The authors were funded by grants from the Novo Nordisk Foundation, the Lundbeck Foundation, and the Danish National Research Foundation (DNRF120) through the Center for Bacterial Stress Response and Persistence (BASP).

1. Collection of the Transposon Library
NOTE: The chromosomal DARS2 locus was cloned into the mini Tn10-based transposon, NKBOR (on pNKBOR)21, resulting in NKBOR::DARS2 (pJFM1). pNKBOR can be obtained online22. pNKBOR is a R6K-based suicide vector that requires the initiator protein &#960; for replication23. Plasmid pJFM1 is therefore able to replicate in an E. coli strain (e.g., Dh5&#945; &#955; pir) containing a chromosomal copy of the pir gene. However, when pJFM1 is transformed into the Pir-deficient wildtype MG1655, pJFM1 cannot replicate, leading to the selection of kanamycin-resistant clones generated by the random insertions of NKBOR::DARS2 into the bacterial chromosome. For simplicity, these are referred to as DARS2 insertions. See Figure 1 for a schematic presentation of the methodology.
<ol>
	<li>Prepare electrocompetent MG1655 &#916;DARS2 from actively growing cells in Lysogeny broth (LB) grown at 37 &#176;C24.</li>
	<li>Electroporate pJFM1 into electrocompetent MG1655 &#916;DARS2, according to Gonzales et al.24
	<ol>
		<li>Add 1 &#181;g of pJFM1 (in 1 &#181;L of water) to 40 &#181;L of electrocompetent E. coli MG1655 &#916;DARS2 and transfer this mixture to a pre-chilled, sterile 0.2-cm gap cuvette. Insert the cuvette into the electroporation chamber. Electroporate at 18 kV, 500 &#937;, and 25 &#181;F; the time constant should be ~5.0 ms, and no arcing should occur.</li>
		<li>Quickly recover the bacterial suspension by resuspending it in 1 mL of pre-warmed LB broth and transfer to a 15 mL test tube.</li>
		<li>Let the cells recover by incubating under aerated growth conditions at 37 &#176;C for 30 min, without antibiotic selection. Plate the bacteria onto LB agar plates supplemented with 50&#181;g/mL kanamycin and incubate at 37 &#176;C overnight.</li>
	</ol>
	</li>
	<li>Count the colonies from the electroporation: one colony is considered equal to one chromosomal transposon insertion. 
	NOTE: Colonies can be counted by eye or with a colony counter. The number of colonies is inversely proportional to the average distance separating the transposons located in the chromosome of each clone.</li>
	<li>Add 1 mL of LB broth to each plate and wash off all colonies; 1 mL of LB broth should be sufficient to wash off ~100,000 colonies. Re-use the same 1 mL of LB broth to increase the bacterial concentration. Pool all colonies in the same 50 mL tube.</li>
	<li>Vortex the tube and freeze the start material (t = 0). To freeze it, mix 1 mL of cell suspension with 1 mL of 50% glycerol on ice. Transfer the tubes to dry ice for 10 min. Once the cultures are frozen, transfer them to a -80 &#176;C freezer. 
	NOTE: A cell concentration of a minimum of 50,000 CFU/mL is expected at this step.</li>
</ol>
2. Competition Experiment in LB
<ol>
	<li>Thaw the transposon library from -80 &#176;C on ice. Mix by pipetting.</li>
	<li>Transfer 100 &#181;L of the transposon library to 10 mL of LB in a 15 mL test tube.</li>
	<li>Grow the cells, aerated by continuous shaking (250 rpm), for 8 h at 37 &#176;C to stationary phase (i.e., OD600 = ~4.0). Adjust these parameters to different growth conditions, as desired.</li>
	<li>Propagate the bacterial population by continuous transfers into fresh prewarmed medium every ~10 generations. Do this by transferring 10 &#181;L of the previous stationary phase culture to 10 mL of fresh LB and growing for another 8 h to the stationary phase (i.e., OD600 = ~4.0). 
	NOTE: As the start and end optical density are the same, a 1,000-fold dilution corresponds to ~10 generations of growth (210 = 1,024). The bacterial population can either be propagated directly into fresh prewarmed medium or saved at 0-4 &#176;C (on ice) and propagated the following day. LB was used here to ensure as many cellular doublings in as short a time as possible (a doubling time close to 22 min).</li>
	<li>After each 100 generations of competition, save five 1-mL samples at -80 &#176;C (as described in step 3.3).</li>
	<li>If the fitness differences between cells containing individual transposon insertions are expected to be small, keep the duration of competition long; here, 700 generations (t = 700) were used.</li>
</ol>
3. Southern Blot Analysis to Monitor the Competition Experiment Over Time
<ol>
	<li>Prepare the probe for the Southern blot (1-kb section of the NKBOR) by performing polymerase chain reaction (PCR) amplification using specific primers: NKBOR_Probe_FW: gatgttggacgagtcggaat and NKBOR_Probe_RV: cgttacatccctggcttgtt.
	<ol>
		<li>Incubate at 98 &#176;C for 30 s for initial denaturation. Then, perform 35 cycles at 98 &#176;C for 10 s, 60 &#176;C for 30 s, and 72 &#176;C for 45 s. For the final extension, use 72 &#176;C for 10 min. 
		NOTE: The template for the PCR reaction was a purified pNKBOR plasmid21.</li>
		<li>Label the resultant PCR fragment with [&#945;-32P]dATP using the random primer system, according to Smith25.</li>
	</ol>
	</li>
	<li>Prepare the total cellular DNA according to L&#248;bner-Olesen and von Freiesleben26 for t = 0 and selected time points until t = 700 estimated generations of competition.</li>
	<li>Digest the total cellular DNA with PvuI, which cuts the NKBOR containing the region of interest once only in a region not covered by the probe; 1 unit of PvuI can be used to completely digest 1 &#181;g of substrate DNA. 
	NOTE: The probe will recognize fragments containing part of the transposon, along with chromosomal DNA of various lengths, depending on the insertion site.</li>
	<li>Perform a Southern blot using a 0.7% agarose gel according to L&#248;bner-Olesen and von Freiesleben26.</li>
</ol>
4. Identification of the Fittest Clones
<ol>
	<li>Use easy gene walking, as described by Harrison et al.27, to identify DARS2 insertion sites from single clones (isolated on LB plates) after 700 estimated generations of competition; the more bands on the Southern blot, the more isolates are needed to cover all transposon insertions.
	<ol>
		<li>Isolate genomic DNA for PCR template. Spread bacteria on an LB agar plate containing 50 &#181;g/mL kanamycin and incubate at 37 &#176;C overnight. Grow single colonies overnight in LB broth at 37 &#176;C and subsequently transfer 20 &#181;L into 200 &#181;L of autoclaved distilled water (or use DNA purification, as in step 3.2).
		<ol>
			<li>Vortex to mix. Heat the mix at 100 &#176;C for 10 min and centrifuge at max speed for 5 min. Save the cell lysate at -20 &#176;C for future use.</li>
		</ol>
		</li>
		<li>Design three nested primers to anneal within the transposon of choice (see Figure 2 for a graphic representation of the PCR strategy). 
		NOTE: Designing Nested Primers should ensure that Nested Primer 3 lies closest to the known 5&#39; end of the transposon DNA, followed by Nested Primers 2 and 1. The spacing between Nested Primer 3 and the 5&#39; end of the known transposon DNA should be sufficient for a sequence read-through from the known DNA to the unknown DNA (to find the specific chromosomal transposon insertion site). For NKBOR the following nested primers were used: pNKBOR_Nested3_RV: gcagggctttattgattcca, pNKBOR_Nested2_RV: tcagcaacaccttcttcacg, and pNKBOR_Nested1_RV: actttctggctggatgatgg. Random primers containing the recognition sites of known restriction enzymes are also used. To ensure a result, one should use at least two different random primers. The restriction sites for the restriction enzymes (e.g.,Sau3AI and HindIII) should be located at the 3&#39; end and preceded by ten random bases so that 5&#39;-NNNNNNNNNNGATC-3&#39; and 5&#39;-NNNNNNNNNNAAGCTT-3&#39; are the primers containing a Sau3AI site (GATC) and a HindIII site (AAGCTT), respectively, where N = A, T, G, or C.</li>
		<li>Use 200 ng of genomic DNA in a 20 &#181;L PCR reaction. Incubate at 98 &#176;C for 30 s for the initial denaturation. Perform 25 cycles at 98 &#176;C for 30 s, 50 &#176;C for 15 s, and 72 &#176;C for 4 min. For the final extension, use 72 &#176;C for 10 min. Use primer pairs consisting of Nested Primer 1 and one of the random primers.</li>
		<li>Use primer pairs consisting of Nested Primer 2 and the same random primer from the second amplification, using 1 &#181;L of its previous reaction as a template.</li>
		<li>Repeat step 4.1.4 with primer pairs consisting of Nested Primer 3 and the same random primer.</li>
		<li>Run the products from the final PCR reaction on a 1.5% agarose gel and stain with ethidium bromide. Cut out a band in the range 100-800 bp and isolate the DNA using any commercial DNA gel extracting kit according to the manufacturer&#39;s direction. Resuspend the DNA in 15 &#181;L of water. 
		NOTE: Caution. Ethidium bromide is toxic and must be handled with care.</li>
		<li>Sequence the band isolated in the previous step (step 4.1.6), with Nested Primer 3 as the sequencing primer, using Sanger sequencing at a commercial provider.</li>
	</ol>
	</li>
	<li>Perform WGS.
	<ol>
		<li>Perform WGS on the total DNA extracted from selected samples collected during the competition experiment, as described by Frimodt-M&#248;ller et al4.</li>
	</ol>
	</li>
	<li>Perform sequencing analysis.
	<ol>
		<li>Align paired-end reads to 150 Ns contiguous to NKBOR, AF310136.1 1,904&#8230;2,204 using Bowtie228 with an interval between seed substrings (S,1,1.15) and a maximum number of ambiguous characters (L,0,0.9).</li>
		<li>Select the aligned reads and then re-align to both MG1655 ref|NC_000913.3 and NKBOR gb|AF310136 using blastN29</li>
		<li>Assign transposition insertion positions at junctions MG1655-NKBOR.</li>
	</ol>
	</li>
</ol>
5. Flow Cytometry
<ol>
	<li>Collect samples for flow cytometry.
	<ol>
		<li>Balance each culture by maintaining it in the exponential growth phase for at least 10 generations. Check the OD600 and ensure that it never exceeds 0.3.</li>
		<li>Collect two types of flow samples.
		<ol>
			<li>For RIF-runout, transfer 1 mL of culture to a 15 mL tube containing 30 &#181;L of RIF-CEF (300 &#181;g/mL rifampicin and 36 &#181;g/mL cephalexin dissolved in 12.5 mM NaOH). Leave it at 37 &#176;C for a minimum of 4 h of shaking. 
			NOTE: Rifampicin indirectly blocks the initiation of chromosome replication while allowing for ongoing rounds of replication to continue to termination. Cephalexin prevents cell division, which results in replication runout (RIF-runout) and the accumulation of cells with fully replicated chromosomes. The number of fully replicated chromosomes is equal to the number of origins at the time of treatment with rifampicin and cephalexin20.</li>
			<li>For the EXP-sample, transfer 1 mL of exponentially growing culture to a 1.5-mL tube on ice.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Fix THE cells as follows. Harvest the cells by centrifugation at 15,000 x g for 5 min at 4 &#176;C. Resuspend the pellet in 100 &#181;L of ice-cold 10 mM Tris pH 7.5 and add 1 mL of ice-cold 77% ethanol. Store the samples at 4 &#176;C until use.</li>
	<li>Stain the cells as follows. Harvest 100-300 &#181;L of fixed cells by centrifugation at 15,000 x g for 15 min. Remove the supernatant and resuspend the pellet in 130 &#181;L of &#34;DNA Staining solution&#34; (90 &#181;g/mL mithramycin, 20 &#181;g/mL ethidium bromide, 10 mM MgCl2, and 10 mM Tris pH 7.5). Put the samples on ice and in the dark; the samples are ready for flow cytometry analysis after 10 min. 
	NOTE: Other DNA stains than ethidium bromide and mithramycin can also be used30,31.</li>
	<li>Determine the origin per cell, the relative cell mass, and the relative DNA content by flow cytometry analysis.
	<ol>
		<li>Perform flow cytometry, as described previously32. Run RIF-runout and EXP-samples using the flow cytometer manufacturer&#39;s instructions. For mithramycin- and ethidium bromide-stained cells, use excitation wavelengths 395 and 440 nm and collect the fluorescence above 565 nm.
		<ol>
			<li>To determine the relative cell mass and relative DNA content, run the EXP-samples to obtain single-parameter forward-light scatter versus cell number histograms and fluorescence intensity versus cell number histograms for a minimum of 30,000 events corresponding to the cell signal.</li>
			<li>Use forward-scattered light single-parameter distribution to measure the average relative cell mass. 
			NOTE: Forward-scattered light is a measure of the average cell mass20.</li>
			<li>Use fluorescence intensity single-parameter distributions to measure the average DNA content20.</li>
			<li>Obtain the DNA concentration as the ratio of average DNA content to the average cell mass20.</li>
		</ol>
		</li>
		<li>Determine the number of origins per cell.
		<ol>
			<li>Run RIF-runout samples to obtain single-parameter fluorescence intensity versus cell number histograms for a minimum of 30,000 events corresponding to the cell signal.</li>
			<li>Use fluorescence intensity single-parameter distributions to determine the number of chromosomes in each cell20.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Calculate the asynchrony index (Ai).
	<ol>
		<li>Calculate the Ai,as described by L&#248;bner-Olesen et al.32, using the fluorescence intensity single parameter distributions of the RIF-runout samples and the formula Ai = (f3 + f5 + f6 + f7) / (f2 + f4 + f8), where fx is the fraction cells with x number of fully replicated chromosomes. Consider initiations asynchronous when A &#62;0.1.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Frimodt-Moller, J., Charbon, G., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+bacterial+chromosome+replication+by+non-coding+regions+outside+the+origin.">Control of bacterial chromosome replication by non-coding regions outside the origin.</a> Curr Genet. , (2016).</li><li>Sherratt, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombination+and+chromosome+segregation.">Recombination and chromosome segregation.</a> Philos Trans R Soc Lond B Biol Sci. 359 (1441), 61-69 (2004).</li><li>Bigot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+motifs+that+control+E.+coli+chromosome+segregation+by+orienting+the+FtsK+translocase.">DNA motifs that control E. coli chromosome segregation by orienting the FtsK translocase.</a> EMBO J. 24 (21), 3770-3780 (2005).</li><li>Frimodt-Moller, J., Charbon, G., Krogfelt, K. A., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Replication+Control+Is+Linked+to+Genomic+Positioning+of+Control+Regions+in+Escherichia+coli.">DNA Replication Control Is Linked to Genomic Positioning of Control Regions in Escherichia coli.</a> PLoS Genet. 12 (9), 1006286 (2016).</li><li>Kornberg, A., Baker, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> DNA Replication, Second Edition. , (1992).</li><li>Kaguni, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+initiation+at+the+Escherichia+coli+chromosomal+origin.">Replication initiation at the Escherichia coli chromosomal origin.</a> Curr Opin Chem Biol. 15 (5), 606-613 (2011).</li><li>Leonard, A. C., Grimwade, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+DnaA+assembly+and+activity:+taking+directions+from+the+genome.">Regulation of DnaA assembly and activity: taking directions from the genome.</a> Annu Rev Microbiol. 65, 19-35 (2011).</li><li>Kurokawa, K., Nishida, S., Emoto, A., Sekimizu, K., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+cycle-coordinated+change+of+the+adenine+nucleotide-bound+forms+of+DnaA+protein+in+Escherichia+coli.">Replication cycle-coordinated change of the adenine nucleotide-bound forms of DnaA protein in Escherichia coli.</a> EMBO J. 18 (23), 6642-6652 (1999).</li><li>Sekimizu, K., Bramhill, D., Kornberg, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATP+activates+dnaA+protein+in+initiating+replication+of+plasmids+bearing+the+origin+of+the+E.+coli+chromosome.">ATP activates dnaA protein in initiating replication of plasmids bearing the origin of the E. coli chromosome.</a> Cell. 50 (2), 259-265 (1987).</li><li>Brendler, T., Austin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+of+SeqA+protein+to+DNA+requires+interaction+between+two+or+more+complexes+bound+to+separate+hemimethylated+GATC+sequences.">Binding of SeqA protein to DNA requires interaction between two or more complexes bound to separate hemimethylated GATC sequences.</a> EMBO J. 18 (8), 2304-2310 (1999).</li><li>Lu, M., Campbell, J. L., Boye, E., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SeqA:+a+negative+modulator+of+replication+initiation+in+E.+coli.">SeqA: a negative modulator of replication initiation in E. coli.</a> Cell. 77 (3), 413-426 (1994).</li><li>Katayama, T., Kubota, T., Kurokawa, K., Crooke, E., Sekimizu, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+initiator+function+of+DnaA+protein+is+negatively+regulated+by+the+sliding+clamp+of+the+E.+coli+chromosomal+replicase.">The initiator function of DnaA protein is negatively regulated by the sliding clamp of the E. coli chromosomal replicase.</a> Cell. 94 (1), 61-71 (1998).</li><li>Kato, J., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hda,+a+novel+DnaA-related+protein,+regulates+the+replication+cycle+in+Escherichia+coli.">Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli.</a> EMBO J. 20 (15), 4253-4262 (2001).</li><li>Kasho, K., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DnaA+binding+locus+datA+promotes+DnaA-ATP+hydrolysis+to+enable+cell+cycle-coordinated+replication+initiation.">DnaA binding locus datA promotes DnaA-ATP hydrolysis to enable cell cycle-coordinated replication initiation.</a> Proc Natl Acad Sci U S A. 110 (3), 936-941 (2013).</li><li>Kitagawa, R., Ozaki, T., Moriya, S., Ogawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negative+control+of+replication+initiation+by+a+novel+chromosomal+locus+exhibiting+exceptional+affinity+for+Escherichia+coli+DnaA+protein.">Negative control of replication initiation by a novel chromosomal locus exhibiting exceptional affinity for Escherichia coli DnaA protein.</a> Genes Dev. 12 (19), 3032-3043 (1998).</li><li>Fujimitsu, K., Senriuchi, T., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+genomic+sequences+of+E.+coli+promote+replicational+initiation+by+directly+reactivating+ADP-DnaA.">Specific genomic sequences of E. coli promote replicational initiation by directly reactivating ADP-DnaA.</a> Genes Dev. 23 (10), 1221-1233 (2009).</li><li>Kasho, K., Fujimitsu, K., Matoba, T., Oshima, T., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timely+binding+of+IHF+and+Fis+to+DARS2+regulates+ATP-DnaA+production+and+replication+initiation.">Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiation.</a> Nucleic Acids Res. 42 (21), 13134-13149 (2014).</li><li>Frimodt-Moller, J., Charbon, G., Krogfelt, K. A., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+regions+for+chromosome+replication+are+conserved+with+respect+to+sequence+and+location+among+Escherichia+coli+strains.">Control regions for chromosome replication are conserved with respect to sequence and location among Escherichia coli strains.</a> Front Microbiol. 6, 1011 (2015).</li><li>Bergthorsson, U., Ochman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+chromosome+length+variation+in+natural+isolates+of+Escherichia+coli.">Distribution of chromosome length variation in natural isolates of Escherichia coli.</a> Mol Biol Evol. 15 (1), 6-16 (1998).</li><li>Boye, E., Steen, H. B., Skarstad, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+of+bacteria:+a+promising+tool+in+experimental+and+clinical+microbiology.">Flow cytometry of bacteria: a promising tool in experimental and clinical microbiology.</a> J Gen Microbiol. 129 (4), 973-980 (1983).</li><li>Rossignol, M., Basset, A., Espeli, O., Boccard, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NKBOR,+a+mini-Tn10-based+transposon+for+random+insertion+in+the+chromosome+of+Gram-negative+bacteria+and+the+rapid+recovery+of+sequences+flanking+the+insertion+sites+in+Escherichia+coli.">NKBOR, a mini-Tn10-based transposon for random insertion in the chromosome of Gram-negative bacteria and the rapid recovery of sequences flanking the insertion sites in Escherichia coli.</a> Res Microbiol. 152 (5), 481-485 (2001).</li><li>Shafferman, A., Helinski, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+properties+of+the+beta+origin+of+replication+of+plasmid+R6K.">Structural properties of the beta origin of replication of plasmid R6K.</a> J Biol Chem. 258 (7), 4083-4090 (1983).</li><li>Gonzales, M. F., Brooks, T., Pukatzki, S. U., Provenzano, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+protocol+for+preparation+of+electrocompetent+Escherichia+coli+and+Vibrio+cholerae.">Rapid protocol for preparation of electrocompetent Escherichia coli and Vibrio cholerae.</a> J Vis Exp. (80), (2013).</li><li>Smith, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+primed+labeling+of+DNA.">Random primed labeling of DNA.</a> Methods Mol Biol. 18, 445-447 (1993).</li><li>Lobner-Olesen, A., von Freiesleben, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+replication+incompatibility+in+Dam+methyltransferase+deficient+Escherichia+coli+cells.">Chromosomal replication incompatibility in Dam methyltransferase deficient Escherichia coli cells.</a> EMBO J. 15 (21), 5999-6008 (1996).</li><li>Harrison, R. W., Miller, J. C., D'Souza, M. J., Kampo, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+gene+walking.">Easy gene walking.</a> Biotechniques. 22 (4), 650-653 (1997).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J Mol Biol. 215 (3), 403-410 (1990).</li><li>Stepankiw, N., Kaidow, A., Boye, E., Bates, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+right+half+of+the+Escherichia+coli+replication+origin+is+not+essential+for+viability,+but+facilitates+multi-forked+replication.">The right half of the Escherichia coli replication origin is not essential for viability, but facilitates multi-forked replication.</a> Mol Microbiol. 74 (2), 467-479 (2009).</li><li>Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+minichromosomes+in+individual+Escherichia+coli+cells:+implications+for+replication+control.">Distribution of minichromosomes in individual Escherichia coli cells: implications for replication control.</a> EMBO J. 18 (6), 1712-1721 (1999).</li><li>Lobner-Olesen, A., Skarstad, K., Hansen, F. G., von Meyenburg, K., Boye, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DnaA+protein+determines+the+initiation+mass+of+Escherichia+coli+K-12.">The DnaA protein determines the initiation mass of Escherichia coli K-12.</a> Cell. 57 (5), 881-889 (1989).</li><li>Carver, T., Thomson, N., Bleasby, A., Berriman, M., Parkhill, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAPlotter:+circular+and+linear+interactive+genome+visualization.">DNAPlotter: circular and linear interactive genome visualization.</a> Bioinformatics. 25 (1), 119-120 (2009).</li><li>Eckert, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrospective+application+of+transposon-directed+insertion+site+sequencing+to+a+library+of+signature-tagged+mini-Tn5Km2+mutants+of+Escherichia+coli+O157:H7+screened+in+cattle.">Retrospective application of transposon-directed insertion site sequencing to a library of signature-tagged mini-Tn5Km2 mutants of Escherichia coli O157:H7 screened in cattle.</a> J Bacteriol. 193 (7), 1771-1776 (2011).</li><li>van Opijnen, T., Bodi, K. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn-seq:+high-throughput+parallel+sequencing+for+fitness+and+genetic+interaction+studies+in+microorganisms.">Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms.</a> Nat Methods. 6 (10), 767-772 (2009).</li><li>van Opijnen, T., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon+insertion+sequencing:+a+new+tool+for+systems-level+analysis+of+microorganisms.">Transposon insertion sequencing: a new tool for systems-level analysis of microorganisms.</a> Nat Rev Microbiol. 11 (7), 435-442 (2013).</li><li>Jeong, H., Lee, S. J., Kim, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Procedure+for+Adaptive+Laboratory+Evolution+of+Microorganisms+Using+a+Chemostat.">Procedure for Adaptive Laboratory Evolution of Microorganisms Using a Chemostat.</a> J Vis Exp. (115), (2016).</li><li>Bryant, J. A., Sellars, L. E., Busby, S. J., Lee, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome+position+effects+on+gene+expression+in+Escherichia+coli+K-12.">Chromosome position effects on gene expression in Escherichia coli K-12.</a> Nucleic Acids Res. 42 (18), 11383-11392 (2014).</li><li>Blattner, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complete+genome+sequence+of+Escherichia+coli+K-12.">The complete genome sequence of Escherichia coli K-12.</a> Science. 277 (5331), 1453-1462 (1997).</li></ol>

The authors have no competing financial interest.

The methodology used here takes advantage of state-of-the-art techniques to answer a difficult question regarding the optimal genomic position of a genetic element. The random insertion of the genetic element (mediated by the transposon) enables the fast and easy collection of thousands of clones, which then can be made to compete against each other to select for the optimal position of the investigated genetic element (i.e., the fittest clone).
Here, DARS2 was inserted into ...

The function of any genetic element can be affected by its location in the genome. In bacteria, this mainly results from interference by the transcription of neighboring genes, local DNA topology, and/or replication-associated gene dosage. In particular, the processes of DNA replication and segregation are controlled, at least in part, by non-coding chromosomal regions1, and the proper function of these regions depends on genomic location/context. In E.coli, examples are the dif site, required for sister chromosome resolution2; KOPS sequences, required for chromosome segregation3; and datA, DARS1, and DARS2 regions, required for proper chromosomal replication control (below; 4). We present a method allowing for the random relocation, selection, and determination of the optimal genetic context of any given genetic element, exemplified here by the study of the DARS2 non-coding region.
In E. coli, DnaA is the initiator protein responsible for DNA strand opening at the single replication origin, oriC, and for the recruitment of the helicase DnaB5,6,7. DnaA belongs to the AAA+ (i.e., ATPases associated with diverse activities) proteins and can bind both ATP and ADP with similar high affinities5. The level of DnaAATP peaks at initiation8, where DnaAATP forms a multimer on oriC that triggers DNA duplex opening9. After initiation, oriC is made temporarily unavailable for re-initiation due to sequestration by a mechanism involving the binding of the SeqA protein to hemimethylated oriC10,11. During sequestration, the level of DnaAATP is reduced by at least two mechanisms: the regulatory inactivation of DnaA (RIDA)12,13 and datA-dependent DnaAATP hydrolysis (DDAH)14,15. Both RIDA and DDAH promote the conversion of DnaAATP to DnaAADP. Prior to a new round of initiation, DnaAADP is re-activated to DnaAATP at specific DnaA-reactivating sequences (DARS): DARS1 and DARS216,17. The chromosomal datA, DARS1,and DARS2 regions are non-coding and act in a chaperone-like manner to modulate DnaAATP/DnaAADP interconversion. These regions, located outside the origin of replication, enable the assembly of a DnaA complex for either the inactivation (datA;14) or activation (DARS1 and DARS2;17) of DnaA. Deleting DARS2 in a cell does not alter mass doubling time but results in asynchronous replication initiation15,16,18. However, DARS2-deficient cells have a fitness cost compared to an otherwise isogenic wildtype during both continuous growth competition in rich medium or during the establishment of colonization in the mouse intestine18. This indicates that even minor changes in asynchrony/origin concentration have a negative effect on bacterial fitness. In E. coli, there is a selective pressure to maintain chromosome symmetry (i.e., two nearly equal length replication arms)19. The datA, DARS1, and DARS2 regions have the same relative distance to oriC in all E. coli strains sequenced18, despite large variations in chromosome size.
Here, we use the DARS2 region of E. coli as an example for the identification of the chromosomal position(s) optimal for its function. DARS2 was inserted into the NKBOR transposon, and the resultant NKBOR::DARS2 transposon subsequently inserted randomly into the genome of MG1655 &#916;DARS2. We thus generated a collection of cells, each possessing DARS2 placed at a different location on the chromosome. An in vitro competition experiment, where all cells in the collection were pooled and competed against each other during continuous growth in LB for an estimated 700 generations, was performed. The outcome of the competition experiment was monitored/determined using Southern blot, easy gene walking, and whole-genome sequencing (WGS; Figure 1). End-point clones resolved by easy gene walking were characterized by flow cytometry to evaluate cell-cycle parameters. In a flow cytometric analysis, cell size, DNA content, and initiation synchrony can be measured for a large number of cells. During flow cytometry, a flow of single cells passes a light beam of the appropriate wavelength to excite the stained DNA, which is then simultaneously registered by photomultipliers that collect the emitted fluorescence, a measure of DNA content, provided the cells are stained for DNA. The forward-scattered light is a measure of cell mass20.
The in vitro competition experiment we present here is used to address questions relating to the importance of the chromosomal position and genomic context of the genetic element. The method is unbiased and easy to use.

<table><tbody><tr><td>Autoclaved Mili-Q water</td><td></td><td>None</td><td></td></tr><tr><td>Electroporation Cuvettes, 0.1 cm</td><td>Thermo Fisher Scientific</td><td>P41050</td><td></td></tr><tr><td>Bio-Rad MicroPulser Electroporation System</td><td>Bio-Rad</td><td>165-2100</td><td></td></tr><tr><td>LB Broth</td><td>Thermo Fisher Scientific</td><td>12780029&amp;nbsp;</td><td></td></tr><tr><td>LB Agar, powder (Lennox L agar)</td><td>Thermo Fisher Scientific</td><td>22700025</td><td></td></tr><tr><td>Glycerol</td><td>Thermo Fisher Scientific</td><td>17904</td><td></td></tr><tr><td>Fisherbrand&amp;nbsp;Plastic Petri Dishes</td><td>Fisher Scientific</td><td>S33580A</td><td></td></tr><tr><td>Falcon 50mL Conical Centrifuge Tubes</td><td>Fisher Scientific</td><td>14-432-22</td><td></td></tr><tr><td>Falcon 15mL Conical Centrifuge Tubes</td><td>Fisher Scientific</td><td>14-959-53A</td><td></td></tr><tr><td>Nunc&amp;nbsp;CryoTubes</td><td>Sigma-Aldrich</td><td>V7634&amp;nbsp;</td><td></td></tr><tr><td>Phusion High-Fidelity DNA Polymerase (2 U/&amp;micro;L)</td><td>Thermo Fisher Scientific</td><td>F530S</td><td></td></tr><tr><td>dATP, [&amp;alpha;-32P]- 3000Ci/mmol 10mCi/ml, 250 &amp;micro;Ci</td><td>PerkinElmer</td><td>BLU012H250UC</td><td></td></tr><tr><td>DECAprime II DNA Labeling Kit</td><td>Thermo Fisher Scientific</td><td>AM1455</td><td></td></tr><tr><td>Spectrophotometer&amp;nbsp; SF/MBV/03.32</td><td>Pharmacia</td><td></td><td></td></tr><tr><td>Hermle Centrifuge&amp;nbsp;&amp;nbsp;&amp;nbsp; SF/MBV/03.46</td><td>Hermle</td><td></td><td></td></tr><tr><td>Ole Dich Centrifuge&amp;nbsp; SF/MBV/03.29</td><td>Ole Dich</td><td></td><td></td></tr><tr><td>Eppendorftubes 1.5 mL</td><td>Sigma-Aldrich</td><td>T9661</td><td></td></tr><tr><td>Eppendorftubes 2.0 mL</td><td>Sigma-Aldrich</td><td>T2795</td><td></td></tr><tr><td>Sodium Chloride</td><td>Merck</td><td>6404</td><td></td></tr><tr><td>96% Ethanol</td><td>Sigma-Aldrich</td><td>16368</td><td></td></tr><tr><td>Trizma HCl</td><td>Sigma-Aldrich</td><td>T-3253</td><td></td></tr><tr><td>Phenol Ultra Pure</td><td>BRL</td><td>5509UA</td><td></td></tr><tr><td>Chloroform</td><td>Merck</td><td>2445</td><td></td></tr><tr><td>Ribonuclease A type II A</td><td>Sigma-Aldrich</td><td>R5000</td><td></td></tr><tr><td>Sodiumdodecylsulphate (SDS)</td><td>Merck</td><td>13760</td><td></td></tr><tr><td>Lysozyme</td><td>Sigma-Aldrich</td><td>L 6876</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma-Aldrich</td><td>405-7</td><td></td></tr><tr><td>0.5M Na-EDTA pH 8.0</td><td>BRL</td><td>5575 UA</td><td></td></tr><tr><td>Kanamycin sulfate</td><td>Sigma-Aldrich</td><td>10106801001</td><td></td></tr><tr><td>PvuI (10 U/&amp;micro;L)</td><td>Thermo Fisher Scientific</td><td>ER0621</td><td></td></tr><tr><td>UltraPure Agarose</td><td>Thermo Fisher Scientific</td><td>16500500</td><td></td></tr><tr><td>DNA Gel Loading Dye (6X)</td><td>Thermo Fisher Scientific</td><td>R0611</td><td></td></tr><tr><td>Tris-Borate-EDTA buffer</td><td>Sigma-Aldrich</td><td>T4415</td><td></td></tr><tr><td>Ethidium bromide</td><td>Sigma-Aldrich</td><td>E7637</td><td></td></tr><tr><td>Hydrochloric acid</td><td>Sigma-Aldrich</td><td>433160</td><td></td></tr><tr><td>Sodium Hydroxide</td><td>Sigma-Aldrich</td><td>71687</td><td></td></tr><tr><td>Whatman&amp;nbsp;3MM papers</td><td>Sigma-Aldrich</td><td>WHA3030931</td><td></td></tr><tr><td>SSC Buffer 20&amp;times; Concentrate</td><td>Sigma-Aldrich</td><td>S6639</td><td></td></tr><tr><td>Amersham Hybond-N+</td><td>GE Healthcare</td><td>RPN119B</td><td></td></tr><tr><td>Ficoll&amp;nbsp;400</td><td>Sigma-Aldrich</td><td>F8016</td><td></td></tr><tr><td>Polyvinylpyrrolidone</td><td>Sigma-Aldrich</td><td>PVP40</td><td></td></tr><tr><td>Bovine Serum Albumin - Fraction V</td><td>Sigma-Aldrich</td><td>85040C</td><td></td></tr><tr><td>Deoxyribonucleic acid sodium salt from salmon testes</td><td>Sigma-Aldrich</td><td>D1626</td><td></td></tr><tr><td>Carestream Kodak &amp;nbsp;BioMax &amp;nbsp;light film</td><td>Sigma-Aldrich</td><td>Z373494</td><td></td></tr><tr><td>GenElute &amp;nbsp;Gel Extraction Kit</td><td>Sigma-Aldrich</td><td>NA1111&amp;nbsp;</td><td></td></tr><tr><td>GenElute &amp;nbsp;PCR Clean-Up Kit</td><td>Sigma-Aldrich</td><td>NA1020</td><td></td></tr><tr><td>T100&amp;nbsp; Thermal Cycler</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>SmartSpec Plus Spectrophotometer</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>Rifampicin</td><td>Serva</td><td>34514.01</td><td></td></tr><tr><td>Cephalexin</td><td>Sigma-Aldrich</td><td>C4895</td><td></td></tr><tr><td>Mithramycin</td><td>Serva</td><td>29803.02</td><td></td></tr><tr><td>Magnesium chloride hexahydrate</td><td>Sigma-Aldrich</td><td>246964</td><td></td></tr><tr><td>Apogee A10 instrument</td><td>Apogee</td><td></td><td></td></tr></tbody></table>

determination of the optimal chromosomal location(s) for a dna element in escherichia coli using a novel transposon-mediated approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

A Southern blot was done to verify that DARS2 was distributed randomly throughout the chromosome in the transposon library (t = 0) and that the fittest clones would persist over time. The Southern blot was performed on DNA extracted from the initial transposon pool (at t = 0) and every estimated 100 out of 700 generations of competition (Figure 3). Here, the total cellular DNA from each time-point was digested with the PvuI restriction enzym...

Watch this Scientific Journal Video about Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach at JoVE.com

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

determination-optimal-chromosomal-location-s-for-dna-element

Research

JoVE Journal

Genetics

7.5K Views.  University of Copenhagen. Hier, werd de kracht van een transposon-gemedieerde willekeurige invoeging van een niet-coderende DNA element gebruikt om op te lossen zijn optimale chromosomale positie.

Video: Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia coli, these transfer proteins make up a DNA transfer machinery known as the mating pair formation, or DNA transfer complex, which facilitates conjugative plasmid transfer. The objective of this paper is to provide a method that can be used to determine the role of a specific transfer protein that is involved in conjugation using a series of deletions and/or point mutations in combination with mating assays. The target gene is knocked out on the conjugative plasmid and is then provided in trans through the use of a small recovery plasmid harboring the target gene. Mutations affecting the target gene on the recovery plasmid can reveal information about functional aspects of the target protein that result in the alteration of mating efficiency of donor cells harboring the mutated gene. Alterations in mating efficiency provide insight into the role and importance of the particular transfer protein, or a region therein, in facilitating conjugative DNA transfer. Coupling this mating assay with detailed three-dimensional structural studies will provide a comprehensive understanding of the function of the conjugative transfer protein as well as provide a means for identifying and characterizing regions of protein-protein interaction.

Here, we present a protocol to knockout a gene of interest involved in plasmid conjugation and subsequently analyze the impact of its absence using mating assays. The function of the gene is further explored to a specific region of its sequence using deletion or point mutations.

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia ...

Site-specific Bacterial Chromosome Engineering: &#934;C31 Integrase Mediated Cassette Exchange (IMCE)

The bacterial chromosome may be used to stably maintain foreign DNA in the mega-base range1. Integration into the chromosome circumvents issues such as plasmid replication, plasmid stability, plasmid incompatibility, and plasmid copy number variance. This method uses the site-specific integrase from the Streptomyces phage (&Phi;) C312,3. The &Phi;C31 integrase catalyzes a direct recombination between two specific DNA sites: attB and attP (34 and 39 bp, respectively)4. This recombination is stable and does not revert5. A "landing pad" (LP) sequence consisting of a spectinomycin- resistance gene, aadA (SpR), and the E. coli &szlig;-glucuronidase gene (uidA) flanked by attP sites has been integrated into the chromosomes of Sinorhizobium meliloti, Ochrobactrum anthropi, and Agrobacterium tumefaciens in an intergenic region, the ampC locus, and the tetA locus, respectively. S. meliloti is used in this protocol. Mobilizable donor vectors containing attB sites flanking a stuffer red fluorescent protein (rfp) gene and an antibiotic resistance gene have also been constructed. In this example the gentamicin resistant plasmid pJH110 is used. The rfp gene6 may be replaced with a desired construct using SphI and PstI. Alternatively a synthetic construct flanked by attB sites may be sub-cloned into a mobilizable vector such as pK19mob7. The expression of the &Phi;C31 integrase gene (cloned from pHS628) is driven by the lac promoter, on a mobilizable broad host range plasmid pRK78139.
A tetraparental mating protocol is used to transfer the donor cassette into the LP strain thereby replacing the markers in the LP sequence with the donor cassette. These cells are trans-integrants. Trans-integrants are formed with a typical efficiency of 0.5%. Trans-integrants are typically found within the first 500-1,000 colonies screened by antibiotic sensitivity or blue-white screening using 5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid (X-gluc). This protocol contains the mating and selection procedures for creating and isolating trans-integrants.

A quick and efficient method to integrate foreign DNA of interest into pre-made acceptor strains, termed landing pad strains, is described. The method allows site-specific integration of a DNA cassette into the engineered landing pad locus of a given strain, through conjugation and expression of the &#934;C31 integrase.

The bacterial chromosome may be used to stably maintain foreign DNA in the mega-base range1. Integration into the chromosome circumvents issues such as ...

Bioengineering

High-Resolution Comparison of Bacterial Conjugation Frequencies

Bacterial conjugation is an important step in the horizontal transfer of antibiotic resistance genes via a conjugative DNA element. In-depth comparisons of conjugation frequency under different conditions are required to understand how the conjugative element spreads in nature. However, conventional methods for comparing conjugation frequency are not appropriate for in-depth comparisons because of the high background caused by the occurrence of additional conjugation events on the selective plate. We successfully reduced the background by introducing a most probable number (MPN) method and a higher concentration of antibiotics to prevent further conjugation in selective liquid medium. In addition, we developed a protocol for estimating the probability of how often donor cells initiate conjugation by sorting single donor cells into recipient pools by fluorescence-activated cell sorting (FACS). Using two plasmids, pBP136 and pCAR1, the differences in conjugation frequency in Pseudomonas putida cells could be detected in liquid medium at different stirring rates. The frequencies of conjugation initiation were higher for pBP136 than for pCAR1. Using these results, we can better understand the conjugation features in these two plasmids.

With an aim to understand the behaviors of various bacterial conjugative DNA elements under different conditions, we describe a protocol for detecting differences in conjugation frequency, with high resolution, to estimate how efficiently the donor bacterium initiates conjugation.

Bacterial conjugation is an important step in the horizontal transfer of antibiotic resistance genes via a conjugative DNA element. In-depth comparisons ...

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below outlines a method for high efficiency transfer between bacterial strains of a plasmid harboring a transposon containing a kanamycin resistance marker. The plasmid-borne transposase is encoded by a variant tnp gene that inserts the transposon into the genome of the recipient strain with very low insertional bias. This method thus allows the creation of large mutant libraries in which transposons have been inserted into unique genomic positions in a recipient strain of either Escherichia coli or Shigella flexneri bacteria. By using bacterial conjugation, as opposed to other methods such as electroporation or chemical transformation, large libraries with hundreds of thousands of unique clones can be created. This yields high-density insertion libraries, with insertions occurring as frequently as every 4-6 base pairs in non-essential genes. This method is superior to other methods as it allows for an inexpensive, easy to use, and high efficiency method for the creation of a dense transposon insertion library. The transposon library can be used in downstream applications such as transposon sequencing (Tn-Seq), to infer genetic interaction networks, or more simply, in mutational (forward genetic) screens.

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Presented here is a simple method for creating a high-density transposon insertion library in Escherichia coli or Shigella flexneri using bacterial conjugation. This protocol allows the creation of a collection of hundreds of thousands of unique mutants in bacteria by the random genomic insertion of a transposon.

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below ...

Immunology and Infection

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

Biology

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can be generated using a transposome. The commercially available, Tn5-derived transposome used in this protocol consists of a linear segment of DNA containing an R6K&#947; replication origin, a gene for kanamycin resistance and two mosaic sequence ends, which serve as transposase binding sites. The transposome, provided as a DNA/transposase protein complex, is introduced by electroporation into the prototrophic strain, Enterobacter sp. YSU, and randomly incorporates itself into this host&#8217;s genome. Transformants are replica plated onto Luria-Bertani agar plates containing kanamycin, (LB-kan) and onto M-9 medium agar plates containing kanamycin (M-9-kan). The transformants that grow on LB-kan plates but not on M-9-kan plates are considered to be auxotrophs. Purified genomic DNA from an auxotroph is partially digested, ligated and transformed into a pir+ Escherichia coli (E. coli) strain. The R6K&#947; replication origin allows the plasmid to replicate in pir+ E. coli strains, and the kanamycin resistance marker allows for plasmid selection. Each transformant possesses a new plasmid containing the transposon flanked by the interrupted chromosomal region. Sanger sequencing and the Basic Local Alignment Search Tool (BLAST) suggest a putative identity of the interrupted gene. There are three advantages to using this transposome mutagenesis strategy. First, it does not rely on the expression of a transposase gene by the host. Second, the transposome is introduced into the target host by electroporation, rather than by conjugation or by transduction and therefore is more efficient. Third, the R6K&#947; replication origin makes it easy to identify the mutated gene which is partially recovered in a recombinant plasmid. This technique can be used to investigate the genes involved in other characteristics of Enterobacter sp. YSU or of a wider variety of bacterial strains.

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Enterobacter sp. YSU grows in glucose minimal salts medium. Auxotrophs are generated by transforming it with a transposome which randomly inserts itself into the host genome. Mutants are found by replica plating from complex medium to minimal medium. Interrupted genes are identified by gene rescue and sequencing.

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can ...

Generating Transposon Insertion Libraries in Gram-Negative Bacteria for High-Throughput Sequencing

Transposon sequencing (Tn-seq) is a powerful method that combines transposon mutagenesis and massive parallel sequencing to identify genes and pathways that contribute to bacterial fitness under a wide range of environmental conditions. Tn-seq applications are extensive and have not only enabled examination of genotype-phenotype relationships at an organism level but also at the population, community and systems levels. Gram-negative bacteria are highly associated with antimicrobial resistance phenotypes, which has increased incidents of antibiotic treatment failure. Antimicrobial resistance is defined as bacterial growth in the presence of otherwise lethal antibiotics. The &#8220;last-line&#8221; antimicrobial colistin is used to treat Gram-negative bacterial infections. However, several Gram-negative pathogens, including Acinetobacter baumannii can develop colistin resistance through a range of molecular mechanisms, some of which were characterized using Tn-seq. Furthermore, signal transduction pathways that regulate colistin resistance vary within Gram-negative bacteria. Here we propose an efficient method of transposon mutagenesis in A. baumannii that streamlines generation of a saturating transposon insertion library and amplicon library construction by eliminating the need for restriction enzymes, adapter ligation, and gel purification. The methods described herein will enable in-depth analysis of molecular determinants that contribute to A. baumannii fitness when challenged with colistin. The protocol is also applicable to other Gram-negative ESKAPE pathogens, which are primarily associated with drug resistant hospital-acquired infections.

We describe a method to generate saturating transposon mutant libraries in Gram-negative bacteria and subsequent preparation of DNA amplicon libraries for high-throughput sequencing. As an example, we focus on the ESKAPE pathogen, Acinetobacter baumannii, but this protocol is amenable to a wide range of Gram-negative organisms.

Transposon sequencing (Tn-seq) is a powerful method that combines transposon mutagenesis and massive parallel sequencing to identify genes and pathways ...

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

Inferring the function of genes by manipulating their activity is an essential tool for understanding the genetic underpinnings of most biological processes. Advances in molecular microbiology have seen the emergence of diverse mutagenesis techniques for the manipulation of genes. Among them, transposon-insertion sequencing (Tn-seq) is a valuable tool to simultaneously assess the functionality of many candidate genes in an untargeted way. The technique has been key to identify&#160;molecular mechanisms for the colonization of eukaryotic hosts in several pathogenic microbes and a few beneficial symbionts.
Here, Tn-seq is established as a method to identify colonization factors in a mutualistic Burkholderia gladioli symbiont of the beetle Lagria villosa. By conjugation, Tn5 transposon-mediated insertion of an antibiotic-resistance cassette is&#160;carried out at random genomic locations in B. gladioli. To identify the effect of gene disruptions on the ability of the bacteria to colonize the beetle host, the generated B. gladioli transposon-mutant library is inoculated on the beetle eggs, while a control is grown in vitro in a liquid culture medium. After allowing sufficient time for colonization, DNA is extracted from the in vivo and in vitro grown libraries. Following a DNA library preparation protocol, the DNA samples are prepared for transposon-insertion sequencing. DNA fragments that contain the transposon-insert edge and flanking bacterial DNA are selected, and the mutation sites are determined by sequencing away from the transposon-insert edge. Finally, by analyzing and comparing the frequencies of each mutant between the in vivo and in vitro libraries, the importance of specific symbiont genes during beetle colonization can be predicted.

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

This is an adapted method for identifying candidate insect colonization factors in a Burkholderia beneficial symbiont. The beetle host is infected with a random mutant library generated via transposon mutagenesis, and library complexity after colonization is compared to a control grown in vitro.

Inferring the function of genes by manipulating their activity is an essential tool for understanding the genetic underpinnings of most biological ...

Real-Time Quantification of the Effects of IS200/IS605 Family-Associated TnpB on Transposon Activity

Here, a protocol is outlined to perform live, real-time imaging of transposable element activity in live bacterial cells using a suite of fluorescent reporters coupled to transposition. In particular, it demonstrates how real-time imaging can be used to assess the effects of the accessory protein TnpB on the activity of the transposable element IS608, a member of the IS200/IS605 family of transposable elements. The IS200/IS605 family of transposable elements are abundant mobile elements connected with one of the most innumerable genes found in nature, tnpB. Sequence homologies propose that the TnpB protein may be an evolutionary precursor to CRISPR/Cas9 systems. Additionally, TnpB has received renewed interest, having been shown to act as a Cas-like RNA-guided DNA endonuclease. The effects of TnpB on the transposition rates of IS608 are quantified, and it is demonstrated that the expression of TnpB of IS608 results in ~5x increased transposon activity compared to cells lacking TnpB expression.

A protocol is outlined to perform live real-time imaging to quantify how the accessory protein TnpB affects the dynamics of transposition in individual live Escherichia coli cells.

Here, a protocol is outlined to perform live, real-time imaging of transposable element activity in live bacterial cells using a suite of fluorescent ...

Overview of Transposition and Recombination

Transposons make up a significant part of genomes of various organisms. Therefore, it is believed that transposition played a major evolutionary role in speciation by changing genome sizes and modifying gene expression patterns. For example, in bacteria, transposition can lead to conferring antibiotic resistance. Movement of transposable elements within the genetic pool of pathogenic bacteria can aid in transfer of antibiotic-resistant genetic elements. In eukaryotes, transposons can carry out regulatory roles by controlling target gene expression under certain physiological conditions, such as stress. In fact, regulation of genes by transposons in response to stress has been widely studied in plants.
Plant genomes provide an excellent model for the study of transposition. The discovery of transposons was made by Barbara McClintock while she was looking into maize cells with broken chromosomes. She discovered that transposition of genetic elements from broken chromosomes causes the color variegation in maize.
Because of the deleterious effects of transposition, transposons rarely move. The frequency of transposition has been correlated with the sequence specifications and structural motifs at the donor and target sites. This low frequency of transposition implies that genetic selection is required to detect the outcomes of transposition. One such outcome, directly dependent on transposition frequency is the presence of white patches on the flowers of Snapdragon plants.

Transposons, Transposition and Recombination

Transposons make up a significant part of genomes of various organisms. Therefore, it is believed that transposition played a major evolutionary role in ...

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Samenvatting

Meer video's verkennen