이 작품은 부분적으로 CD에 NIDA / NIH 보조금 DA024558, DA30896, DA033892 및 DA021471에 의해 지원됩니다. 우리는 또한 RCMI 부여 G12MD007586을 인정, 밴더빌트 CTSA는 UL1RR024975을 부여의 Meharry 중개 연구의 중앙에 NCRR / NIH의 NIMHD / NIH에서 U54 그랜트 MD007593, 그리고 테네시 CFAR 보조금 P30의 AI110527에서 (MeTRC) CTSA 부여 U54의 RR026140.

1. 바이러스 생산 참고 : 감염성 HIV-1의 높은 역가를 생성 활성화 된 덴드리머 기반의 형질 전환 시약을 사용하여 감염성 HIV-1 분자 복제와 인간 배아 신장 (HEK) 세포주 293T를 형질합니다. 이 인산 칼슘 트랜 스펙 션 방법은 유사한 결과를 얻을 수 있음이 관찰되었다. <ol><li> 바이오 안전성 레벨 2 (BSL2) 실험실, 종자 8 10cm 접시 당 3 × 10 6 293T 세포 mL의 10 % 태아 소 혈청 (FBS), 페니실린과 스트렙토 마이신이 보충 된 둘 베코의 수정 독수리 중간 (DMEM)의. 문화 37 ° C로 설정 배양기 5 %의 셀 CO 2 O / N. </li><li> 다음날, 각 10cm 접시에 세포를 형질 감염에 대한 혈청과 항생제가없는 DMEM 300 μL의 최종 볼륨에 pNL4-3 플라스미드 DNA (참조 자료 표)의 8 μg의 희석. 의 형질 전환 시약 80 μL를 추가 피펫으로 잘 혼합하고 실온에서 부화5 - 형질 전환 복합체 형성을위한 10 분. </li><li> 흡인하여 요리에서 배지를 제거하고 혈청과 항생제가 포함 된 신선한 DMEM의 접시 당 7 mL를 넣어. </li><li> , 트랜 단지에 DMEM 포함 된 혈청과 항생제 1 mL를 넣고 피펫으로 혼합하고, 세포 혼합물을 추가합니다. 조심스럽게 형질 단지의 균일 한 분포를 용이하게 접시를 소용돌이 친다. </li><li> 즉시 48 시간 동안 세포를 CO 2, 37 ℃, 5 %로 설정 인큐베이터에서 BSL3 실험실 배치하는 셀을 전송하고 배양. </li><li> 피펫을 이용하여 바이러스 - 함유 조직 배양 상등액을 수집 한 후 원심 분리 튜브로 옮긴다. 5 분 동안 300 × g으로 원심 분리는 세포 파편 펠렛 후, 0.45 ㎛의 공극 크기의 주사기 필터로 상청액을 필터링한다. </li><li> 이 무 세포 바이러스 제제의 임의 이월 플라스미드 DNA를 제거하기 위해 1 시간 동안 37 ° C에서 하나의 DNase (20 μg의 / mL)로 처리한다. </li><li> 을 정량화하기그것은 일상적인 사용 (22)에 대한 신속하고 의무 방법으로 HIV-1 역가,은 P24 특정 효소 면역 분석 (ELISA)를 사용합니다. 주 : P24 ELISA 물리적 역가 (바이러스 입자의 수)를 측정된다는 사실을 주목해야한다. 대안으로, 바이러스 관련된 RT 활동 (외인성 RT 분석) 또는 바이러스 감염 (TZM-BL 표시 세포주 계 감염성 분석)를 측정하는 감염성 바이러스 입자를 제외한 판독을 제공한다. </li></ol> 먹어 볼래요-T1 세포의 2. 바이러스 감염 (BSL3 실험실) <ol><li> BSL2 연구실에서 1 6 10 × 10 × 1.0 6 2.0 세포 / 로즈웰 파크 기념 연구소 (RPMI) 10 % 열 - 불 활성화 FBS, 페니실린 보충 매체 및 스트렙토 마이신의 ㎖ (분할 비율 먹어 볼래요-T1 세포를 유지 : 2 매 2-3 D). 배양 플라스크로부터 섭-T1 세포 풀 피펫 팅하여 잘 혼합하고, 혈구 및 트리 판 블루 배제 성을 이용하여 생존 세포 수를 결정방법을 aining. <ol><li> 50 mL의 원뿔 원심 분리기 튜브에 (바이러스 감염 당) 80 × 10 6 세포의 분취 필요한 수를 준비합니다. </li><li> 500 XG에서 스윙 버킷 로터에서 세포를 원심 분리기, 5 분 동안 25 ° C. 세포 배양 배지를 제거하지 않고, 상기 처리를 위해 BSL3 실험실로 펠렛 세포를 함유하는 튜브에 옮긴다. 조심스럽게 세포 펠렛을 방해하지 않고, 튜브로부터 세포 배양 배지를 흡인. </li></ol></li><li> 관의 세포의 DNase I 처리 된 바이러스 접종 물을 적당량 첨가하고 부드럽게 피펫 팅하여 잘 혼합한다. 80 × 10 6 세포의 경우, DNase의 I-처리 바이러스 (P24-해당하는 바이러스의 50 μg의) 30 ㎖를 사용합니다. 참고 : 기능 PICS는의 분리는 감염의 매우 높은 다중도 (MOI)와 표적 세포를 감염이 필요합니다. </li><li> 균일 즉이 6 잘 조직 배양 플레이트 (12 X 2.5 mL를 씩 사이의 혼합물을 배포, 감염되고 당이 판을 사용이온). </li><li> spinoculation를 들어, 스윙 버킷 480 XG에 로터와 2 시간 동안 25 ° C를 사용하여 플레이트 캐리어 원심 분리기의 문화 판을 놓습니다. </li><li> 5 시간 동안 CO (2)을 37 ° C에서 spinoculated 세포를 인큐베이션하고, 5 %. </li></ol> 감염된 세포의 3. 수확 및 용해 (BSL3 실험실) <ol><li> 한 50㎖ 원추형 원심 분리 튜브에 배양 플레이트에서 각각 감염에 대응하는 셀 (~ 총 30 ml)에 풀. </li><li> 300 × g으로 원심 분리하여 세포를 수확하고 10 분 동안 25 ° C. 조심스럽게 튜브에서 뜨는을 대기음 (또는, 피펫 사용). </li><li> 남아있는 바이러스 입자를 제거하려면 버퍼 K 2 ㎖를 추가하여 각각의 세포 펠렛을 씻어 - / - (150 밀리미터의 KCl, 20 mM의 HEPES, pH가 7.6, 5 밀리미터의 MgCl 2) 300 XG에 샘플 25 ° C에 대한 원심 분리 10 분. 그 후, 펠렛을 방해하지 않고, 조심스럽게 흡인에 의해 또는 피펫을 이용하여 상층 액을 제거합니다. </li><li> Repeat 단계 3.3. </li><li> 조심스럽게 마이크로 피펫을 사용하여 남아있는 버퍼를 제거합니다. 빙냉 용해 완충액 K 2 ㎖에 각 세포 펠렛을 재현 탁 + / + (버퍼 K - / - 0.025 %의 디기 토닌, 1 mM의 DTT, 20 μg의 / ㎖ 아프로 티닌 보충) 부드러운 피펫 팅하여 내용물을 혼합하고, 편입 2 ML의 microcentrifuge 관. </li></ol> 세포질의 PICS는 4. 준비 (BSL3 실험실) <ol><li> 실온에서 10 분 동안 회전 진탕 기에서 샘플 락. </li><li> 1,500 XG에서, 4 ° C에 예비 냉각 로터와, 샘플을 원심 분리기 4 분 동안 4 ° C. </li><li> 펠렛을 방해하지 않고, 신중 16,000 XG에서 새로운 microcentrifuge 관과 원심 분리기에 뜨는을 전송하고 1 분 4 ° C. </li><li> 조심스럽게 새로운 microcentrifuge 관에 뜨는을 전송합니다. 30 분 (NO 요동)을 실온에서 20 μg의 내용 / ㎖ (찍어 2ml를 2 μL)의 최종 농도의 RNase A (20 ㎎ / ㎖)를 첨가하고, 배양한다. &lt;/ 리&gt; <li> 7 %의 최종 농도로 부드러운 피펫으로 잘 혼합 (- - / 버퍼 K에 w 60 % / v)의 크로스를 추가합니다. 액체 질소에서 동결 플래시 및 장소에서 -80 장기 보존 C 냉동기 °, 마이크로 원심 튜브에 분취 찍어 (예, 200 μL)를 준비한다. </li></ol> 체외 통합 5. (IVI) 분석 실험은 HIV-1 사진을 사용하여 <ol><li> 주문 제작 프라이머, phiX174-F와 phiX174-R을 사용하여 PCR로 phiX174 플라스미드 DNA에서 2.0 kb의 영역을 증폭하여 IVI 분석에 사용되는 타겟 DNA를 준비합니다. <ol><li> 표 1에 기재된 바와 같이 PCR 혼합물을 조립한다. 표 2에서 권장 열 사이클링 조건을 사용하여 열 순환기 PCR을 수행한다. (제조사 권장 프로토콜 다음) 겔 정제 키트를 사용하여 PCR 생성물을 겔 - 정제하고, 사용시까지 -80 ℃에서 분취로 정제 된 타겟 DNA를 저장한다. </li></ol></li><li> (200)에 표적 DNA 600 ng의 추가 - &amp; #(181), PICS는의 L 나누어지는이 잘 혼합하고, 45 분 동안 37 ° C에서 품어. 참고 : 인테그라 제 억제제 (예를 들어, Raltegravir)을 대상 DNA를 생략하거나 포함 IVI 반응은 제어 반응을 권장합니다. </li><li> 0.5 %, 8 mm의 각각 0.5 ㎎ / ㎖의 최종 농도로 SDS, EDTA, 및 프로 티나 제 K를 첨가하여 IVI 반응을 멈춘다. 철저하게 반응 내용을 혼합하고 하룻밤에 56 ° C를 품어. </li><li> 그 다음날, 페놀 / 클로로포름 추출 및 에탄올 침전에 의해 IVI 반응에서 전체 DNA를 정제. 16,000 XG 및 RT의 모든 원심 분리 단계를 수행하십시오. </li><li> 2 분 들어, 탈 단백 시료에 페놀의 동일한 볼륨을 추가 텍싱에 의해 격렬하게 혼합하고, 원심 분리기. 조심스럽게 위 수성 상을 제거하고 새로운 튜브로 전송할 수 있습니다. </li><li> 단계를 반복 5.5. 새로운 튜브로 위 수성 위상을 전송합니다. </li><li> , 클로로포름 혼합물 텍싱에 의해 격렬하게 혼합하고, 원심 분리 기용 : 1 페놀 : 1의 동일한 볼륨을 추가R 2 분. 새로운 튜브로 위 수성 위상을 전송합니다. </li><li> 클로로포름의 동일한 볼륨을 추가 텍싱에 의해 격렬하게 혼합하고, 2 분 동안 원심 분리. 새로운 튜브로 위 수성 위상을 전송합니다. </li><li> , DNA를 침전 0.3 M의 최종 농도 0.1 μg의 / μL, 초산 나트륨 3 M의 최종 농도로 글리코겐을 추가하고, 100 % 에탄올 (빙냉) 2.5 볼륨. 소용돌이는 내용을 수집, 원심 분리기 간략하게 혼합하고, -80 ° CO / N에 튜브를 배치합니다. </li><li> 다음 날, 16,000 XG에서 30 분 동안 샘플을 원심 분리하고 30 분 동안 4 ° C. 조심스럽게 펠렛을 방해하지 않고 뜨는을 제거합니다. </li><li> 16,000 XG에서 펠렛 원심 분리기 80 % 에탄올 (얼음처럼 차가운) 500 μL를 추가하고 10 분 동안 4 ° C. RT에서 DNA 펠렛을 공기 - 건조하고 철저하게 클레아없는 물 50 μL에 재현 탁. -20 ° C에서 DNA 샘플을 저장합니다. </li></ol> 정량화 PIC 활동 6. PCR 분석 실험 <ol><li> 통합 된 HIV-1 DNA의 접합을 증폭 (각각 LTR 및 phiX174 프라이머) 바이러스 LTR과 phiX174 DNA를 대상으로 프라이머를 사용하여 1 라운드 기존의 PCR을 수행합니다. <ol><li> 표 3에 기재된 바와 같이 1 라운드 PCR 혼합물을 조립한다. 템플릿 DNA를 제외한 모든 구성 요소의 마스터 믹스를 조립, 별도의 PCR 튜브에 45 μL 씩 분배하고, 템플릿 DNA 또는 클레아없는 물 (제어)의 5 μL를 추가합니다. </li><li> 표 4에서 권장 열 사이클링 조건을 사용하여 열 순환기 PCR을 수행한다. </li></ol></li><li> 상기 제 1 로로부터 집적 vDNA 서열을 증폭 바이러스 LTR (LTR-R 및 LTR-U 프라이머)의 짧은 영역의 측면에 프라이머를 사용하여 두 번째 라운드 qPCR을 수행싶게 PCR 제품. 통합 vDNA 숫자를 복사 확인하려면 알려진 사본 번호의 10 배 연속 희석을 사용하여 표준 곡선을 생성 (예를 들어, 10 0-10 8) HIV-1 분자 클론의. <ol><li> 표 5에 기재된 바와 같이 2 라운드 qPCR의 혼합물을 조립한다. 96 웰 PCR 반응 플레이트에 웰의 적절한 수에 25 μL 씩 분배주의, 템플릿 DNA를 제외한 모든 구성 요소의 마스터 믹스를 조립 한 후 정제되지 않은 1 라운드의 PCR 제품이나 클레아없는 물을 5 μL를 추가 (제어). 세중의 모든 qPCR에 반응을 수행합니다. </li><li> 실시간 PCR 장비로 PCR 플레이트를 넣고 표 6에 추천 사이클링 조건을 사용하여 qPCR을 수행합니다. </li><li> 적합한 소프트웨어를 사용하여 데이터를 분석한다. </li></ol></li></ol>

<ol>
	<li>Sattentau, Q. J., Weiss, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CD4+antigen:+physiological+ligand+and+HIV+receptor.">The CD4 antigen: physiological ligand and HIV receptor.</a> Cell. 52 (5), 631-633 (1988).</li><li>Wilen, C. B., Tilton, J. C., Doms, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+HIV+entry.">Molecular mechanisms of HIV entry.</a> Adv Exp Med Biol. 726, 223-242 (2012).</li><li>Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nucleoprotein+complex+mediates+the+integration+of+retroviral+DNA.">A nucleoprotein complex mediates the integration of retroviral DNA.</a> Genes Dev. 3 (4), 469-478 (1989).</li><li>Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+nuclear+import+of+human+immunodeficiency+virus+type+1+preintegration+complexes.">Active nuclear import of human immunodeficiency virus type 1 preintegration complexes.</a> Proc Natl Acad Sci. 9 (14), 6580-6584 (1992).</li><li>Hansen, M. S., Smith, G. J., Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+complexes+derived+from+HIV+vectors+for+rapid+assays+in+vitro.">Integration complexes derived from HIV vectors for rapid assays in vitro.</a> Nature biotechnol. 17 (6), 578-582 (1999).</li><li>Farnet, C. M., Haseltine, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+human+immunodeficiency+virus+type+1+DNA+in+vitro.">Integration of human immunodeficiency virus type 1 DNA in vitro.</a> Proc Natl Acad Sci. 87 (11), 4164-4168 (1990).</li><li>Fujiwara, T., Mizuuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration:+structure+of+an+integration+intermediate.">Retroviral DNA integration: structure of an integration intermediate.</a> Cell. 54 (4), 497-504 (1988).</li><li>Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+integration+of+retroviral+DNA+in+vitro.">Correct integration of retroviral DNA in vitro.</a> Cell. 49 (3), 347-356 (1987).</li><li>Lewinski, M. K., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration--mechanism+and+consequences.">Retroviral DNA integration--mechanism and consequences.</a> Adv Genet. 55, 147-181 (2005).</li><li>Engelman, A., Mizuuchi, K., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-1+DNA+integration:+mechanism+of+viral+DNA+cleavage+and+DNA+strand+transfer.">HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer.</a> Cell. 67 (6), 1211-1221 (1991).</li><li>Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+of+retroviral+integration.">Genetics of retroviral integration.</a> Ann rev gen. 26, 527-544 (1992).</li><li>Panganiban, A. T., Temin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+terminal+nucleotides+of+retrovirus+DNA+are+required+for+integration+but+not+virus+production.">The terminal nucleotides of retrovirus DNA are required for integration but not virus production.</a> Nature. 306 (5939), 155-160 (1983).</li><li>Bieniasz, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell+biology+of+HIV-1+virion+genesis.">The cell biology of HIV-1 virion genesis.</a> Cell host microbe. 5 (6), 550-558 (2009).</li><li>Sherman, P. A., Fyfe, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+immunodeficiency+virus+integration+protein+expressed+in+Escherichia+coli+possesses+selective+DNA+cleaving+activity.">Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity.</a> Proc Natl Acad Sci. 87 (13), 5119-5123 (1990).</li><li>Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+avian+retroviral+integration+protein+cleaves+the+terminal+sequences+of+linear+viral+DNA+at+the+in+vivo+sites+of+integration.">The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration.</a> J Virol. 63 (12), 5319-5327 (1989).</li><li>Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+in+vitro+assay+for+HIV+DNA+integration.">A rapid in vitro assay for HIV DNA integration.</a> Nucl acid res. 19 (10), 2729-2734 (1991).</li><li>Bushman, F. D., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activities+of+human+immunodeficiency+virus+(HIV)+integration+protein+in+vitro:+specific+cleavage+and+integration+of+HIV+DNA.">Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA.</a> Proc Natl Acad Sci. 88 (4), 1339-1343 (1991).</li><li>Pauza, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+bases+are+deleted+from+the+termini+of+HIV-1+linear+DNA+during+integrative+recombination.">Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination.</a> Virology. 179 (2), 886-889 (1990).</li><li>Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+analysis+of+HIV-1+preintegration+complexes.">Isolation and analysis of HIV-1 preintegration complexes.</a> Meth Mol Biol. 485, 135-149 (2009).</li><li>Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+HIV-1+preintegration+complexes.">Quantitative analysis of HIV-1 preintegration complexes.</a> Methods. 47 (4), 283-290 (2009).</li><li>Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cocaine+modulates+HIV-1+integration+in+primary+CD4++T+cells:+implications+in+HIV-1+pathogenesis+in+drug-abusing+patients.">Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients.</a> J Leuk Biol. 97 (4), 779-790 (2015).</li><li>Wehrly, K., Chesebro, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p24+antigen+capture+assay+for+quantification+of+human+immunodeficiency+virus+using+readily+available+inexpensive+reagents.">p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents.</a> Methods. 12 (4), 288-293 (1997).</li></ol>

저자는 더 경쟁 재무 및 비재무 이익을 선언합니다.

레트로 바이러스 PICS는의 생화학 적 분석은 레트로 바이러스 DNA 통합의 메커니즘에 중요한 통찰력을 제공하고 있습니다. 레트로 바이러스 찍어 통합 활성 측정은 플라크 형성 분석법, 서던 블롯 분석, 및 중첩 qPCR에 의해 달성 될 수있다. 플라크 분석의 실험적 전략은 힘든이고 통합 6, 7, 18를 측정하는 간접 방법을 이용한다. ?...

초기와 후기 이벤트 : 표적 세포에서 HIV-1 복제는 크게 두 단계로 구분 여러 단계를 포함한다. HIV-1을 순차적으로 표적 세포 표면 수용체 CD4 및 두 개의 공동 수용체 (CCR5 또는 CXCR4 1) 중 하나에 결합 할 때 초기 이벤트는 시작한다. 따라서, 바이러스 세포막 퓨즈 및 바이러스 캡시드는 (CA) 코어는이 세포질로 방출된다. 칼슘 코어는 바이러스와 기원 세포 모두 바이러스 게놈의 단일 가닥 RNA (ssRNA) 및 여러 가지 단백질을 포함하고 있습니다. 칼슘 - 관련 바이러스 성 단백질은 역전사 효소 (RT) 및 인테그라 (IN), 바이러스 복제의 초기 발생시 중요한 단계를 매개이 효소를 포함한다. 역전사 및 핵 단백질 복합체, 즉 역전사 착체 (RTC) 및 사전 통합 복합체 (PIC)는 각각 3, 4, 5의 문맥 함수 IN &lt;SUP&gt; 6. &quot;(말 3에서) (끝 U3 바이러스 ssRNA 게놈 항구 터미널 반복 (R) 5시) &#39;고유 시퀀스 U5에 인접 요소의 끝. RTC는 이중 가닥 (DS) DNA 사본 (vDNA)에 바이러스 ssRNA 게놈 변환합니다. 이 역전사 과정은 따라서 vDNA (7, 8)의 양단의 긴 말단 반복 (LTR)을 생성하는 U5 및 U3 서열의 중복을 초래한다. 이어서, PIC 관련 IN 호스트 염색체 9, 10, 11로 vDNA의 통합을 가능하게 두 개의 연속 생화학 적 반응을 촉매한다. 우선, 세포질, 다량 모두의 LTR (12)와 결합 및 3&#39;- 말단의 각각으로부터 뉴클레오티드를 절단. 이것은 3&#39;- 말단 처리가 각 3&#39;- 단부 vDNA의 (CA OH)에 수산기를 생성한다.IN은 지그재그 방식으로 염색체 DNA의 두 가닥을 절단하는 친핵체로서 오 vDNA CA를 사용하는 것을 특징이어서, PIC는 핵 트래 피킹. 동시에, IN은 배위 염색체 DNA의 반대쪽 가닥에 생성 된 포스 포디 에스테르 결합에 vDNA의 양 단부를 접합한다. 이 스트랜드 전사 공정 후, 숙주 세포 기계 통합 사이트의 교차점에서 5 &#39;를 vDNA의 단부 및 수리 계속되는 본쇄 갭의 2 개의 비 결합 (unpaired) 뉴클레오타이드를 제거한다. 초기 이벤트는 따라서 HIV-1 게놈의 통합 DNA 사본 (프로 바이러스)의 설립과 함께 절정에 달하다. 프로 바이러스는 바이러스 - 인 코드 된 단백질의 발현을 포함하여 이후의 이벤트를 시작 효율적인 바이러스 유전자 발현에 적합한 환경을 제공하고; 미성숙 바이러스의 조립; 감염성 비리 (13)에 신진, 릴리스 및 성숙. 정제 된 재조합 레트로 바이러스의 IN은에 능력이시험관 내에서, 수행, 모두 3&#39;- 말단 처리 및 가닥 전송 활동에 외생 적 LTR 같은 기판 DNA 제공. 이러한 정제 된 재조합의 IN을 사용하여 생화학 연구 vDNA 통합 14, 15, 16, 17의 중요한 측면을 계시했다. 그러나, 자연 감염과는 달리,이 시험 관내 생화학 적 반응은 표적 DNA에 기판 DNA의 양 단부의 공동의 통합을 지원하지 않는다. 대조적으로, 심하게 감염된 세포로부터 단리 레트로 찍어 concertedly 이종 대상 DNA로 내인성 vDNA의 양단을 통합한다. 이것은 고립 된 원시 사진을 사용하여 널리 채택 및 I n은 체외 통합 (IVI) 분석의 후속 개선되었다. 처음에 레트로 바이러스 IVI 분석, 재조합 쥐에 감염된 세포로부터 세포질 추출물을보고그 LTR의 대장균 supF 유전자 형질 백혈병 바이러스 (MLV)는 IN 활성 소스 및 용균 성장 결함이 외생 대상 DNA로 공급 하였다 돌연변이 람다 파지 DNA 역임. 재조합 MLV DNA의 성공적인 통합은 파지 DNA에 복사하고 supF 다음의 표현은 재조합 파지의 플라크 형성 능력의 복원되었다. 그러나이 실험 전략은 간접적 인 방식으로 힘들고 조치 통합이다. 이러한주의 사항을 해결하기 위하여, 외인성 선형 박테리오 phiX174 DNA에 통합 내인성 vDNA의 척도로서 PIC 관련 IVI 활성을 정량화 서던 블롯 기반 간접 단부 라벨링 분석은, 18 (7), (6)을 개발 하였다. 이 방법은 통합 이벤트의 직접적인 측정을 제공하지만, PIC 제제의 상대적으로 높은 양의 기술적 도전 유지하는 필요노력. 이 문제를 회피하기 위해, PICS는의 적당한 양을 필요로하는 중첩 된 PCR 기반의 분석은, 19 (5), 4 개발되었다. 이 보고서에서 우리는의 업데이트 된 버전을 설명 중첩 된 자연 감염시 발생하는 HIV-1 PIC 매개 통합 활동을 요점을 되풀이하기 위해 고안 체외 방법에서 PCR 기반. 이 방법은 실시간 정량 중합 효소 연쇄 반응 (qPCR에)로 측정 PIC 내인성 활성 소스로서 HIV-1 감염 표적 세포의 세포질 추출물을 사용한다. 자신의 통합 활동을 사진을 분리하고 측정하기위한 절차는 Engelman 실험실 (20)에 의해 출판 프로토콜에서, 수정과, 적응하고 있습니다. 이 방법에서, PIC 관련된 통합 활동 외인성 선형 표적 DNA (21)로부터 생성 된 DNA의 제품을 제공함으로써 개시된다이러한 통합 반응으로 정제 이후 PCR 기반 정량 용 원료로서 사용된다. 제 1 라운드 PCR 통상적으로, 바이러스 표적 DNA 접합은 적절한 프라이머를 사용하여 증폭된다. 두 번째 라운드에서 qPCR에가, LTR 특정 프라이머는 특히 1 라운드 PCR 제품에서 vDNA 인구를 풍부하게하는 데 사용됩니다. 이 방법에 대한 자세한 설명을위한 프로토콜 섹션을 참조하십시오. 레트로 바이러스 찍어와 시험관 연구에서 레트로 바이러스 DNA 통합의 메커니즘에 대한 우리의 이해와 IN 억제제의 개발에 상당한 발전을 주도하고있다. HIV-1 통합 바이러스 및 호스트 요인의 역할을 결정하고, 약물 내성 퇴치를 향해 새로운 항 바이러스 약물을 개발, 매핑 HIV-1 통합 사이트에서 최근 증가 초점을 바탕으로, 우리는 IVI 분석의 증가 된 관심과 광범위한 사용을 직시 이 보고서에 설명 된 것과 같은. 이 차례로 이어질 것상기 방법은 향후 개선함으로써, 그 응용 범위를 다양.

<table align="left" border="1" cellpadding="0" cellspacing="0" style="width:679px;" width="679">
	<tbody>
		<tr>
			<td style="width:312px;">
			Fetal bovine serum (FBS)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			10437-028
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:34px;">
			Heat-inactivated Fetal bovine serum (Hi-FBS)
			</td>
			<td style="width:198px;height:34px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:34px;">
			10438-026
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:42px;">
			Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM)
			
			</td>
			<td style="width:198px;height:42px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:42px;">
			11995-065
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Roswell Park Memorial Institute (RPMI) 1640 medium
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			11875-093
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phosphate buffered saline (PBS) (1X)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			20012-027
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Trypsin-EDTA (0.25%)
			
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			25200-056
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Penicillin-Streptomycin solution (100x)
			</td>
			<td style="width:198px;">
			Cellgro/Mediatech
			</td>
			<td style="width:138px;">
			30-002-CI
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEK293T cells (293T)
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-3216
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV-1 proviral molecular clone pNL4-3
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			114
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PolyFect transfection reagent
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			301107
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			DNase
			
			</td>
			<td style="width:198px;">
			Calbiochem/Merckmillipore
			</td>
			<td style="width:138px;">
			260913
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Immulon 2HB 96-well plates
			
			</td>
			<td style="width:198px;">
			Thermo Scientific
			
			</td>
			<td style="width:138px;">
			3455
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Triton X-100
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9284
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA coating antibody: anti-CA-183-H12-5C monoclonal antibody
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			1513
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA wash solution (0.2% Tween-20 in PBS)
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Donor bovine serum
			</td>
			<td style="width:198px;">
			&#160;Gibco/Invitrogen
			</td>
			<td style="width:138px;">
			16030074
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:78px;">
			Blocking Buffer (5% donor bovine serum in PBS) - Prepare fresh before use.
			
			</td>
			<td style="width:198px;height:78px;">
			---
			</td>
			<td style="width:138px;height:78px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sample diluent (SD) buffer (10% donor bovine serum and 0.5% Triton X-100 in PBS) - Sterilize using 0.22 micron pore-size syringe filter and store aliquots at 4&#176;C.
			
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Recombinant p24 protein
			(Full-length CA protein was expressed from pET21a-CA plasmid in E. coli BL21-DE3 and purified as described in Ref # ----)
			</td>
			<td style="width:198px;">
			Dr. Wesley Sundquist
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV IgG
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			3957
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Goat anti-human IgG (H+L) cross-adsorbed secondary antibody, HRP conjugate
			</td>
			<td style="width:198px;">
			Pierce/ThermoFisher
			
			</td>
			<td style="width:138px;">
			31412
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			TMB Microwell Peroxidase substrate system
			</td>
			<td style="width:198px;">
			KPL, Inc.
			</td>
			<td style="width:138px;">
			50-76-00
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			SupT1 cells
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-1942
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEPES pH 7.2-7.5
			(ready-to-use solution)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			15630-080
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Potassium chloride (KCl) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			60142
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Magnesium chloride (MgCl2) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			M1028
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Dithiothreitol (DTT)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			43815
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Aprotinin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			A6106
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Digitonin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			D141
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			RNase A
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			12091-021
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:29px;">
			Sucrose
			</td>
			<td style="width:198px;height:29px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:29px;">
			S0389
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			phiX174 Replicative Form 1 DNA
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			D1531
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PhiX174-F primer:
			5&#8217;-CGCTTCCATGACGCAGAAGTT-3&#8217;
			
			PhiX174-R primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			
			
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			dNTP mix
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			U1515
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Go Taq DNA Polymerase
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			M3005
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Qiaquick gel extraction kit
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			28706
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ultrapure distilled water
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			10977-015
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Tris-EDTA (TE) buffer (100X)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9285
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium dodecyl sulphate (SDS)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			L3771
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:50px;">
			Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0
			</td>
			<td style="width:198px;height:50px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:50px;">
			E7889
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Proteinase K (20 mg/ml ready-to-use solution)
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			19131
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phenol (equilibrated with 10&#160;mM Tris HCl, pH&#160;8.0 and 1&#160;mM EDTA)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			P4557
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Chloroform
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			288306
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Glycogen (5 mg/ml solution)
			</td>
			<td style="width:198px;">
			Ambion/Invitrogen
			</td>
			<td style="width:138px;">
			AM9510
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium acetate (3M, pH 5.2)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			57899
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ethanol
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			E7023
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			First round LTR primer:
			5&#8217;-GTGCGCGCTTCAGCAAG-3&#8217;)
			First round phiX174 primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Second round LTR-R primer:
			5&#8217;-TCTGGCTAACTAGGGAACCCA-3&#8217;
			Second round LTR-U primer:
			5&#8217;-CTGACTAAAAGGGTCTGAGG-3&#8217;;
			
			Second round Taqman probe:
			&#160;5&#8217;-56- FAM/TTAAGCCTCAATAAAGCTTGC
			CTTGAGTGC/36-TAMRA/-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			iQ Supermix
			</td>
			<td style="width:198px;">
			Bio-Rad
			</td>
			<td style="width:138px;">
			170-8862
			</td>
		</tr>
	</tbody>
</table>

measurement of in vitro integration activity of hiv-1 preintegration complexes

HIV-1 외피 단백질은 세포질로의 바이러스 캡시드 (CA) 코어의 박리 하였다 바이러스 세포 막 융합을 유도하는 표적 세포의 표면에 동족 수용체 결합. 이어서, 바이러스 성 역전사 효소 (RT)를하는 딴 핵 단백질 복합체의 일부로서 복합 역전사 (RTC)를 이중 - 가닥 DNA 카피 (vDNA)에 바이러스의 단일 가닥 RNA 게놈을 변환 불린다. 이것은 다른 핵 단백질 복합체의 생물 발생에 이르게 상기 vDNA과 관련된 바이러스 단백질, 숙주 인자 이루어지는 사전 통합 복합체 (PIC)를 불린다. PIC는 관련 바이러스 인테그라 제 (IN)은 시간적 및 공간적으로 조절 두 단계에서 호스트 염색체 DNA 내로 vDNA의 통합을 조정한다. 우선, IN은 PIC의 핵 트래 피킹 후에는 염색체 DNA 내로 통합 처리 vDNA을 매개, 둘째, 세포질에서 vDNA의 3 &#39;말단을 처리하고. 찍어 절연그들이 이종 외생 첨가 타겟 DNA에 관련된 vDNA를 통합하는 능력이 급격 같이 HIV-1 감염 표적 세포에서 시험 관내 기능이다. 이러한 PIC 기반 체외 통합 분석에서 크게 레트로 바이러스 통합의 기계적인 세부 사항을 서술 및 억제제 년에 발견에 기여했다. 이보고에서는 절연 기본 찍어 관내 통합 활동을 측정하기위한 중첩 정량적 실시간 중합 효소 연쇄 반응 (qPCR에) 기반 전략을 채택 업데이트 HIV-1 PIC 분석에 상세히.

HIV-1 PICS는의 분리 급성 감염 섭-T1 세포에서 HIV-1 찍어 분리에 사용되는 프로토콜의 개략도는도 1에 도시되어있다. 이 프로토콜은 Engelman 등에 의해 기술 된 방법에서 파생됩니다. 19, 20. HIV-1 감염 세포 찍어 조립하고 역전사 vDNA 구성되어 핵 단백질 복...

Watch this Scientific Journal Video about Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes at JoVE.com

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

측정<em&gt; 체외</em&gt; HIV-1 사전 통합 단지의 통합 활동

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

measurement-vitro-integration-activity-hiv-1-preintegration

Research

JoVE Journal

Immunology and Infection

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

7.4K 조회수.  Meharry Medical College. This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy. 

비디오: Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

V3의 HIV - 1 Tropism의 Genotypic 추론 사용 인구를 기반 시퀀싱

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

연구

면역학 및 감염병학

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

HIV - 1 코어의 시험 관내 Uncoating에서

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Imaging of HIV-1 Envelope-induced Virological Synapse and Signaling on Synthetic Lipid Bilayers

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between CD4+ T cells involves the formation of a virological synapse (VS), which is an F-actin-dependent cell-cell junction formed upon the engagement of HIV-1 envelope gp120 on the infected cell with CD4 and the chemokine receptor (CKR) CCR5 or CXCR4 on the target cell 8. In addition to gp120 and its receptors, other membrane proteins, particularly the adhesion molecule LFA-1 and its ligands, the ICAM family, play a major role in VS formation and virus transmission as they are present on the surface of virus-infected donor cells and target cells, as well as on the envelope of HIV-1 virions1,4,5,6,7,13. VS formation is also accompanied by intracellular signaling events that are transduced as a result of gp120-engagement of its receptors. Indeed, we have recently showed that CD4+ T cell interaction with gp120 induces recruitment and phosphorylation of signaling molecules associated with the TCR signalosome including Lck, CD3&zeta;, ZAP70, LAT, SLP-76, Itk, and PLC&gamma;15.
In this article, we present a method to visualize supramolecular arrangement and membrane-proximal signaling events taking place during VS formation. We take advantage of the glass-supported planar bi-layer system as a reductionist model to represent the surface of HIV-infected cells bearing the viral envelope gp120 and the cellular adhesion molecule ICAM-1. The protocol describes general procedures for monitoring HIV-1 gp120-induced VS assembly and signal activation events that include i) bi-layer preparation and assembly in a flow cell, ii) injection of cells and immunofluorescence staining to detect intracellular signaling molecules on cells interacting with HIV-1 gp120 and ICAM-1 on bi-layers, iii) image acquisition by TIRF microscopy, and iv) data analysis. This system generates high-resolution images of VS interface beyond that achieved with the conventional cell-cell system as it allows detection of distinct clusters of individual molecular components of VS along with specific signaling molecules recruited to these sub-domains.

This article describes a method to visualize formation of an HIV-1 envelope-induced virological synapse on glass supported planar bilayers by total internal reflection fluorescence (TIRF) microscopy. The method can also be combined with immunofluorescence staining to detect activation and redistribution of signaling molecules that occur during HIV-1 envelope-induced virological synapse formation.

의 이미징 HIV-1 봉투 유발 Virological 시냅스와 합성 지질 Bilayers에 신호

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

<em&gt; 체외에서</em공부하기&gt; 공동 감염 모델<em&gt; Plasmodium falciparum</em인간의 기본 단핵구 파생 면역 세포에서&gt; - HIV-1 상호 작용

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

제한 효소 기반의 복제 방법을 평가하기 위해<em&gt; 시험관</em&gt; HIV-1 서브 타입 C 개그 - MJ4 키메라 바이러스의 복제 능력

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

셀 기반의 ELISA 분석을 사용하여 HIV-1 삼량 봉투 당 단백질의 구조적 평가

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

HIV-1 양성 개인의 플라즈마에서 엑소 좀의 분리

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle (GUV) Membranes

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an essential step for virus particle formation, since a defect in Gag membrane binding results in severe impairment of viral particle production. To gain mechanistic details of Gag-lipid membrane interactions, in vitro methods based on NMR, protein footprinting, surface plasmon resonance, liposome flotation centrifugation, or fluorescence lipid bead binding have been developed thus far. However, each of these in vitro methods has its limitations. To overcome some of these limitations and provide a complementary approach to the previously established methods, we developed an in vitro assay in which interactions between HIV-1 Gag and lipid membranes take place in a &#34;cell-like&#34; environment. In this assay, Gag binding to lipid membranes is visually analyzed using YFP-tagged Gag synthesized in a wheat germ-based in vitro translation system and GUVs prepared by an electroformation technique. Here we describe the background and the protocols to obtain myristoylated full-length Gag proteins and GUV membranes necessary for the assay and to detect Gag-GUV binding by microscopy.

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle GUV Membranes

We illustrate here an in vitro membrane binding assay in which interactions between HIV-1 Gag and lipid membranes are visually analyzed using YFP-tagged Gag synthesized in a wheat germ-based in vitro translation system and GUVs prepared by an electroformation technique.

거대한 단일 층 소포 (GUV) 막 바인딩 HIV-1 개그의 시각화

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

유전자 또는 약물 치료에 사용하기 위해 HIV-1 생산을 표적 RNA를의 효능 및 독성 평가

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.