This work was supported by grants from the European Research Council (ERC-2010-AdG, GT-SKIN), the Italian Ministry of Education, Universities and Research (FIRB-Futuro in Ricerca 2010-RBFR10OS4G, FIRB-Futuro in Ricerca 2012-RBFR126B8I_003, EPIGEN Epigenomics Flagship Project), the Italian Ministry of Health (Young researchers Call 2011 GR-2011-02352026) and the Imagine Institute Foundation (Paris, France).

1. MLV Transduction of Human Cells
<ol>
	<li>Isolate target cells and transduce them with an mLV-derived retroviral vector harboring the eGFP reporter gene and pseudotyped with Vesicular Stomatitis Virus G (VSV-G) or the amphotropic envelope glycoprotein16.
	<ol>
		<li>Keep mock-transduced cells as a negative control for the following analyses. Since mLV-based retroviral vectors can transduce efficiently dividing cells, culture the target cell population in conditions that stimu...

<ol>
	<li>Ernst, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+and+analysis+of+chromatin+state+dynamics+in+nine+human+cell+types.">Mapping and analysis of chromatin state dynamics in nine human cell types.</a> Nature. 473 (7345), 43-49 (2011).</li><li>Shlyueva, D., Stampfel, G., Stark, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+enhancers:+from+properties+to+genome-wide+predictions.">Transcriptional enhancers: from properties to genome-wide predictions.</a> Nat Rev Genet. 15 (4), 272-286 (2014).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Natl Acad Sci U S A. 107 (50), 21931-21936 (2010).</li><li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-enhancers+in+the+control+of+cell+identity+and+disease.">Super-enhancers in the control of cell identity and disease.</a> Cell. 155 (4), 934-947 (2013).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+identifies+active+regulatory+elements+in+human+multipotent+hematopoietic+progenitors.">High-definition mapping of retroviral integration sites identifies active regulatory elements in human multipotent hematopoietic progenitors.</a> Blood. 116 (25), 5507-5517 (2010).</li><li>Biasco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+profile+of+retroviral+vector+in+gene+therapy+treated+patients+is+cell-specific+according+to+gene+expression+and+chromatin+conformation+of+target+cell.">Integration profile of retroviral vector in gene therapy treated patients is cell-specific according to gene expression and chromatin conformation of target cell.</a> EMBO Mol Med. 3 (2), 89-101 (2011).</li><li>De Ravin, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancers+are+major+targets+for+murine+leukemia+virus+vector+integration.">Enhancers are major targets for murine leukemia virus vector integration.</a> J Virol. 88 (8), 4504-4513 (2014).</li><li>LaFave, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mLV+integration+site+selection+is+driven+by+strong+enhancers+and+active+promoters.">mLV integration site selection is driven by strong enhancers and active promoters.</a> Nucleic Acids Res. 42 (7), 4257-4269 (2014).</li><li>Gupta, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bromo-+and+extraterminal+domain+chromatin+regulators+serve+as+cofactors+for+murine+leukemia+virus+integration.">Bromo- and extraterminal domain chromatin regulators serve as cofactors for murine leukemia virus integration.</a> J Virol. 87 (23), 12721-12736 (2013).</li><li>Sharma, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BET+proteins+promote+efficient+murine+leukemia+virus+integration+at+transcription+start+sites.">BET proteins promote efficient murine leukemia virus integration at transcription start sites.</a> Proc Natl Acad Sci U S A. 110 (29), 12036-12041 (2013).</li><li>De Rijck, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BET+family+of+proteins+targets+moloney+murine+leukemia+virus+integration+near+transcription+start+sites.">The BET family of proteins targets moloney murine leukemia virus integration near transcription start sites.</a> Cell reports. 5 (4), 886-894 (2013).</li><li>Romano, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional,+epigenetic+and+retroviral+signatures+identify+regulatory+regions+involved+in+hematopoietic+lineage+commitment.">Transcriptional, epigenetic and retroviral signatures identify regulatory regions involved in hematopoietic lineage commitment.</a> Sci Rep. 6, 24724 (2016).</li><li>Cavazza, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+Transcriptional+and+Epigenetic+Regulation+of+Human+Epidermal+Keratinocyte+Differentiation.">Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.</a> Stem Cell Reports. 6 (4), 618-632 (2016).</li><li>Miller, A. D., Law, M. F., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+helper-free+amphotropic+retroviruses+that+transduce+a+dominant-acting,+methotrexate-resistant+dihydrofolate+reductase+gene.">Generation of helper-free amphotropic retroviruses that transduce a dominant-acting, methotrexate-resistant dihydrofolate reductase gene.</a> Mol Cell Biol. 5 (3), 431-437 (1985).</li><li>Cattoglio, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-definition+mapping+of+retroviral+integration+sites+defines+the+fate+of+allogeneic+T+cells+after+donor+lymphocyte+infusion.">High-definition mapping of retroviral integration sites defines the fate of allogeneic T cells after donor lymphocyte infusion.</a> PLoS One. 5 (12), e15688 (2010).</li><li>Aiuti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+in+patients+with+Wiskott-Aldrich+syndrome.">Lentiviral hematopoietic stem cell gene therapy in patients with Wiskott-Aldrich syndrome.</a> Science. 341 (6148), 1233151 (2013).</li><li>Biffi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+hematopoietic+stem+cell+gene+therapy+benefits+metachromatic+leukodystrophy.">Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy.</a> Science. 341 (6148), 1233158 (2013).</li><li>Gabriel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+genomic+access+to+vector+integration+in+clinical+gene+therapy.">Comprehensive genomic access to vector integration in clinical gene therapy.</a> Nat Med. 15 (12), 1431-1436 (2009).</li><li>Gillet, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+genomic+environment+of+the+provirus+determines+the+abundance+of+HTLV-1-infected+T-cell+clones.">The host genomic environment of the provirus determines the abundance of HTLV-1-infected T-cell clones.</a> Blood. 117 (11), 3113-3122 (2011).</li></ol>

The authors have nothing to disclose.

Here, we described a protocol for genome-wide mapping of the integration sites of mLV, a retrovirus that targets chromatin regions, epigenetically marked as active promoters and enhancers. Critical steps and/or limitations of the protocol include: (i) mLV transduction of the target cell population; (ii) amplification of virus-host junctions by LM-PCR; (iii) retrieval of a high fraction of integration sites. mLV-based retroviral vectors efficiently transduce dividing cells. The low efficiency of transduction of non-dividi...

Cell identity is determined by the expression of specific sets of genes. The role of cis-regulatory elements, such as promoters and enhancers, is crucial for the activation of cell-type specific transcriptional programs. These regulatory regions are characterized by specific chromatin features, such as peculiar histone modifications, transcription factors and co-factors binding, and chromatin accessibility, which have been widely used for their genome-wide identification in several cell types1,2,3. In particular, the genome-wide profile of acetylation of histone H3 lysine 27 (H3K27ac) is commonly used to define active promoters, enhancers and super-enhancers4,5,6.
Moloney murine leukemia virus (MLV) is a gamma-retrovirus that is widely used for gene transfer in mammalian cells. After infecting a target cell, the retroviral RNA genome is retro-transcribed in a double-stranded DNA molecule that binds viral and cellular proteins to assemble the pre-integration complex (PIC). The PIC enters the nucleus and binds the host cell chromatin. Here, the viral integrase, a key PIC component, mediates the integration of the proviral DNA into the host cell genome. mLV integration in the genomic DNA is not random, but occurs in active cis-regulatory elements, such as promoters and enhancers, in a cell-specific fashion7,8,9,10. This peculiar integration profile is mediated by a direct interaction between the mLV integrase and the cellular bromodomain and extraterminal domain (BET) proteins11,12,13. BET proteins (BRD2, BRD3, and BRD4) act as a bridge between host chromatin and mLV PIC: through their bromodomains they recognize highly acetylated cis-regulatory regions, while the extraterminal domain interacts with the mLV integrase11,12,13.
Here, we describe the retroviral scanning, a novel tool to map active cis-regulatory regions based on the integration properties of mLV. Briefly, cells are transduced with mLV-derived retroviral vector expressing the enhanced green fluorescent protein (eGFP) reporter gene. After genomic DNA extraction, the junctions between the 3&#39; long terminal repeat (LTR) of the mLV vector and the genomic DNA are amplified by linker-mediated PCR (LM-PCR) and massively sequenced. mLV integration sites are mapped to the human genome and genomic regions highly targeted by mLV are defined as clusters of mLV integration sites.
Retroviral scanning was used to define cell-specific active regulatory elements in several human primary cells14,15. mLV clusters co-mapped with epigenetically defined promoters and enhancers, most of which harbored active histone marks, such as H3K27ac, and were cell-specific. Retroviral scanning allows the genome-wide identification of DNA regulatory elements in prospectively purified cell populations7,14, as well as in retrospectively defined cell populations, such as keratinocyte stem cells, that lack effective markers for prospective isolation15.

<table>
	<tbody>
		<tr>
			<td>PBS, pH 7.4</td>
			<td>ThermoScientific</td>
			<td>10010031</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>ThermoScientific</td>
			<td>16000044</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>0.2 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 ml tubes</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QIAGEN QIAmp DNA mini Kit&#160;</td>
			<td>QIAGEN</td>
			<td>51306</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>T4 DNA ligase&#160;</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA Ligase Reaction buffer</td>
			<td>New England BioLabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr>
			<td>Linker Plus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-PO4-TAGTCCCTTAAGCGGAG-3&#8217;&#160; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Linker Minus Strand oligonucleotide</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC-3&#8217; (Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Tru9I</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11464825001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer M</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417983001</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI&#160;</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>10798991001</td>
			<td></td>
		</tr>
		<tr>
			<td>SuRE/Cut Buffer H</td>
			<td>Roche-Sigma-Aldrich</td>
			<td>11417991001</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA Polimerase High Fidelity&#160;</td>
			<td>Invitrogen</td>
			<td>11304011</td>
			<td></td>
		</tr>
		<tr>
			<td>10mM dNTP Mix</td>
			<td>Invitrogen</td>
			<td>18427013</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well thermal cycler (with heated lid)</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>linker primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GTAATACGACTCACTATAGGGC-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR primer</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GACTTGTGGTCTCGCTGTTCCTTGG-3&#8217; (Purification grade: PCR grade)</td>
		</tr>
		<tr>
			<td>linker nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTTGCCAGCCCGCTCAG[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer 454</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#8217;-GCCTCCCTCGCGCCATCAGTAGC[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>linker nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[AGGGCTCCGCTTAAGGGAC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>MLV-3&#8217; LTR nested primer Illumina</td>
			<td>general lab supplier</td>
			<td></td>
			<td>5&#39;-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[GGTCTCCTCTGAGTGATTGACTACC](Purification grade: SDS-PAGE)</td>
		</tr>
		<tr>
			<td>Sodium Acetate Solution (3M) pH 5.2</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol (absolute) for molecular biology</td>
			<td>Sigma-Aldrich</td>
			<td>E7023</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Topo TA Cloning kit (with pCR2.1-TOPO vector)</td>
			<td>Invitrogen</td>
			<td>K4500-01</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction kit</td>
			<td>QIAGEN</td>
			<td>28704</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma-Aldrich</td>
			<td>A9539</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Ethidium bromide&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>E1510</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>100 bp DNA ladder</td>
			<td>Invitrogen</td>
			<td>15628019</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>6X Loading Buffer</td>
			<td>ThermoScientific</td>
			<td>R0611</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>NanoDrop 2000 UV-Vis Spectrophotometer</td>
			<td>ThermoScientific</td>
			<td>ND-2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Nextera XT Index kit</td>
			<td>Illumina</td>
			<td>FC-131-1001 or FC-131-1002</td>
			<td></td>
		</tr>
		<tr>
			<td>2x KAPA HiFi Hot Start Ready Mix&#160;</td>
			<td>KAPA Biosystems</td>
			<td>KK2601</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynal magnetic stand for 2 ml tubes</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP 60 ml kit</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl 10 mM, pH 8.5</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2200 TapeStation system</td>
			<td>Agilent Technologies</td>
			<td>G2964AA</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 ScreenTape</td>
			<td>Agilent Technologies</td>
			<td>5067-5582</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>D1000 Reagents</td>
			<td>Agilent Technologies</td>
			<td>5067-5583</td>
			<td>or equivalent</td>
		</tr>
		<tr>
			<td>KAPA Library Quantification Kit for Illumina platforms (ABI Prism)</td>
			<td>KAPA Biosystems</td>
			<td>KK4835</td>
			<td></td>
		</tr>
		<tr>
			<td>ABI Prism 7900HT Fast Real-Time PCR System</td>
			<td>Applied Biosystems</td>
			<td>4329003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH 1.0 N, molecular biology-grade</td>
			<td>general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HT1 (Hybridization Buffer)</td>
			<td>Illumina&#160;</td>
			<td>Provided in the MiSeq Reagent Kit</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq Reagent Kit v3 (150 cycles)</td>
			<td>Illumina</td>
			<td>MS-102-3001</td>
			<td></td>
		</tr>
		<tr>
			<td>MiSeq System</td>
			<td>Illumina</td>
			<td>SY-410-1003</td>
			<td></td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>FC-110-3001</td>
			<td></td>
		</tr>
	</tbody>
</table>

retroviral scanning: mapping mlv integration sites to define cell-specific regulatory regions

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs.
The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.

Workflow of the retroviral scanning procedure
The workflow of retroviral scanning procedure is schematized in Figure 1. The target cell population is purified and transduced with a mLV-derived retroviral vector expressing an eGFP reporter gene. The transgene is flanked by the two identical long terminal repeats (5&#39; and 3&#39; LTR), ensuring synthesis, reverse transcription and integration of the vi...

Watch this Scientific Journal Video about Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions at JoVE.com

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

The overall goal of this procedure is to map integration sites of murine leukemia virus derived retroviral vectors to define cell specific regulatory regions. This method can help answer key question in gene therapy and gene regulation studies such as where the vector integrates in the human genome and which regulatory element can actively use via particular sub type. We first had the idea for this method observing that in gene therapy studies, MLV vectors integrate into active sub specific promoters and enhancers.Begin by transducing the target cells with an MLV-derived retroviral vector harboring the EGFP reporter gene and pseudotyped with VSV-G or the amphrotopic envelope glycoprotein. Mock transduced cells are used as a negative control. 48 hours after transduction, centrifuge the samples and then resuspend 100, 000 cells in 300 microliters of PBS containing two percent fetal bovine serum.Then, measurement the EGFP expression by flow site metric analysis. Harvest another 0.5 to five million transduced cells for genomic DNA preparation and subsequent restriction enzyme digestion. Set up four restriction enzyme digestions per sample in 1.5 milliliter tubes.Digest 0.1 to one microgram G-DNA in each tube. By adding 10 units of TRU91 and one microliter of buffer M per sample in a final volume of 10 microliters. Dispense two microliters of the mix into digestion tubes.And then incubate the reactions at 65 degrees celsius for six hours or overnight. Following the incubation, add 40 microliters of water to a 1.5 milliliter tube. In the same tube, add 10 units of PST1 and one microliters of buffer H per sample.Dispense 10 microliters of the digestion reaction mix in the digestion tubes. Incubate the reactions at 37 degrees celsius for six hours or overnight. The next day, set up eight linker ligation reactions in 1.5 milliliter tubes.For each reaction, add the ligase reaction mixture to 10 microliters of the digestion genomic DNA. Incubate at 16 degrees celsius for three to six hours. For first-round PCR, set up 48 PCR reactions in 0.2 milliliter tubes.For each PCR, add the reaction mixture containing the linker primer and MLV3 prime LTR primer to two microliters of the ligation reaction. Place the samples in a thermal cycler with heater lid. Set the cycling parameters and run the first round PCR reaction.For the second round PCR, set up the reaction mixture including linker nested primer and MLV3 prime LTR nested primer. Then, add two microliters of the PCR product from the first-round PCR as template. Then, run the second round PCR reaction to generate the final LN PCR products.After the second round PCR, pull the 48 nested LM PCR reactions in a 15 milliliter tube. Then add 20 microliters of loading buffer to 100 microliters of the pooled and precipitated LM PCR product. And load the sample onto a one percent agarose gel together with the 100 base pair DNA ladder.Run the gel at five volt per centimeter for 30 to 60 minutes once the bands are resolved, cut the proportion of the gel containing 500 to 150 base pair long amplicons. After purifying the LM PCR product with a column based gel extraction kit, measure the concentration using a UV spectrophotometer before proceeding to library preparation. Also, evaluate the length of the LM PCR products using a bioanalyzer instrument as per the manufacturer's instructions.Prepare the library by setting up an indexing PCR. For each PCR, use 150 to 170 nanograms of purified LM PCR product, in different index combination for each sample. Perform the PCR in a thermal cycler with heated lid as indicated.Following the PCR, dilute the purified library to 10 nanomolar with 10 millimolar tris HCL. Next, mix five microliters of diluted pool with five microliters of 0.2 newtons sodium hydroxide in a new 1.5 milliliter tube. Vortex briefly, spin down and then incubate for five minutes at room temperature to denature the libraries.Place the tubes of denatured pool on ice and 990 microliters of pre-chilled HT1 hybridization buffer. Then aliquot 300 microliters of denatured pool into a new 1.5 milliliter tube. And add 300 microliters of pre-chilled HT1 to obtain a ten picomolar final library pool.In parallel, mix 10 nanomolar of fixed control library in a two microliter volume with 3 microliters of 10 millimolar tris HCl in a 1.5 milliliter tube. Add five microliters of 0.2 newtons sodium hydroxide and vortex briefly. After spinning down, incubate for five minutes at room temperature to denature the diluted fix.After the incubation, place the tube on ice and add 990 microliters of pre-chilled HT1. Now, aliquot 100 microliters of denatured fix in a new 1.5 milliliter tube and add 300 microliters of pre-chilled HT1 to obtain a 10 picomolar final concentration of fix. Finally, in a new 1.5 milliliter tube, mix 510 microliters of denatured library pool with 90 microliters of denatured fixed library, thus obtaining a final 10 picomolar pool with 15%of fix control to be sequenced.This image shows the analysis of 3498, 2989, and 4103 clusters of recurrent MLV integration sites in hematopoietic stem progenitor cells, erythroid progenitors and myeloid progenitors respectively. In each cell population, greater than 95%of MLV clusters overlapped with epigenetically defined enhancers and promoters. Cell specific MLV targeted regions were highly acetylated and associated with cell specific expression of the targeted gene.Examples are the promoter of HSP specific SPINK2 gene. The locus control region containing potent enhancers of the erythroid specific beta-like globin genes. Enhancers located upstream of the NPP specific LYZ gene.Luciferase reporter assays validated the subset of cell specific MLV targeted enhancers in EPP and MPP. Erythroid specific MLV targeted regions had higher activity in EPP than in MPP and vice versa, confirming that MLV identifies cell specific enhancers possibly controlling the expression of nearby genes. Once mastered, this technique can be done in on week if it's performed properly.While attempting this procedure, it's important to remember to maximize the frequency of transduced cells for optimal integration site retrieval. After watching this video, you should have a good understanding of how to map viral integration sites by first adjusting the genomic DNA then ligating the genomic fragments with a DNA linker followed by amplifying the host genome viral junction via LM PCR and lastly deep sequencing the amplicon library.

retroviral-scanning-mapping-mlv-integration-sites-to-define-cell

Research

JoVE Journal

Genetics

8.3K ビュー.  University of Modena and Reggio Emilia. The overall goal of this procedure is to map integration sites of murine leukemia virus derived retroviral vectors to define cell specific regulatory regions. This method can help answer key question in gene therapy and gene regulation studies such as where the vector integrates in the human genome and which regulatory element can actively use via particular sub type. We first had the idea for this method observing that in gene therapy studies, MLV vectors integrate into active sub specific p...