gt; </td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;11995-065&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Roswell Park Memorial Institute (RPMI) 1640 medium&lt;/p&gt; </td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;11875-093&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Phosphate-buffered Saline (PBS) (1x)&lt;/p&gt;</td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;20012-027&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Trypsin-EDTA (0.25%)&lt;/p&gt; &lt;p&gt;&lt;/p&gt; </td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;25200-056&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Penicillin-Streptomycin solution (100x)&lt;/p&gt; </td><td> &lt;p&gt;Cellgro/Mediatech&lt;/p&gt; </td><td> &lt;p&gt;30-002-CI&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;HEK293T cells (293T)&lt;/p&gt; </td><td> &lt;p&gt;American Type Culture Collection (ATCC)&lt;/p&gt; </td><td> &lt;p&gt;CRL-3216&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;HIV-1 proviral molecular clone pNL4-3&lt;/p&gt; </td><td> &lt;p&gt;NIH AIDS Research and Reference Reagent Program&lt;/p&gt; &lt;p&gt;&lt;/p&gt; </td><td> &lt;p&gt;114&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;PolyFect transfection reagent&lt;/p&gt; </td><td> &lt;p&gt;Qiagen&lt;/p&gt; </td><td> &lt;p&gt;301107&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;DNase 1&lt;/p&gt; &lt;p&gt;&lt;/p&gt;</td><td> &lt;p&gt;Calbiochem/Merckmillipore&lt;/p&gt; </td><td> &lt;p&gt;260913&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Sup-T1 cells&lt;/p&gt;</td><td> &lt;p&gt;American Type Culture Collection (ATCC)&lt;/p&gt; </td><td> &lt;p&gt;CRL-1942&lt;/p&gt; &lt;p&gt;&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;HEPES pH 7.2 - 7.5&lt;/p&gt; &lt;p&gt;(ready-to-use solution)&lt;/p&gt;</td><td> &lt;p&gt;GIBCO/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;15630-080&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Potassium chloride (KCl) solution&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;60142&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Magnesium chloride (MgCl&lt;sub&gt;2&lt;/sub&gt;) solution&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;M1028&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Dithiothreitol (DTT)&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;43815&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Aprotinin&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;A6106&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Digitonin&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;D141&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;RNase A&lt;/p&gt; </td><td> &lt;p&gt;Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;12091-021&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Sucrose&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;S0389&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;phiX174 Replicative Form 1 DNA&lt;/p&gt; </td><td> &lt;p&gt;Promega&lt;/p&gt; </td><td> &lt;p&gt;D1531&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;&lt;u&gt;PhiX174-F primer:&lt;/u&gt;&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-CGCTTCCATGACGCAGAAGTT-3&amp;rsquo;&lt;/p&gt; &lt;p&gt;&lt;/p&gt; &lt;p&gt;&lt;u&gt;PhiX174-R primer:&lt;/u&gt;&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-CACTGACCCTCAGCAATCTTA-3&amp;rsquo;&lt;/p&gt; &lt;p&gt;&lt;/p&gt; &lt;p&gt;&lt;/p&gt; </td><td> &lt;p&gt;Invitrogen and/or IDT-DNA&lt;/p&gt; </td><td> &lt;p&gt;&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;dNTP mix&lt;/p&gt; </td><td> &lt;p&gt;Promega&lt;/p&gt; </td><td> &lt;p&gt;U1515&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Go Taq DNA Polymerase&lt;/p&gt; </td><td> &lt;p&gt;Promega&lt;/p&gt; </td><td> &lt;p&gt;M3005&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Qiaquick gel extraction kit&lt;/p&gt; </td><td> &lt;p&gt;Qiagen&lt;/p&gt; </td><td> &lt;p&gt;28706&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Ultrapure distilled water&lt;/p&gt; </td><td> &lt;p&gt;Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;10977-015&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Tris-EDTA (TE) buffer (100x)&lt;/p&gt;</td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;T9285&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Sodium Dodecyl Sulphate (SDS)&lt;/p&gt;</td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;L3771&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;E7889&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Proteinase K (20 mg/mL ready-to-use solution)&lt;/p&gt;</td><td> &lt;p&gt;Qiagen&lt;/p&gt; </td><td> &lt;p&gt;19131&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Phenol (equilibrated with 10&amp;nbsp;mM Tris HCl, pH&amp;nbsp;8.0 and 1&amp;nbsp;mM EDTA)&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;P4557&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;Chloroform&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;288306&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Glycogen (5 mg/mL solution)&lt;/p&gt;</td><td> &lt;p&gt;Ambion/Invitrogen&lt;/p&gt; </td><td> &lt;p&gt;AM9510&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;Sodium acetate (3 M, pH 5.2)&lt;/p&gt;</td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td>&lt;p&gt;S7899&lt;/p&gt;</td><td></td></tr><tr><td> &lt;p&gt;Ethanol&lt;/p&gt; </td><td> &lt;p&gt;Sigma-Aldrich&lt;/p&gt; </td><td> &lt;p&gt;E7023&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;&lt;u&gt;First round LTR primer&lt;/u&gt;:&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-GTGCGCGCTTCAGCAAG-3&amp;rsquo;&lt;/p&gt; &lt;p&gt;&lt;u&gt;First round phiX174 primer&lt;/u&gt;:&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-CACTGACCCTCAGCAATCTTA-3&amp;rsquo;&lt;/p&gt;</td><td> &lt;p&gt;Invitrogen and/or IDT-DNA&lt;/p&gt; </td><td> &lt;p&gt;---&lt;/p&gt; </td><td></td></tr><tr><td>&lt;p&gt;&lt;u&gt;Second round LTR-R primer&lt;/u&gt;:&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-TCTGGCTAACTAGGGAACCCA-3&amp;rsquo;&lt;/p&gt; &lt;p&gt;&lt;u&gt;Second round LTR-U primer&lt;/u&gt;:&lt;/p&gt; &lt;p&gt;5&amp;rsquo;-CTGACTAAAAGGGTCTGAGG-3&amp;rsquo;&lt;/p&gt; &lt;p&gt;&lt;/p&gt; &lt;p&gt;&lt;u&gt;Second round Taqman probe&lt;/u&gt;:&lt;/p&gt; &lt;p&gt;&amp;nbsp;5&amp;rsquo;-6- FAM/TTAAGCCTCAATAAAGCTTGC&lt;/p&gt; &lt;p&gt;CTTGAGTGC/6-TAMRA/-3&amp;rsquo;&lt;/p&gt;</td><td> &lt;p&gt;Invitrogen and/or IDT-DNA&lt;/p&gt; </td><td> &lt;p&gt;---&lt;/p&gt; </td><td></td></tr><tr><td> &lt;p&gt;iQ Supermix&lt;/p&gt; </td><td> &lt;p&gt;Bio-Rad&lt;/p&gt; </td><td> &lt;p&gt;170-8862&lt;/p&gt; </td><td></td></tr></tbody></table>

measurement of in vitro integration activity of hiv-1 preintegration complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3&#39; ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Isolation of HIV-1 PICs
A schematic of the protocol used for the isolation of HIV-1 PICs from acutely infected Sup-T1 cells is depicted in Figure 1. This protocol is derived from the methods described by Engelman et al.19,20. HIV-1 PICs are nucleoprotein complexes that are assembled in infected cells and are comprised of the rev...

Watch this Scientific Journal Video about Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes at JoVE.com

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

measurement-vitro-integration-activity-hiv-1-preintegration

Research

JoVE Journal

Immunology and Infection

7.5K Views.  Meharry Medical College. This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy. 

Video: Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

This manuscript describes the experimental procedure and software analysis for a bidirectional integration site assay that can simultaneously analyze upstream and downstream vector-host junction DNA. Bidirectional PCR products can be used for any downstream sequencing platform. The resulting data are useful for a high-throughput, quantitative comparison of integrated DNA targets.

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

Genetics

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are upregulated upon this ongoing antigen exposure and contribute to loss of proliferation, reduced cytolytic function, and impaired cytokine production by CD4 and CD8 T cells. In the murine model of LCMV infection, administration of blocking antibodies against these two pathways augmented T cell responses. However, there is currently no in vitro assay to measure the impact of such blockade on cytokine secretion in cells from human samples. Our protocol and experimental approach enable us to accurately and efficiently quantify the restoration of cytokine production by HIV-specific CD4 T cells from HIV infected subjects.
Here, we depict an in vitro experimental design that enables measurements of cytokine secretion by HIV-specific CD4 T cells and their impact on other cell subsets. CD8 T cells were depleted from whole blood and remaining PBMCs were isolated via Ficoll separation method. CD8-depleted PBMCs were then incubated with blocking antibodies against PD-L1 and/or IL-10R&#945; and, after stimulation with an HIV-1 Gag peptide pool, cells were incubated at 37 &#176;C, 5% CO2. After 48 hr, supernatant was collected for cytokine analysis by beads arrays and cell pellets were collected for either phenotypic analysis using flow cytometry or transcriptional analysis using qRT-PCR. For more detailed analysis, different cell populations were obtained by selective subset depletion from PBMCs or by sorting using flow cytometry before being assessed in the same assays. These methods provide a highly sensitive and specific approach to determine the modulation of cytokine production by antigen-specific T-helper cells and to determine functional interactions between different populations of immune cells.

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

We developed an in vitro assay to investigate the role of immunoregulatory pathways in the regulation of cytokine secretion by HIV-specific CD4 T cells.

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify new compounds that can inhibit infection by the common drug resistant HIV-1 strains with minimal toxicity. Here we describe an efficient assay that can be used to rapidly determine the cellular cytotoxicity and efficacy of a compound against WT and mutant viral strains.
The desired target cell line is seeded in a 96-well plate and, after a 24 hr incubation, serially dilutions of the compounds to be tested are added. No further manipulations are necessary for cellular cytotoxicity assays; for anti HIV assays a predetermined amount of either a WT or drug resistant HIV-1 vector that expresses luciferase is added to the cells. Cytotoxicity is measured by using an ATP dependent luminescence assay and the impact of the compounds on infectivity is measured by determining the amount of luciferase in the presence or the absence of the putative inhibitors.
This screening assay takes 4 days to complete and multiple compounds can be screened in parallel. Compounds are screened in triplicate and the data are normalized to the infectivity/ATP levels in absence of target compounds. This technique provides a quick and accurate measurement of the efficacy and toxicity of potential anti HIV compounds.

Here we describe cellular cytotoxicity and single round infectivity assays that allow for the rapid and accurate screening of compounds to determine their cellular cytotoxicity (CC50) and IC50 values against WT and drug resistant HIV-1.

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to extrapolate viral replication fitness, ranging from the number of viral particles per infectious unit, growth rate in cell culture, and relative fitness derived from multiple-cycle growth competition assays. Growth competition assays provide a particularly sensitive measurement of fitness since the viruses are competing for cellular targets under identical growth conditions. There are several experimental factors to consider when conducting growth competition assays, including the multiplicity of infection (MOI), sampling times, and viral detection and fitness calculation methods. Each factor can affect the end result and hence must be considered carefully during the experimental design. The protocol presented here includes steps from constructing a new recombinant HIV-1 clone to performing growth competition assays and analyzing the experimental results. This protocol utilizes experimental parameter values previously shown to yield consistent and robust results. Alternatives are discussed, as some parameters need to be adjusted according to the cell type and viruses being studied. The protocol contains two alternative viral detection methods to provide flexibility as the availability of instruments, reagents and expertise varies between laboratories.

Growth competition between nearly isogenic viruses provides a sensitive measurement for determining relative replication fitness. The protocols described here include the construction of recombinant HIV-1 clones, virus propagation and growth competition and analysis methods optimized to yield sensitive and consistent results.

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Assembly and Purification of Prototype Foamy Virus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an integrase (IN) enzyme that catalyzes the covalent joining of viral to host DNA, which is known as strand transfer. Integration may be modeled in vitro with recombinant retroviral IN and DNA oligomers mimicking the ends of the viral genome. In order to more closely recapitulate the integration reaction that occurs in vivo, integration complexes are assembled from recombinant IN and synthetic oligomers by dialysis in a reduced salt concentration buffer. The integration complex, called an intasome, may be purified by size exclusion chromatography. In the case of prototype foamy virus (PFV), the intasome is a tetramer of IN and two DNA oligomers and is readily separated from monomeric IN and free oligomer DNA. The integration efficiency of PFV intasomes may be assayed under a variety of experimental conditions to better understand the dynamics and mechanics of retroviral integration.

Recombinant retroviral integrase and DNA oligomers mimicking viral DNA ends can form an enzymatically active complex known as an intasome. Intasomes may be used for biochemical, structural, and kinetic studies. This protocol details how to assemble and purify prototype foamy virus intasomes.

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

A High-throughput Cre-Lox Activated Viral Membrane Fusion Assay to Identify Inhibitors of HIV-1 Viral Membrane Fusion

This assay is designed to specifically report on HIV-1 fusion via the expression of green fluorescent protein (GFP) detectable by flow cytometry or fluorescence microscopy. An HIV-1 reporter virus (HIV-1 Gag-iCre) is generated by inserting Cre recombinase into the HIV-1 genome between the matrix and the capsid proteins of the Gag polyprotein. This results in a packaging of Cre recombinase into virus particles, which is then released into a target cell line stably expressing a Cre recombinase-activated red fluorescent protein (RFP) to GFP switch cassette. In the basal state, this cassette expresses RFP only. Following the delivery of Cre recombinase into the target cell, the RFP, flanked by loxP sites, excises, resulting in GFP expression. This assay can be used to test any inhibitors of viral entry (specifically at the fusion step) in cell-free and cell-to-cell infection systems and has been used to identify a class of purinergic receptor antagonists as novel inhibitors of HIV-1 viral membrane fusion.

We describe a cell-based assay to report on HIV-1 fusion via the expression of green fluorescent protein detectable by flow cytometry or fluorescence microscopy. It can be used to test inhibitors of viral entry (specifically at the fusion step) in cell-free and cell-to-cell infection systems.

This assay is designed to specifically report on HIV-1 fusion via the expression of green fluorescent protein (GFP) detectable by flow cytometry or ...

Studying ER Stress and UPR Activation During HIV-1 Infection in T-Cells

Measuring Endoplasmic Reticulum Stress and Unfolded Protein Response in HIV-1 Infected T-Cells and Analyzing its Role in HIV-1 Replication

Viral infections can cause Endoplasmic Reticulum (ER) stress due to abnormal protein accumulation, leading to Unfolded Protein Response (UPR). Viruses have developed strategies to manipulate the host UPR, but there is a lack of detailed understanding of UPR modulation and its functional significance during HIV-1 infection in the literature. In this context, the current article describes the protocols used in our laboratory to measure ER stress levels and UPR during HIV-1 infection in T-cells and the effect of UPR on viral replication and infectivity. 
Thioflavin T (ThT) staining is a relatively new method used to detect ER stress in the cells by detecting protein aggregates. Here, we have illustrated the protocol for ThT staining in HIV-1 infected cells to detect and quantify ER stress. Moreover, ER stress was also detected indirectly by measuring the levels of UPR markers such as BiP, phosphorylated IRE1, PERK, and eIF2&#945;, splicing of XBP1, cleavage of ATF6, ATF4, CHOP, and GADD34 in HIV-1 infected cells, using conventional immunoblotting and quantitative reverse transcription polymerase chain reaction (RT-PCR). We have found that the ThT-fluorescence correlates with the indicators of UPR activation. This article also demonstrates the protocols to analyze the impact of ER stress and UPR modulation on HIV-1 replication by knockdown experiments as well as the use of pharmacological molecules. The effect of UPR on HIV-1 gene expression/replication and virus production was analyzed by Luciferase reporter assays and p24 antigen capture ELISA, respectively, whereas the effect on virion infectivity was analyzed by staining of infected reporter cells. Collectively, this set of methods provides a comprehensive understanding of the Unfolded Protein Response pathways during HIV-1 infection, revealing its intricate dynamics.

Author Spotlight: Exploring the Role of Unfolded Protein Response in HIV-1 Replication and Infectivity

Here, we describe some established methods to determine endoplasmic reticulum (ER) stress and unfolded protein response (UPR) activation, with particular emphasis on HIV-1 infection. This article also describes a set of protocols to investigate the effect of ER stress/UPR on HIV-1 replication and virion infectivity.

Viral infections can cause Endoplasmic Reticulum (ER) stress due to abnormal protein accumulation, leading to Unfolded Protein Response (UPR). Viruses ...

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

Samenvatting

Meer video's verkennen