This work was supported by grants from the European Research Council (ERC-2010-AdG, GT-SKIN), the Italian Ministry of Education, Universities and Research (FIRB-Futuro in Ricerca 2010-RBFR10OS4G, FIRB-Futuro in Ricerca 2012-RBFR126B8I_003, EPIGEN Epigenomics Flagship Project), the Italian Ministry of Health (Young researchers Call 2011 GR-2011-02352026) and the Imagine Institute Foundation (Paris, France).

1. MLV Transduction of Human Cells
<ol>
	<li>Isolate target cells and transduce them with an mLV-derived retroviral vector harboring the eGFP reporter gene and pseudotyped with Vesicular Stomatitis Virus G (VSV-G) or the amphotropic envelope glycoprotein16.
	<ol>
		<li>Keep mock-transduced cells as a negative control for the following analyses. Since mLV-based retroviral vectors can transduce efficiently dividing cells, culture the target cell population in conditions that stimulate cell division. Transduction conditions need to be specifically optimized for each cell type under study. Cell growth and transduction conditions for human hematopoietic progenitors, T cells and epidermal cells are described in References 7, 14, 15, and 17.</li>
	</ol>
	</li>
	<li>48 h after transduction, resuspend 100,000 cells in 300 &#956;L of phosphate-buffered saline (PBS) containing 2% fetal bovine serum and measure eGFP expression by flow cytometric analysis (488-nm excitation laser). Use mock-transduced cells as negative control. For optimal integration site retrieval, purify GFP+ cells by Fluorescence Activated Cell Sorting (FACS).</li>
	<li>Collect 0.5 to 5 million cells for genomic DNA preparation. A longer culture period (&#62;7 days) is preferred to dilute the unintegrated provirus and necessary when analyzing the long-term progeny of bona fide stem cells (see Discussion Section and reference15). The cell pellets can be snap-frozen and stored at -80 &#176;C until use.</li>
</ol>
2. Amplification of mLV integration sites by linker-mediated-PCR (LM-PCR)
<ol>
	<li>Preparation of genomic DNA (gDNA)
	<ol>
		<li>Extract gDNA using a column-based DNA extraction kit and follow the protocol for cultured cells, according to the manufacturer&#39;s instructions.</li>
	</ol>
	</li>
	<li>Restriction enzyme digestion
	<ol>
		<li>Set up 4 restriction enzyme digestions per sample in 1.5 mL tubes. Digest 0.1 to 1 &#956;g gDNA in each tube by adding 1 &#181;L of Tru9I (10U) and 1 &#181;L of Buffer M in a final volume of 10 &#181;L. Incubate the reactions at 65 &#176;C for 6 h or overnight.</li>
		<li>Add to each reaction 1 &#181;L of PstI (10U), 1 &#181;L of Buffer H and 8 &#181;L of water. Incubate the reactions at 37 &#176;C for 6 h or overnight. Samples can be stored at -20 &#176;C until use.</li>
	</ol>
	</li>
	<li>Linker ligation
	<ol>
		<li>Prepare a 100 &#956;M Tru9I linker stock solution in a 1.5 mL tube by mixing the linker plus strand and linker minus strand oligonucleotides at a 100 &#956;M concentration. Put the tube in a water set at 100 &#176;C and let it cool down at room temperature. Tru9I linker stock solution can be stored at -20 &#176;C until use.</li>
		<li>Set up 8 linker ligation reactions in 1.5 mL tubes. For each reaction, add the following components to 10 &#181;L of restriction enzyme digestion: 1.4 &#181;L of 10X T4 DNA Ligase Reaction buffer, 1 &#181;L of 10 &#956;M linker Tru9I, 1 &#181;L (2,000U) of T4 DNA ligase and 0.6 &#181;L of water. Incubate at 16 &#176;C for 3 to 6 h. Samples can be stored at -20 &#176;C until use.</li>
	</ol>
	</li>
	<li>First PCR
	<ol>
		<li>Set up 48 PCR reactions (6 reactions from each ligation tube) in 0.2 mL tubes. For each PCR, add the following reagents to 2 &#181;L of ligation reaction: 5 &#181;L of 10X PCR buffer, 2 &#181;L of 50 mM Magnesium Sulfate, 1 &#181;L of 10 mM deoxynucleotide (dNTP) Mix, 1 &#181;L of 10 &#956;M linker primer, 1 &#181;L of 10 &#956;M mLV-3&#39; LTR primer, 0.3 &#181;L (1.5U) of Taq DNA Polymerase and 37.7 &#181;L of water. Primer sequences are provided in Table 1.</li>
		<li>Perform PCR reaction in a thermal cycler with heated lid, as follows: 95 &#176;C for 2 min; 25 cycles of 95 &#176;C for 15 s, 55 &#176;C for 30 s, 72 &#176;C for 1 min; 72 &#176;C for 5 min; hold at 4 &#176;C. Samples can be stored at -20 &#176;C until use.</li>
	</ol>
	</li>
	<li>Second PCR
	<ol>
		<li>Set up 48 PCR reactions (1 from each &#34;first PCR&#34; tube) in 0.2 mL tubes. For each PCR, add the following components to 2 &#181;L of the first PCR reaction: 5 &#181;L of 10X PCR buffer, 2 &#181;L of 50 mM Magnesium Sulfate, 1 &#181;L of 10 mM dNTP Mix, 1 &#181;L of 10 &#956;M linker nested primer, 1 &#181;L of 10 &#956;M mLV-3&#39; LTR nested primer, 0.3 &#181;L of Taq DNA Polymerase (1.5 U) and 37.7 &#181;L of water. Use nested primers designed for the specific massive sequencing strategy chosen: (i) linker nested primer and mLV-3&#39; LTR nested primer compatible with Illumina platform; (ii) linker nested primer and mLV-3&#39; LTR nested primer compatible with Roche platform. Primer sequences are listed in Table 1.</li>
		<li>Perform PCR reaction in a thermal cycler with heated lid, as follows: 95 &#176;C for 2 min; 25 cycles of 95 &#176;C for 15 s, 58 &#176;C for 30 s, 72 &#176;C for 1 min; 72 &#176;C for 5 min; hold at 4 &#176;C. Samples can be stored at -20 &#176;C until use.</li>
		<li>Pool the 48 nested PCR reactions in a 15 mL tube (final volume of ~2.4 mL). Samples can be stored at -20 &#176;C until use.</li>
	</ol>
	</li>
	<li>Determine the presence and the size of the LM-PCR products by agarose gel electrophoresis.
	<ol>
		<li>Add 4 &#181;L of Loading Buffer to 20 &#181;L of LM-PCR products and load the sample onto a 1% agarose gel, together with a 100 bp DNA ladder. Run the gel at 5 V/cm for 30 to 60 min and visualize the PCR products by ethidium bromide staining.</li>
		<li>Run an LM-PCR reaction from the mock-transduced sample as negative control.</li>
	</ol>
	</li>
	<li>Precipitate the amplicons by adding 0.1 volumes of sodium acetate solution (3 M; pH 5.2) and 2.5 volumes of 100% ethanol. Mix and freeze at -80 &#176;C for 20 min.
	<ol>
		<li>Spin at full speed in a standard microcentrifuge at 4 &#176;C for 20 min. Discard the supernatant and wash the pellet with 70% ethanol. Spin at full speed in a standard microcentrifuge at 4 &#176;C for 5 min.</li>
		<li>Discard the supernatant and air dry the pellet. Add 200 &#181;L of PCR-grade water and resuspend the DNA. Samples can be stored at -20 &#176;C until use.</li>
	</ol>
	</li>
	<li>Add 20 &#956;L of Loading Buffer to 100 &#181;L of the LM-PCR products and load the sample onto a 1% agarose gel, together with a 100 bp DNA ladder.
	<ol>
		<li>Run the gel at 5 V/cm for 30 to 60 min and cut the portion of the gel containing 150 to 500 bp-long amplicons.</li>
		<li>Purify the LM-PCR products with a column-based gel extraction kit and measure the concentration using an UV spectrophotometer.</li>
	</ol>
	</li>
	<li>Use 1 &#181;L of library to evaluate the length of the LM-PCR products using a bioanalyzer instrument, according to manufacturer&#39;s instructions.</li>
	<li>Shotgun cloning of amplicons
	<ol>
		<li>Use 20 ng of the purified LM-PCR products and clone them in the pCR2.1-TOPO vector, according to the manufacturer&#39;s instructions.</li>
		<li>Perform sequencing reactions using the M13 Universal primer, followed by genomic mapping of the resulting sequences, to reveal the presence of the viral-genome junctions (including the mLV-3&#39; LTR nested primer) in &#62;50% of the clones to identify samples suitable for massive sequencing. Example of a viral-genome junction: 
		<img alt="Junction" src="/files/ftp_upload/55919/55919junction.jpg" /> 
		MLV-3&#39; LTR nested primer 454 and linker nested primer 454 (Table 1) are indicated in bold and the 3&#39; end of the viral LTR in italic. The human genomic sequence is highlighted in red text (chr10:6439408-6439509, hg19).</li>
	</ol>
	</li>
</ol>
3. Massive Sequencing of mLV Integration Sites
NOTE: LM-PCR products can be sequenced using commercial platforms (choosing the proper nested primer pair in the second PCR reaction, see subsection 2.5.1). For sequencing by Roche GS-FLX pyrosequencing platform, refer to previous papers7,14,15. In this section, a newly-optimized protocol for Illumina sequencing platform is described.
<ol>
	<li>Library preparation
	<ol>
		<li>Set up 1 indexing PCR reaction per sample in 0.2 mL tubes. For each PCR, add the following reagents to 5 &#181;L (150-170 ng) of purified LM-PCR product: 5 &#181;L of Index Primer 1, 5 &#181;L of Index Primer 2, 25 &#181;L of 2X Master Mix and 10 &#181;L of PCR-grade water. Use a different index combination for each sample.</li>
		<li>Perform PCR reactions in a thermal cycler with heated lid, as follows: 95 &#176;C for 3 min; 8 cycles of 95 &#176;C for 30 s, 55 &#176;C for 30 s, 72 &#176;C for 30 s; 72 &#176;C for 5 min; hold at 4 &#176;C.</li>
		<li>Purify the PCR products using a solid-phase reversible immobilization (SPRI) bead isolation protocol: in new 1.5 mL tubes, add 56 &#181;L of beads to each sample and proceed following manufacturer&#39;s instructions. Elute in 25 &#181;L of Tris-HCl 10 mM. Libraries can be stored at -20 &#176;C until use.</li>
	</ol>
	</li>
	<li>Library check
	<ol>
		<li>Use 1 &#181;L of sample to assess library size using a bioanalyzer instrument.</li>
		<li>Use 1 &#181;L of sample to quantify library molarity using a fluorescence-based Real time PCR assay, according to manufacturer&#39;s instructions.</li>
	</ol>
	</li>
	<li>Library dilution and sequencing
	<ol>
		<li>Dilute libraries to 10 nM using Tris-HCl 10 mM. For pooling libraries, transfer 5 &#181;L of each diluted library to a new 1.5 mL tube and then dilute the pool to 4 nM in Tris-HCl 10 mM.</li>
		<li>Mix 5 &#181;L of diluted pool with 5 &#181;L of 0.2 N NaOH in a new 1.5 mL tube, vortex briefly, spin-down and incubate for 5 min at room temperature to denature the libraries.</li>
		<li>Put tubes on ice and add 990 &#181;L of pre-chilled hybridization buffer (HT1). Aliquot 300 &#181;L of denatured pool in a new 1.5 mL tube and add 300 &#181;L of pre-chilled HT1 to obtain a 10 pM final library pool.</li>
		<li>In parallel, mix 2 &#181;L of PhiX control library (10 nM) with 3 &#181;L of Tris-HCl 10 mM in a 1.5 mL tube. Add 5 &#181;L of NaOH 0.2 N, vortex briefly, spin-down and incubate for 5 min at room temperature to denature the diluted PhiX. Put tube on ice and add 990 &#181;L of pre-chilled HT1.</li>
		<li>Aliquot 300 &#181;L of denatured PhiX in a new 1.5 mL tube and add 300 &#181;L of pre-chilled HT1 to obtain a 10 pM final PhiX.</li>
		<li>In a new 1.5 mL tube, mix 510 &#181;L of denatured library pool with 90 &#181;L of denatured PhiX library, thus obtaining a final 10 pM pool with 15% of PhiX control.</li>
		<li>Pipette these 600 &#181;L of sample volume into the Load Sample reservoir of the thawed sequencing reagent cartridge and proceed immediately to perform a single-read 150-cycle run. 
		NOTE: The critical reagents and primer sequences required for this protocol are listed in Table 1.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Ernst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+and+analysis+of+chromatin+state+dynamics+in+nine+human+cell+types.">Mapping and analysis of chromatin state dynamics in nine human cell types.</a> Nature. 473 (7345), 43-49 (2011).</li><li>Shlyueva, D., Stampfel, G., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+enhancers:+from+properties+to+genome-wide+predictions.">Transcriptional enhancers: from properties to genome-wide predictions.</a> Nat Rev Genet. 15 (4), 272-286 (2014).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).</li><li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-enhancers+in+the+control+of+cell+identity+and+disease.">Super-enhancers in the control of cell identity and disease.</a> Cell. 155 (4), 934-947 (2013).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+identifies+active+regulatory+elements+in+human+multipotent+hematopoietic+progenitors.">High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors.</a> Blood. 116 (25), 5507-5517 (2010).</li><li>Biasco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+profile+of+retroviral+vector+in+gene+therapy+treated+patients+is+cell-specific+according+to+gene+expression+and+chromatin+conformation+of+target+cell.">Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell.</a> EMBO Mol Med. 3 (2), 89-101 (2011).</li><li>De Ravin, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancers+are+major+targets+for+murine+leukemia+virus+vector+integration.">Enhancers are major targets for murine leukemia virus vector integration.</a> J Virol. 88 (8), 4504-4513 (2014).</li><li>LaFave, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mLV+integration+site+selection+is+driven+by+strong+enhancers+and+active+promoters.">mLV integration site selection is driven by strong enhancers and active promoters.</a> Nucleic Acids Res. 42 (7), 4257-4269 (2014).</li><li>Gupta, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bromo-+and+extraterminal+domain+chromatin+regulators+serve+as+cofactors+for+murine+leukemia+virus+integration.">Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration.</a> J Virol. 87 (23), 12721-12736 (2013).</li><li>Sharma, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BET+proteins+promote+efficient+murine+leukemia+virus+integration+at+transcription+start+sites.">BET proteins promote efficient murine leukemia virus integration at transcription start sites.</a> Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).</li><li>De Rijck, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BET+family+of+proteins+targets+moloney+murine+leukemia+virus+integration+near+transcription+start+sites.">The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites.</a> Cell reports. 5 (4), 886-894 (2013).</li><li>Romano, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional,+epigenetic+and+retroviral+signatures+identify+regulatory+regions+involved+in+hematopoietic+lineage+commitment.">Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment.</a> Sci Rep. 6, 24724 (2016).</li><li>Cavazza, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+Transcriptional+and+Epigenetic+Regulation+of+Human+Epidermal+Keratinocyte+Differentiation.">Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.</a> Stem Cell Reports. 6 (4), 618-632 (2016).</li><li>Miller, A. D., Law, M. F., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+helper-free+amphotropic+retroviruses+that+transduce+a+dominant-acting,+methotrexate-resistant+dihydrofolate+reductase+gene.">Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene.</a> Mol Cell Biol. 5 (3), 431-437 (1985).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+defines+the+fate+of+allogeneic+T+cells+after+donor+lymphocyte+infusion.">High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion.</a> PLoS One. 5 (12), e15688 (2010).</li><li>Aiuti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+in+patients+with+Wiskott-Aldrich+syndrome.">Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome.</a> Science. 341 (6148), 1233151 (2013).</li><li>Biffi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+benefits+metachromatic+leukodystrophy.">Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy.</a> Science. 341 (6148), 1233158 (2013).</li><li>Gabriel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+genomic+access+to+vector+integration+in+clinical+gene+therapy.">Comprehensive genomic access to vector integration in clinical gene therapy.</a> Nat Med. 15 (12), 1431-1436 (2009).</li><li>Gillet, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+genomic+environment+of+the+provirus+determines+the+abundance+of+HTLV-1-infected+T-cell+clones.">The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones.</a> Blood. 117 (11), 3113-3122 (2011).</li></ol>

The authors have nothing to disclose.

Here, we described a protocol for genome-wide mapping of the integration sites of mLV, a retrovirus that targets chromatin regions, epigenetically marked as active promoters and enhancers. Critical steps and/or limitations of the protocol include: (i) mLV transduction of the target cell population; (ii) amplification of virus-host junctions by LM-PCR; (iii) retrieval of a high fraction of integration sites. mLV-based retroviral vectors efficiently transduce dividing cells. The low efficiency of transduction of non-dividi...

Cell identity is determined by the expression of specific sets of genes. The role of cis-regulatory elements, such as promoters and enhancers, is crucial for the activation of cell-type specific transcriptional programs. These regulatory regions are characterized by specific chromatin features, such as peculiar histone modifications, transcription factors and co-factors binding, and chromatin accessibility, which have been widely used for their genome-wide identification in several cell types1,2,3. In particular, the genome-wide profile of acetylation of histone H3 lysine 27 (H3K27ac) is commonly used to define active promoters, enhancers and super-enhancers4,5,6.
Moloney murine leukemia virus (MLV) is a gamma-retrovirus that is widely used for gene transfer in mammalian cells. After infecting a target cell, the retroviral RNA genome is retro-transcribed in a double-stranded DNA molecule that binds viral and cellular proteins to assemble the pre-integration complex (PIC). The PIC enters the nucleus and binds the host cell chromatin. Here, the viral integrase, a key PIC component, mediates the integration of the proviral DNA into the host cell genome. mLV integration in the genomic DNA is not random, but occurs in active cis-regulatory elements, such as promoters and enhancers, in a cell-specific fashion7,8,9,10. This peculiar integration profile is mediated by a direct interaction between the mLV integrase and the cellular bromodomain and extraterminal domain (BET) proteins11,12,13. BET proteins (BRD2, BRD3, and BRD4) act as a bridge between host chromatin and mLV PIC: through their bromodomains they recognize highly acetylated cis-regulatory regions, while the extraterminal domain interacts with the mLV integrase11,12,13.
Here, we describe the retroviral scanning, a novel tool to map active cis-regulatory regions based on the integration properties of mLV. Briefly, cells are transduced with mLV-derived retroviral vector expressing the enhanced green fluorescent protein (eGFP) reporter gene. After genomic DNA extraction, the junctions between the 3&#39; long terminal repeat (LTR) of the mLV vector and the genomic DNA are amplified by linker-mediated PCR (LM-PCR) and massively sequenced. mLV integration sites are mapped to the human genome and genomic regions highly targeted by mLV are defined as clusters of mLV integration sites.
Retroviral scanning was used to define cell-specific active regulatory elements in several human primary cells14,15. mLV clusters co-mapped with epigenetically defined promoters and enhancers, most of which harbored active histone marks, such as H3K27ac, and were cell-specific. Retroviral scanning allows the genome-wide identification of DNA regulatory elements in prospectively purified cell populations7,14, as well as in retrospectively defined cell populations, such as keratinocyte stem cells, that lack effective markers for prospective isolation15.

<table><tbody><tr><td>PBS, pH 7.4</td><td>ThermoScientific</td><td>10010031</td><td>or equivalent</td></tr><tr><td>Fetal Bovine Serum</td><td>ThermoScientific</td><td>16000044</td><td>or equivalent</td></tr><tr><td>0.2 ml tubes</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>1.5 ml tubes</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>QIAGEN QIAmp DNA mini Kit&amp;nbsp;</td><td>QIAGEN</td><td>51306</td><td>or equivalent</td></tr><tr><td>T4 DNA ligase&amp;nbsp;</td><td>New England BioLabs</td><td>M0202T</td><td></td></tr><tr><td>T4 DNA Ligase Reaction buffer</td><td>New England BioLabs</td><td>M0202T</td><td></td></tr><tr><td>Linker Plus Strand oligonucleotide</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-PO&lt;sub&gt;4&lt;/sub&gt;-TAGTCCCTTAAGCGGAG-3&amp;rsquo;&amp;nbsp; (Purification grade: SDS-PAGE)</td></tr><tr><td>Linker Minus Strand oligonucleotide</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3&amp;rsquo; (Purification grade: SDS-PAGE)</td></tr><tr><td>Tru9I</td><td>Roche-Sigma-Aldrich</td><td>11464825001</td><td></td></tr><tr><td>SuRE/Cut Buffer M</td><td>Roche-Sigma-Aldrich</td><td>11417983001</td><td></td></tr><tr><td>PstI&amp;nbsp;</td><td>Roche-Sigma-Aldrich</td><td>10798991001</td><td></td></tr><tr><td>SuRE/Cut Buffer H</td><td>Roche-Sigma-Aldrich</td><td>11417991001</td><td></td></tr><tr><td>Platinum Taq DNA Polimerase High Fidelity&amp;nbsp;</td><td>Invitrogen</td><td>11304011</td><td></td></tr><tr><td>10 mM dNTP Mix</td><td>Invitrogen</td><td>18427013</td><td>or equivalent</td></tr><tr><td>PCR grade water</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>96-well thermal cycler (with heated lid)</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>linker primer</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-GTAATACGACTCACTATAGGGC-3&amp;rsquo; (Purification grade: PCR grade)</td></tr><tr><td>MLV-3&amp;rsquo; LTR primer</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-GACTTGTGGTCTCGCTGTTCCTTGG-3&amp;rsquo; (Purification grade: PCR grade)</td></tr><tr><td>linker nested primer 454</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td></tr><tr><td>MLV-3&amp;rsquo; LTR nested primer 454</td><td>general lab supplier</td><td></td><td>5&amp;rsquo;-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td></tr><tr><td>linker nested primer Illumina</td><td>general lab supplier</td><td></td><td>5&#039;-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td></tr><tr><td>MLV-3&amp;rsquo; LTR nested primer Illumina</td><td>general lab supplier</td><td></td><td>5&#039;-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td></tr><tr><td>Sodium Acetate Solution (3M) pH 5.2</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>Ethanol (absolute) for molecular biology</td><td>Sigma-Aldrich</td><td>E7023</td><td>or equivalent</td></tr><tr><td>Topo TA Cloning kit (with pCR2.1-TOPO vector)</td><td>Invitrogen</td><td>K4500-01</td><td></td></tr><tr><td>QIAquick Gel Extraction kit</td><td>QIAGEN</td><td>28704</td><td></td></tr><tr><td>Agarose</td><td>Sigma-Aldrich</td><td>A9539</td><td>or equivalent</td></tr><tr><td>Ethidium bromide&amp;nbsp;</td><td>Sigma-Aldrich</td><td>E1510</td><td>or equivalent</td></tr><tr><td>100 bp DNA ladder</td><td>Invitrogen</td><td>15628019</td><td>or equivalent</td></tr><tr><td>6x Loading Buffer</td><td>ThermoScientific</td><td>R0611</td><td>or equivalent</td></tr><tr><td>NanoDrop 2000 UV-Vis Spectrophotometer</td><td>ThermoScientific</td><td>ND-2000</td><td></td></tr><tr><td>Nextera XT Index kit</td><td>Illumina</td><td>FC-131-1001 or FC-131-1002</td><td></td></tr><tr><td>2x KAPA HiFi Hot Start Ready Mix&amp;nbsp;</td><td>KAPA Biosystems</td><td>KK2601</td><td></td></tr><tr><td>Dynal magnetic stand for 2 ml tubes</td><td>Invitrogen</td><td>12321D</td><td>or equivalent</td></tr><tr><td>Agencourt AMPure XP 60 ml kit</td><td>Beckman Coulter Genomics</td><td>A63881</td><td></td></tr><tr><td>Tris-HCl 10 mM, pH 8.5</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>Agilent 2200 TapeStation system</td><td>Agilent Technologies</td><td>G2964AA</td><td>or equivalent</td></tr><tr><td>D1000 ScreenTape</td><td>Agilent Technologies</td><td>5067-5582</td><td>or equivalent</td></tr><tr><td>D1000 Reagents</td><td>Agilent Technologies</td><td>5067-5583</td><td>or equivalent</td></tr><tr><td>KAPA Library Quantification Kit for Illumina platforms (ABI Prism)</td><td>KAPA Biosystems</td><td>KK4835</td><td></td></tr><tr><td>ABI Prism 7900HT Fast Real-Time PCR System</td><td>Applied Biosystems</td><td>4329003</td><td></td></tr><tr><td>NaOH 1.0 N, molecular biology-grade</td><td>general lab supplier</td><td></td><td></td></tr><tr><td>HT1 (Hybridization Buffer)</td><td>Illumina&amp;nbsp;</td><td>Provided in the MiSeq Reagent Kit</td><td></td></tr><tr><td>MiSeq Reagent Kit v3 (150 cycles)</td><td>Illumina</td><td>MS-102-3001</td><td></td></tr><tr><td>MiSeq System</td><td>Illumina</td><td>SY-410-1003</td><td></td></tr><tr><td>PhiX Control v3</td><td>Illumina</td><td>FC-110-3001</td><td></td></tr></tbody></table>

retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs.
The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.

Workflow of the retroviral scanning procedure
The workflow of retroviral scanning procedure is schematized in Figure 1. The target cell population is purified and transduced with a mLV-derived retroviral vector expressing an eGFP reporter gene. The transgene is flanked by the two identical long terminal repeats (5&#39; and 3&#39; LTR), ensuring synthesis, reverse transcription and integration of the vi...

Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

retroviral-scanning-mapping-mlv-integration-sites-to-define-cell

Research

JoVE Journal

Genetics

8.4K Views.  University of Modena and Reggio Emilia.  Hier beschrijven we een protocol voor de genoom-brede mapping van de integratie-sites van Moloney-muizen-leukemie-virus-gebaseerde retrovirale vectoren in menselijke cellen. 

Video: Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

This manuscript describes the experimental procedure and software analysis for a bidirectional integration site assay that can simultaneously analyze upstream and downstream vector-host junction DNA. Bidirectional PCR products can be used for any downstream sequencing platform. The resulting data are useful for a high-throughput, quantitative comparison of integrated DNA targets.

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near full-length (intact and defective), HIV-1 proviruses. FLIPS allows determination of the genetic composition of integrated HIV-1 within a cell population. Through identifying defects within HIV-1 proviral sequences that arise during reverse transcription, such as large internal deletions, deleterious stop codons/hypermutation, frameshift mutations, and mutations/deletions in cis acting elements required for virion maturation, FLIPS can identify integrated proviruses incapable of replication. The FLIPS assay can be utilized to identify HIV-1 proviruses that lack these defects and are&#160;therefore potentially replication-competent. The FLIPS protocol involves: lysis of HIV-1 infected cells, nested PCR of near full-length HIV-1 proviruses (using primers targeted to the HIV-1 5&#39; and 3&#39; LTR), DNA purification and quantification, library preparation for Next-generation Sequencing (NGS), NGS, de novo assembly of proviral contigs, and a simple process of elimination for identifying replication-competent proviruses. FLIPS provides advantages over traditional methods designed to sequence integrated HIV-1 proviruses, such as single-proviral sequencing. FLIPS amplifies and sequences near full-length proviruses enabling replication competency to be determined, and also uses fewer amplification primers, preventing the consequences of primer mismatches. FLIPS is a useful tool for understanding the genetic landscape of integrated HIV-1 proviruses, especially within the latent reservoir, however, its utilization can extend to any application in which the genetic composition of integrated HIV-1 is required.

Full-length individual proviral sequencing (FLIPS) provides an efficient and high-throughput method for the amplification and sequencing of single, near full-length (intact and defective) HIV-1 proviruses and allows for determination of their potential replication-competency. FLIPS overcomes limitations of previous assays designed to sequence the latent HIV-1 reservoir.

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

Microarray-based Identification of Individual HERV Loci Expression: Application to Biomarker Discovery in Prostate Cancer

The prostate-specific antigen (PSA) is the main diagnostic biomarker for prostate cancer in clinical use, but it lacks specificity and sensitivity, particularly in low dosage values1&#8203;&#8203;. &#8216;How to use PSA&#39; remains a current issue, either for diagnosis as a gray zone corresponding to a concentration in serum of 2.5-10 ng/ml which does not allow a clear differentiation to be made between cancer and noncancer2 or for patient follow-up as analysis of post-operative PSA kinetic parameters can pose considerable challenges for their practical application3,4. Alternatively, noncoding RNAs (ncRNAs) are emerging as key molecules in human cancer, with the potential to serve as novel markers of disease, e.g. PCA3 in prostate cancer5,6 and to reveal uncharacterized aspects of tumor biology. Moreover, data from the ENCODE project published in 2012 showed that different RNA types cover about 62% of the genome. It also appears that the amount of transcriptional regulatory motifs is at least 4.5x higher than the one corresponding to protein-coding exons. Thus, long terminal repeats (LTRs) of human endogenous retroviruses (HERVs) constitute a wide range of putative/candidate transcriptional regulatory sequences, as it is their primary function in infectious retroviruses. HERVs, which are spread throughout the human genome, originate from ancestral and independent infections within the germ line, followed by copy-paste propagation processes and leading to multicopy families occupying 8% of the human genome (note that exons span 2% of our genome). Some HERV loci still express proteins that have been associated with several pathologies including cancer7-10. We have designed a high-density microarray, in Affymetrix format, aiming to optimally characterize individual HERV loci expression, in order to better understand whether they can be active, if they drive ncRNA transcription or modulate coding gene expression. This tool has been applied in the prostate cancer field (Figure 1).

Human endogenous retroviruses (HERV), which occupy 8% of the human genome, retain scarce coding capacities but a hundred thousand long terminal repeats (LTRs). A custom Affymetrix microarray was designed to identify individual HERV locus expression and was used on prostate cancer tissues as a proof of concept for future clinical studies.

The prostate-specific antigen (PSA) is the main diagnostic biomarker for prostate cancer in clinical use, but it lacks specificity and sensitivity, ...

Medicine

InSET: A Novel Tool for Unbiased Genome-Wide Functional Element Discovery

Identification of Functionally-Relevant Lentivirus Integration Sites in an Insertional Mutagenesis Cell Library

The extent of functional sequences within the human genome is a pivotal yet debated topic in biology. Although high-throughput reverse genetic screens have made strides in exploring this, they often limit their scope to known genomic elements and may introduce non-specific effects. This underscores the urgent need for novel functional genomics tools that enable a deeper, unbiased understanding of genome functionality. This protocol introduces the Insertion-based Screen for functional Elements and Transcripts (InSET), a method for identifying lentivirus integration sites within a lentivirus-based insertional mutagenesis cell library. InSET facilitates the capture of genome-wide lentiviral integration sites, with next-generation sequencing used to detect and quantify flanking sequences. InSET's design enables the analysis of integration site abundance variations in phenotypic screens on a large scale, establishing it as a robust tool for forward genetics and for identifying functional genomic elements. A key benefit of InSET is its capacity to reveal previously unidentified genomic elements, including novel functional exons of both protein-coding and non-coding RNAs, independent of prior annotation. Overall, InSET holds significant value in studying the intricate complexity of the human genome and transcriptome, where many genomic elements await functional characterization.

Insertional mutagenesis is an essential tool in forward genetics for identifying functional genomic elements. Here, we describe the Insertion-based Screen for functional Elements and Transcripts (InSET), a method for detecting lentivirus integration sites within a lentivirus-based insertional mutagenesis cell library.

The extent of functional sequences within the human genome is a pivotal yet debated topic in biology. Although high-throughput reverse genetic screens ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. However, these screens are typically conducted in cells that are naturally permissive to the viral pathogen under study. Therefore, the robust replication of viruses in control conditions may limit the dynamic range of these screens. Furthermore, these screens may be unable to easily identify cellular defense pathways that restrict virus replication if the virus is well-adapted to the host and capable of countering antiviral defenses. In this article, we describe a new paradigm for exploring virus-host interactions through the use of screens that center on naturally abortive infections by arboviruses such as vesicular stomatitis virus (VSV). Despite the ability of VSV to replicate in a wide range of dipteran insect and mammalian hosts, VSV undergoes a post-entry, abortive infection in a variety of cell lines derived from lepidopteran insects, such as the gypsy moth (Lymantria dispar). However, these abortive VSV infections can be &#34;rescued&#34; when host cell antiviral defenses are compromised. We describe how VSV strains encoding convenient reporter genes and restrictive L. dispar cell lines can be paired to set-up screens to identify host factors involved in arbovirus restriction. Furthermore, we also show the utility of these screening tools in the identification of virally encoded factors that rescue VSV replication during coinfection or through ectopic expression, including those encoded by mammalian viruses. The natural restriction of VSV replication in L. dispar cells provides a high signal-to-noise ratio when screening for the conditions that promote VSV rescue, thus enabling the use of simplistic luminescence- and fluorescence-based assays to monitor the changes in VSV replication. These methodologies are valuable for understanding the interplay between host antiviral responses and viral immune evasion factors.

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

Immunology and Infection

CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites

Human immunodeficiency virus (HIV) integrates its proviral DNA non-randomly into the host cell genome at recurrent sites and genomic hotspots. Here we present a detailed protocol for the generation of novel in vitro models for HIV infection with chosen genomic integration sites using CRISPR-Cas9-based genome engineering technology. With this method, a reporter sequence of choice can be integrated into a targeted, chosen genomic locus, reflecting clinically relevant integration sites.
In the protocol, the design of an HIV-derived reporter and choosing of a target site and gRNA sequence are described. A targeting vector with homology arms is constructed and transfected into Jurkat T cells. The reporter sequence is targeted to the selected genomic site by homologous recombination facilitated by a Cas9-mediated double-strand break at the target site. Single-cell clones are generated and screened for targeting events by flow cytometry and PCR. Selected clones are then expanded, and correct targeting is verified by PCR, sequencing, and Southern blotting. Potential off-target events of CRISPR-Cas9-mediated genome engineering are analyzed.
By using this protocol, novel cell culture systems that model HIV infection at clinically relevant integration sites can be generated. Although the generation of single-cell clones and verification of correct reporter sequence integration is time-consuming, the resulting clonal lines are powerful tools to functionally analyze proviral integration site choice.

We present a genome engineering workflow for the generation of new in vitro models for HIV-1 infection that recapitulate proviral integration at selected genomic sites. Targeting of HIV-derived reporters is facilitated by CRISPR-Cas9-mediated, site-specific genome manipulation. Detailed protocols for single-cell clone generation, screening, and correct targeting verification are provided.

Human immunodeficiency virus (HIV) integrates its proviral DNA non-randomly into the host cell genome at recurrent sites and genomic hotspots. Here we ...

High Throughput In Vitro Assessment of Latency Reversing Agents on HIV Transcription and Splicing

HIV remains incurable due to the existence of a reservoir of cells that harbors stable and latent form of the virus, which stays invisible to the immune system and is not targeted by the current antiretroviral therapy (cART). Transcription and splicing have been shown to reinforce HIV-1 latency in resting CD4+ T cells. Reversal of latency by the use of latency reversal agents (LRAs) in the &#34;shock and kill&#34; approach has been studied extensively in an attempt to purge this reservoir but has thus far not shown any success in clinical trials due to the lack of development of adequate small molecules that can efficiently perturb this reservoir. The protocol presented here provides a method for reliably and efficiently assessing latency reversal agents (LRAs) on HIV transcription and splicing. This approach is based on the use of an LTR-driven dual color reporter that can simultaneously measure the effect of an LRA on transcription and splicing by flow cytometry. The protocol described here is adequate for adherent cells as well as the cells in suspension. It is useful for testing a large number of drugs in a high throughput system. The method is technically simple to implement and cost-effective. In addition, the use of flow cytometry allows the assessment of cell viability and thus drug toxicity at the same time.

A high throughput protocol for functional assessment of HIV efficient reactivation and clearance of latent proviruses is described and applied by testing the impact of interventions on HIV transcription and splicing. Representative results of the effect of latency reversing agents on LTR-driven transcription and splicing are provided.

HIV remains incurable due to the existence of a reservoir of cells that harbors stable and latent form of the virus, which stays invisible to the immune ...

Identification of Nucleolar Factors During HIV-1 Replication Through Rev Immunoprecipitation and Mass Spectrometry

The HIV-1 infectious cycle requires viral protein interactions with host factors to facilitate viral replication, packaging, and release. The infectious cycle further requires the formation of viral/host protein complexes with HIV-1 RNA to regulate the splicing and enable nucleocytoplasmic transport. The HIV-1 Rev protein accomplishes the nuclear export of HIV-1 mRNAs through multimerization with intronic cis-acting targets - the Rev response element (RRE). A nucleolar localization signal (NoLS) exists within the COOH-terminus of the Rev arginine-rich motif (ARM), allowing the accumulation of Rev/RRE complexes in the nucleolus. Nucleolar factors are speculated to support the HIV-1 infectious cycle through various other functions in addition to mediating mRNA-independent nuclear export and splicing. We describe an immunoprecipitation method of wild-type (WT) Rev in comparison to Rev nucleolar mutations (deletion and single-point Rev-NoLS mutations) in the presence of HIV-1 replication for mass spectrometry. Nucleolar factors implicated in the nucleocytoplasmic transport (nucleophosmin B23 and nucleolin C23), as well as cellular splicing factors, lose interaction with Rev in the presence of Rev-NoLS mutations. Various other nucleolar factors, such as snoRNA C/D box 58, are identified to lose interaction with Rev mutations, yet their function in the HIV-1 replication cycle remain unknown. The results presented here demonstrate the use of this approach for the identification of viral/host nucleolar factors that maintain the HIV-1 infectious cycle. The concepts used in this approach are applicable to other viral and disease models requiring the characterization of understudied pathways.

Here we describe Rev immunoprecipitation in the presence of HIV-1 replication for mass spectrometry. The methods described can be used for the identification of nucleolar factors involved in the HIV-1 infectious cycle and are applicable to other disease models for the characterization of understudied pathways.

The HIV-1 infectious cycle requires viral protein interactions with host factors to facilitate viral replication, packaging, and release. The infectious ...

Linear Amplification Mediated PCR &#8211; Localization of Genetic Elements and Characterization of Unknown Flanking DNA

Linear-amplification mediated PCR (LAM-PCR) has been developed to study hematopoiesis in gene corrected cells of patients treated by gene therapy with integrating vector systems. Due to the stable integration of retroviral vectors, integration sites can be used to study the clonal fate of individual cells and their progeny. LAM- PCR for the first time provided evidence that leukemia in gene therapy treated patients originated from provirus induced overexpression of a neighboring proto-oncogene. The high sensitivity and specificity of LAM-PCR compared to existing methods like inverse PCR and ligation mediated (LM)-PCR is achieved by an initial preamplification step (linear PCR of 100 cycles) using biotinylated vector specific primers which allow subsequent reaction steps to be carried out on solid phase (magnetic beads). LAM-PCR is currently the most sensitive method available to identify&#160;unknown DNA which is located in the proximity of known DNA. Recently, a variant of LAM-PCR has been developed that circumvents restriction digest thus abrogating retrieval bias of integration sites and enables a comprehensive analysis of provirus locations in host genomes. The following protocol explains step-by-step the amplification of both 3&#8217;- and 5&#8217;- sequences adjacent to the integrated lentiviral vector.

Linear-amplification mediated (LAM)-PCR is a method developed to identify the exact positions of integrating viral vectors in the genome. The technique has evolved to be the superior method to study clonal dynamics in gene therapy patients, biosafety of novel vector technologies, T-cell diversity, cancer stem cell models, etc.

Linear-amplification mediated PCR (LAM-PCR) has been developed to study hematopoiesis in gene corrected cells of patients treated by gene therapy with ...

Biology

Deciphering Early Follicular Helper T-Cell Commitment in Acute LCMV Infection

Accessing Early Differentiation of Virus-Specific Follicular Helper CD4+ T Cell in Acute LCMV-Infected Mice

Follicular Helper T (TFH) cells are perceived as an independent CD4+ T cell lineage that assists cognate B cells in producing high-affinity antibodies, thus establishing long-term humoral immunity. During acute viral infection, the fate commitment of virus-specific TFH cells is determined in the early infection phase, and investigations of the early-differentiated TFH cells are crucial in understanding T cell-dependent humoral immunity and optimizing vaccine design. In the study, using a mouse model of acute lymphocytic choriomeningitis virus (LCMV) infection and the TCR-transgenic SMARTA (SM) mouse with CD4+ T cells specifically recognizing LCMV glycoprotein epitope I-AbGP66-77, we described procedures to access the early fate commitment of virus-specific TFH cells based on flow cytometry stainings. Furthermore, by exploiting retroviral transduction of SM CD4+ T cells, methods to manipulate gene expression in early-differentiated virus-specific TFH cells are also provided. Hence, these methods will help in studies exploring the mechanism(s) underlying the early commitment of virus-specific TFH cells.

Author Spotlight: Elucidating the Pathways of TFH Cell Differentiation in Acute LCMV Challenges

The current study showcases protocols for assessing the early fate commitment of virus-specific TFH cells and manipulating gene expression in these cells.

Follicular Helper T (TFH) cells are perceived as an independent CD4+ T cell lineage that assists cognate B cells in producing high-affinity antibodies, ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Samenvatting

Meer video's verkennen