The authors were funded by grants from the Novo Nordisk Foundation, the Lundbeck Foundation, and the Danish National Research Foundation (DNRF120) through the Center for Bacterial Stress Response and Persistence (BASP).

1. Collection of the Transposon Library
NOTE: The chromosomal DARS2 locus was cloned into the mini Tn10-based transposon, NKBOR (on pNKBOR)21, resulting in NKBOR::DARS2 (pJFM1). pNKBOR can be obtained online22. pNKBOR is a R6K-based suicide vector that requires the initiator protein &#960; for replication23. Plasmid pJFM1 is therefore able to replicate in an E. coli strain (e.g., Dh5&#945; &#955; pir) containing a chromosomal copy of the pir gene. However, when pJFM1 is transformed into the Pir-deficient wildtype MG1655, pJFM1 cannot replicate, leading to the selection of kanamycin-resistant clones generated by the random insertions of NKBOR::DARS2 into the bacterial chromosome. For simplicity, these are referred to as DARS2 insertions. See Figure 1 for a schematic presentation of the methodology.
<ol>
	<li>Prepare electrocompetent MG1655 &#916;DARS2 from actively growing cells in Lysogeny broth (LB) grown at 37 &#176;C24.</li>
	<li>Electroporate pJFM1 into electrocompetent MG1655 &#916;DARS2, according to Gonzales et al.24
	<ol>
		<li>Add 1 &#181;g of pJFM1 (in 1 &#181;L of water) to 40 &#181;L of electrocompetent E. coli MG1655 &#916;DARS2 and transfer this mixture to a pre-chilled, sterile 0.2-cm gap cuvette. Insert the cuvette into the electroporation chamber. Electroporate at 18 kV, 500 &#937;, and 25 &#181;F; the time constant should be ~5.0 ms, and no arcing should occur.</li>
		<li>Quickly recover the bacterial suspension by resuspending it in 1 mL of pre-warmed LB broth and transfer to a 15 mL test tube.</li>
		<li>Let the cells recover by incubating under aerated growth conditions at 37 &#176;C for 30 min, without antibiotic selection. Plate the bacteria onto LB agar plates supplemented with 50&#181;g/mL kanamycin and incubate at 37 &#176;C overnight.</li>
	</ol>
	</li>
	<li>Count the colonies from the electroporation: one colony is considered equal to one chromosomal transposon insertion. 
	NOTE: Colonies can be counted by eye or with a colony counter. The number of colonies is inversely proportional to the average distance separating the transposons located in the chromosome of each clone.</li>
	<li>Add 1 mL of LB broth to each plate and wash off all colonies; 1 mL of LB broth should be sufficient to wash off ~100,000 colonies. Re-use the same 1 mL of LB broth to increase the bacterial concentration. Pool all colonies in the same 50 mL tube.</li>
	<li>Vortex the tube and freeze the start material (t = 0). To freeze it, mix 1 mL of cell suspension with 1 mL of 50% glycerol on ice. Transfer the tubes to dry ice for 10 min. Once the cultures are frozen, transfer them to a -80 &#176;C freezer. 
	NOTE: A cell concentration of a minimum of 50,000 CFU/mL is expected at this step.</li>
</ol>
2. Competition Experiment in LB
<ol>
	<li>Thaw the transposon library from -80 &#176;C on ice. Mix by pipetting.</li>
	<li>Transfer 100 &#181;L of the transposon library to 10 mL of LB in a 15 mL test tube.</li>
	<li>Grow the cells, aerated by continuous shaking (250 rpm), for 8 h at 37 &#176;C to stationary phase (i.e., OD600 = ~4.0). Adjust these parameters to different growth conditions, as desired.</li>
	<li>Propagate the bacterial population by continuous transfers into fresh prewarmed medium every ~10 generations. Do this by transferring 10 &#181;L of the previous stationary phase culture to 10 mL of fresh LB and growing for another 8 h to the stationary phase (i.e., OD600 = ~4.0). 
	NOTE: As the start and end optical density are the same, a 1,000-fold dilution corresponds to ~10 generations of growth (210 = 1,024). The bacterial population can either be propagated directly into fresh prewarmed medium or saved at 0-4 &#176;C (on ice) and propagated the following day. LB was used here to ensure as many cellular doublings in as short a time as possible (a doubling time close to 22 min).</li>
	<li>After each 100 generations of competition, save five 1-mL samples at -80 &#176;C (as described in step 3.3).</li>
	<li>If the fitness differences between cells containing individual transposon insertions are expected to be small, keep the duration of competition long; here, 700 generations (t = 700) were used.</li>
</ol>
3. Southern Blot Analysis to Monitor the Competition Experiment Over Time
<ol>
	<li>Prepare the probe for the Southern blot (1-kb section of the NKBOR) by performing polymerase chain reaction (PCR) amplification using specific primers: NKBOR_Probe_FW: gatgttggacgagtcggaat and NKBOR_Probe_RV: cgttacatccctggcttgtt.
	<ol>
		<li>Incubate at 98 &#176;C for 30 s for initial denaturation. Then, perform 35 cycles at 98 &#176;C for 10 s, 60 &#176;C for 30 s, and 72 &#176;C for 45 s. For the final extension, use 72 &#176;C for 10 min. 
		NOTE: The template for the PCR reaction was a purified pNKBOR plasmid21.</li>
		<li>Label the resultant PCR fragment with [&#945;-32P]dATP using the random primer system, according to Smith25.</li>
	</ol>
	</li>
	<li>Prepare the total cellular DNA according to L&#248;bner-Olesen and von Freiesleben26 for t = 0 and selected time points until t = 700 estimated generations of competition.</li>
	<li>Digest the total cellular DNA with PvuI, which cuts the NKBOR containing the region of interest once only in a region not covered by the probe; 1 unit of PvuI can be used to completely digest 1 &#181;g of substrate DNA. 
	NOTE: The probe will recognize fragments containing part of the transposon, along with chromosomal DNA of various lengths, depending on the insertion site.</li>
	<li>Perform a Southern blot using a 0.7% agarose gel according to L&#248;bner-Olesen and von Freiesleben26.</li>
</ol>
4. Identification of the Fittest Clones
<ol>
	<li>Use easy gene walking, as described by Harrison et al.27, to identify DARS2 insertion sites from single clones (isolated on LB plates) after 700 estimated generations of competition; the more bands on the Southern blot, the more isolates are needed to cover all transposon insertions.
	<ol>
		<li>Isolate genomic DNA for PCR template. Spread bacteria on an LB agar plate containing 50 &#181;g/mL kanamycin and incubate at 37 &#176;C overnight. Grow single colonies overnight in LB broth at 37 &#176;C and subsequently transfer 20 &#181;L into 200 &#181;L of autoclaved distilled water (or use DNA purification, as in step 3.2).
		<ol>
			<li>Vortex to mix. Heat the mix at 100 &#176;C for 10 min and centrifuge at max speed for 5 min. Save the cell lysate at -20 &#176;C for future use.</li>
		</ol>
		</li>
		<li>Design three nested primers to anneal within the transposon of choice (see Figure 2 for a graphic representation of the PCR strategy). 
		NOTE: Designing Nested Primers should ensure that Nested Primer 3 lies closest to the known 5&#39; end of the transposon DNA, followed by Nested Primers 2 and 1. The spacing between Nested Primer 3 and the 5&#39; end of the known transposon DNA should be sufficient for a sequence read-through from the known DNA to the unknown DNA (to find the specific chromosomal transposon insertion site). For NKBOR the following nested primers were used: pNKBOR_Nested3_RV: gcagggctttattgattcca, pNKBOR_Nested2_RV: tcagcaacaccttcttcacg, and pNKBOR_Nested1_RV: actttctggctggatgatgg. Random primers containing the recognition sites of known restriction enzymes are also used. To ensure a result, one should use at least two different random primers. The restriction sites for the restriction enzymes (e.g.,Sau3AI and HindIII) should be located at the 3&#39; end and preceded by ten random bases so that 5&#39;-NNNNNNNNNNGATC-3&#39; and 5&#39;-NNNNNNNNNNAAGCTT-3&#39; are the primers containing a Sau3AI site (GATC) and a HindIII site (AAGCTT), respectively, where N = A, T, G, or C.</li>
		<li>Use 200 ng of genomic DNA in a 20 &#181;L PCR reaction. Incubate at 98 &#176;C for 30 s for the initial denaturation. Perform 25 cycles at 98 &#176;C for 30 s, 50 &#176;C for 15 s, and 72 &#176;C for 4 min. For the final extension, use 72 &#176;C for 10 min. Use primer pairs consisting of Nested Primer 1 and one of the random primers.</li>
		<li>Use primer pairs consisting of Nested Primer 2 and the same random primer from the second amplification, using 1 &#181;L of its previous reaction as a template.</li>
		<li>Repeat step 4.1.4 with primer pairs consisting of Nested Primer 3 and the same random primer.</li>
		<li>Run the products from the final PCR reaction on a 1.5% agarose gel and stain with ethidium bromide. Cut out a band in the range 100-800 bp and isolate the DNA using any commercial DNA gel extracting kit according to the manufacturer&#39;s direction. Resuspend the DNA in 15 &#181;L of water. 
		NOTE: Caution. Ethidium bromide is toxic and must be handled with care.</li>
		<li>Sequence the band isolated in the previous step (step 4.1.6), with Nested Primer 3 as the sequencing primer, using Sanger sequencing at a commercial provider.</li>
	</ol>
	</li>
	<li>Perform WGS.
	<ol>
		<li>Perform WGS on the total DNA extracted from selected samples collected during the competition experiment, as described by Frimodt-M&#248;ller et al4.</li>
	</ol>
	</li>
	<li>Perform sequencing analysis.
	<ol>
		<li>Align paired-end reads to 150 Ns contiguous to NKBOR, AF310136.1 1,904&#8230;2,204 using Bowtie228 with an interval between seed substrings (S,1,1.15) and a maximum number of ambiguous characters (L,0,0.9).</li>
		<li>Select the aligned reads and then re-align to both MG1655 ref|NC_000913.3 and NKBOR gb|AF310136 using blastN29</li>
		<li>Assign transposition insertion positions at junctions MG1655-NKBOR.</li>
	</ol>
	</li>
</ol>
5. Flow Cytometry
<ol>
	<li>Collect samples for flow cytometry.
	<ol>
		<li>Balance each culture by maintaining it in the exponential growth phase for at least 10 generations. Check the OD600 and ensure that it never exceeds 0.3.</li>
		<li>Collect two types of flow samples.
		<ol>
			<li>For RIF-runout, transfer 1 mL of culture to a 15 mL tube containing 30 &#181;L of RIF-CEF (300 &#181;g/mL rifampicin and 36 &#181;g/mL cephalexin dissolved in 12.5 mM NaOH). Leave it at 37 &#176;C for a minimum of 4 h of shaking. 
			NOTE: Rifampicin indirectly blocks the initiation of chromosome replication while allowing for ongoing rounds of replication to continue to termination. Cephalexin prevents cell division, which results in replication runout (RIF-runout) and the accumulation of cells with fully replicated chromosomes. The number of fully replicated chromosomes is equal to the number of origins at the time of treatment with rifampicin and cephalexin20.</li>
			<li>For the EXP-sample, transfer 1 mL of exponentially growing culture to a 1.5-mL tube on ice.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Fix THE cells as follows. Harvest the cells by centrifugation at 15,000 x g for 5 min at 4 &#176;C. Resuspend the pellet in 100 &#181;L of ice-cold 10 mM Tris pH 7.5 and add 1 mL of ice-cold 77% ethanol. Store the samples at 4 &#176;C until use.</li>
	<li>Stain the cells as follows. Harvest 100-300 &#181;L of fixed cells by centrifugation at 15,000 x g for 15 min. Remove the supernatant and resuspend the pellet in 130 &#181;L of &#34;DNA Staining solution&#34; (90 &#181;g/mL mithramycin, 20 &#181;g/mL ethidium bromide, 10 mM MgCl2, and 10 mM Tris pH 7.5). Put the samples on ice and in the dark; the samples are ready for flow cytometry analysis after 10 min. 
	NOTE: Other DNA stains than ethidium bromide and mithramycin can also be used30,31.</li>
	<li>Determine the origin per cell, the relative cell mass, and the relative DNA content by flow cytometry analysis.
	<ol>
		<li>Perform flow cytometry, as described previously32. Run RIF-runout and EXP-samples using the flow cytometer manufacturer&#39;s instructions. For mithramycin- and ethidium bromide-stained cells, use excitation wavelengths 395 and 440 nm and collect the fluorescence above 565 nm.
		<ol>
			<li>To determine the relative cell mass and relative DNA content, run the EXP-samples to obtain single-parameter forward-light scatter versus cell number histograms and fluorescence intensity versus cell number histograms for a minimum of 30,000 events corresponding to the cell signal.</li>
			<li>Use forward-scattered light single-parameter distribution to measure the average relative cell mass. 
			NOTE: Forward-scattered light is a measure of the average cell mass20.</li>
			<li>Use fluorescence intensity single-parameter distributions to measure the average DNA content20.</li>
			<li>Obtain the DNA concentration as the ratio of average DNA content to the average cell mass20.</li>
		</ol>
		</li>
		<li>Determine the number of origins per cell.
		<ol>
			<li>Run RIF-runout samples to obtain single-parameter fluorescence intensity versus cell number histograms for a minimum of 30,000 events corresponding to the cell signal.</li>
			<li>Use fluorescence intensity single-parameter distributions to determine the number of chromosomes in each cell20.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Calculate the asynchrony index (Ai).
	<ol>
		<li>Calculate the Ai,as described by L&#248;bner-Olesen et al.32, using the fluorescence intensity single parameter distributions of the RIF-runout samples and the formula Ai = (f3 + f5 + f6 + f7) / (f2 + f4 + f8), where fx is the fraction cells with x number of fully replicated chromosomes. Consider initiations asynchronous when A &#62;0.1.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Frimodt-Moller, J., Charbon, G., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+bacterial+chromosome+replication+by+non-coding+regions+outside+the+origin.">Control of bacterial chromosome replication by non-coding regions outside the origin.</a> Curr Genet. , (2016).</li><li>Sherratt, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombination+and+chromosome+segregation.">Recombination and chromosome segregation.</a> Philos Trans R Soc Lond B Biol Sci. 359 (1441), 61-69 (2004).</li><li>Bigot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+motifs+that+control+E.+coli+chromosome+segregation+by+orienting+the+FtsK+translocase.">DNA motifs that control E. coli chromosome segregation by orienting the FtsK translocase.</a> EMBO J. 24 (21), 3770-3780 (2005).</li><li>Frimodt-Moller, J., Charbon, G., Krogfelt, K. A., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Replication+Control+Is+Linked+to+Genomic+Positioning+of+Control+Regions+in+Escherichia+coli.">DNA Replication Control Is Linked to Genomic Positioning of Control Regions in Escherichia coli.</a> PLoS Genet. 12 (9), 1006286 (2016).</li><li>Kornberg, A., Baker, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> DNA Replication, Second Edition. , (1992).</li><li>Kaguni, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+initiation+at+the+Escherichia+coli+chromosomal+origin.">Replication initiation at the Escherichia coli chromosomal origin.</a> Curr Opin Chem Biol. 15 (5), 606-613 (2011).</li><li>Leonard, A. C., Grimwade, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+DnaA+assembly+and+activity:+taking+directions+from+the+genome.">Regulation of DnaA assembly and activity: taking directions from the genome.</a> Annu Rev Microbiol. 65, 19-35 (2011).</li><li>Kurokawa, K., Nishida, S., Emoto, A., Sekimizu, K., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+cycle-coordinated+change+of+the+adenine+nucleotide-bound+forms+of+DnaA+protein+in+Escherichia+coli.">Replication cycle-coordinated change of the adenine nucleotide-bound forms of DnaA protein in Escherichia coli.</a> EMBO J. 18 (23), 6642-6652 (1999).</li><li>Sekimizu, K., Bramhill, D., Kornberg, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATP+activates+dnaA+protein+in+initiating+replication+of+plasmids+bearing+the+origin+of+the+E.+coli+chromosome.">ATP activates dnaA protein in initiating replication of plasmids bearing the origin of the E. coli chromosome.</a> Cell. 50 (2), 259-265 (1987).</li><li>Brendler, T., Austin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+of+SeqA+protein+to+DNA+requires+interaction+between+two+or+more+complexes+bound+to+separate+hemimethylated+GATC+sequences.">Binding of SeqA protein to DNA requires interaction between two or more complexes bound to separate hemimethylated GATC sequences.</a> EMBO J. 18 (8), 2304-2310 (1999).</li><li>Lu, M., Campbell, J. L., Boye, E., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SeqA:+a+negative+modulator+of+replication+initiation+in+E.+coli.">SeqA: a negative modulator of replication initiation in E. coli.</a> Cell. 77 (3), 413-426 (1994).</li><li>Katayama, T., Kubota, T., Kurokawa, K., Crooke, E., Sekimizu, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+initiator+function+of+DnaA+protein+is+negatively+regulated+by+the+sliding+clamp+of+the+E.+coli+chromosomal+replicase.">The initiator function of DnaA protein is negatively regulated by the sliding clamp of the E. coli chromosomal replicase.</a> Cell. 94 (1), 61-71 (1998).</li><li>Kato, J., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hda,+a+novel+DnaA-related+protein,+regulates+the+replication+cycle+in+Escherichia+coli.">Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli.</a> EMBO J. 20 (15), 4253-4262 (2001).</li><li>Kasho, K., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DnaA+binding+locus+datA+promotes+DnaA-ATP+hydrolysis+to+enable+cell+cycle-coordinated+replication+initiation.">DnaA binding locus datA promotes DnaA-ATP hydrolysis to enable cell cycle-coordinated replication initiation.</a> Proc Natl Acad Sci U S A. 110 (3), 936-941 (2013).</li><li>Kitagawa, R., Ozaki, T., Moriya, S., Ogawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negative+control+of+replication+initiation+by+a+novel+chromosomal+locus+exhibiting+exceptional+affinity+for+Escherichia+coli+DnaA+protein.">Negative control of replication initiation by a novel chromosomal locus exhibiting exceptional affinity for Escherichia coli DnaA protein.</a> Genes Dev. 12 (19), 3032-3043 (1998).</li><li>Fujimitsu, K., Senriuchi, T., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+genomic+sequences+of+E.+coli+promote+replicational+initiation+by+directly+reactivating+ADP-DnaA.">Specific genomic sequences of E. coli promote replicational initiation by directly reactivating ADP-DnaA.</a> Genes Dev. 23 (10), 1221-1233 (2009).</li><li>Kasho, K., Fujimitsu, K., Matoba, T., Oshima, T., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timely+binding+of+IHF+and+Fis+to+DARS2+regulates+ATP-DnaA+production+and+replication+initiation.">Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiation.</a> Nucleic Acids Res. 42 (21), 13134-13149 (2014).</li><li>Frimodt-Moller, J., Charbon, G., Krogfelt, K. A., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+regions+for+chromosome+replication+are+conserved+with+respect+to+sequence+and+location+among+Escherichia+coli+strains.">Control regions for chromosome replication are conserved with respect to sequence and location among Escherichia coli strains.</a> Front Microbiol. 6, 1011 (2015).</li><li>Bergthorsson, U., Ochman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+chromosome+length+variation+in+natural+isolates+of+Escherichia+coli.">Distribution of chromosome length variation in natural isolates of Escherichia coli.</a> Mol Biol Evol. 15 (1), 6-16 (1998).</li><li>Boye, E., Steen, H. B., Skarstad, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+of+bacteria:+a+promising+tool+in+experimental+and+clinical+microbiology.">Flow cytometry of bacteria: a promising tool in experimental and clinical microbiology.</a> J Gen Microbiol. 129 (4), 973-980 (1983).</li><li>Rossignol, M., Basset, A., Espeli, O., Boccard, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NKBOR,+a+mini-Tn10-based+transposon+for+random+insertion+in+the+chromosome+of+Gram-negative+bacteria+and+the+rapid+recovery+of+sequences+flanking+the+insertion+sites+in+Escherichia+coli.">NKBOR, a mini-Tn10-based transposon for random insertion in the chromosome of Gram-negative bacteria and the rapid recovery of sequences flanking the insertion sites in Escherichia coli.</a> Res Microbiol. 152 (5), 481-485 (2001).</li><li>Shafferman, A., Helinski, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+properties+of+the+beta+origin+of+replication+of+plasmid+R6K.">Structural properties of the beta origin of replication of plasmid R6K.</a> J Biol Chem. 258 (7), 4083-4090 (1983).</li><li>Gonzales, M. F., Brooks, T., Pukatzki, S. U., Provenzano, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+protocol+for+preparation+of+electrocompetent+Escherichia+coli+and+Vibrio+cholerae.">Rapid protocol for preparation of electrocompetent Escherichia coli and Vibrio cholerae.</a> J Vis Exp. (80), (2013).</li><li>Smith, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+primed+labeling+of+DNA.">Random primed labeling of DNA.</a> Methods Mol Biol. 18, 445-447 (1993).</li><li>Lobner-Olesen, A., von Freiesleben, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+replication+incompatibility+in+Dam+methyltransferase+deficient+Escherichia+coli+cells.">Chromosomal replication incompatibility in Dam methyltransferase deficient Escherichia coli cells.</a> EMBO J. 15 (21), 5999-6008 (1996).</li><li>Harrison, R. W., Miller, J. C., D'Souza, M. J., Kampo, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+gene+walking.">Easy gene walking.</a> Biotechniques. 22 (4), 650-653 (1997).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J Mol Biol. 215 (3), 403-410 (1990).</li><li>Stepankiw, N., Kaidow, A., Boye, E., Bates, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+right+half+of+the+Escherichia+coli+replication+origin+is+not+essential+for+viability,+but+facilitates+multi-forked+replication.">The right half of the Escherichia coli replication origin is not essential for viability, but facilitates multi-forked replication.</a> Mol Microbiol. 74 (2), 467-479 (2009).</li><li>Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+minichromosomes+in+individual+Escherichia+coli+cells:+implications+for+replication+control.">Distribution of minichromosomes in individual Escherichia coli cells: implications for replication control.</a> EMBO J. 18 (6), 1712-1721 (1999).</li><li>Lobner-Olesen, A., Skarstad, K., Hansen, F. G., von Meyenburg, K., Boye, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DnaA+protein+determines+the+initiation+mass+of+Escherichia+coli+K-12.">The DnaA protein determines the initiation mass of Escherichia coli K-12.</a> Cell. 57 (5), 881-889 (1989).</li><li>Carver, T., Thomson, N., Bleasby, A., Berriman, M., Parkhill, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAPlotter:+circular+and+linear+interactive+genome+visualization.">DNAPlotter: circular and linear interactive genome visualization.</a> Bioinformatics. 25 (1), 119-120 (2009).</li><li>Eckert, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrospective+application+of+transposon-directed+insertion+site+sequencing+to+a+library+of+signature-tagged+mini-Tn5Km2+mutants+of+Escherichia+coli+O157:H7+screened+in+cattle.">Retrospective application of transposon-directed insertion site sequencing to a library of signature-tagged mini-Tn5Km2 mutants of Escherichia coli O157:H7 screened in cattle.</a> J Bacteriol. 193 (7), 1771-1776 (2011).</li><li>van Opijnen, T., Bodi, K. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn-seq:+high-throughput+parallel+sequencing+for+fitness+and+genetic+interaction+studies+in+microorganisms.">Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms.</a> Nat Methods. 6 (10), 767-772 (2009).</li><li>van Opijnen, T., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon+insertion+sequencing:+a+new+tool+for+systems-level+analysis+of+microorganisms.">Transposon insertion sequencing: a new tool for systems-level analysis of microorganisms.</a> Nat Rev Microbiol. 11 (7), 435-442 (2013).</li><li>Jeong, H., Lee, S. J., Kim, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Procedure+for+Adaptive+Laboratory+Evolution+of+Microorganisms+Using+a+Chemostat.">Procedure for Adaptive Laboratory Evolution of Microorganisms Using a Chemostat.</a> J Vis Exp. (115), (2016).</li><li>Bryant, J. A., Sellars, L. E., Busby, S. J., Lee, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome+position+effects+on+gene+expression+in+Escherichia+coli+K-12.">Chromosome position effects on gene expression in Escherichia coli K-12.</a> Nucleic Acids Res. 42 (18), 11383-11392 (2014).</li><li>Blattner, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complete+genome+sequence+of+Escherichia+coli+K-12.">The complete genome sequence of Escherichia coli K-12.</a> Science. 277 (5331), 1453-1462 (1997).</li></ol>

The authors have no competing financial interest.

The methodology used here takes advantage of state-of-the-art techniques to answer a difficult question regarding the optimal genomic position of a genetic element. The random insertion of the genetic element (mediated by the transposon) enables the fast and easy collection of thousands of clones, which then can be made to compete against each other to select for the optimal position of the investigated genetic element (i.e., the fittest clone).
Here, DARS2 was inserted into ...

The function of any genetic element can be affected by its location in the genome. In bacteria, this mainly results from interference by the transcription of neighboring genes, local DNA topology, and/or replication-associated gene dosage. In particular, the processes of DNA replication and segregation are controlled, at least in part, by non-coding chromosomal regions1, and the proper function of these regions depends on genomic location/context. In E.coli, examples are the dif site, required for sister chromosome resolution2; KOPS sequences, required for chromosome segregation3; and datA, DARS1, and DARS2 regions, required for proper chromosomal replication control (below; 4). We present a method allowing for the random relocation, selection, and determination of the optimal genetic context of any given genetic element, exemplified here by the study of the DARS2 non-coding region.
In E. coli, DnaA is the initiator protein responsible for DNA strand opening at the single replication origin, oriC, and for the recruitment of the helicase DnaB5,6,7. DnaA belongs to the AAA+ (i.e., ATPases associated with diverse activities) proteins and can bind both ATP and ADP with similar high affinities5. The level of DnaAATP peaks at initiation8, where DnaAATP forms a multimer on oriC that triggers DNA duplex opening9. After initiation, oriC is made temporarily unavailable for re-initiation due to sequestration by a mechanism involving the binding of the SeqA protein to hemimethylated oriC10,11. During sequestration, the level of DnaAATP is reduced by at least two mechanisms: the regulatory inactivation of DnaA (RIDA)12,13 and datA-dependent DnaAATP hydrolysis (DDAH)14,15. Both RIDA and DDAH promote the conversion of DnaAATP to DnaAADP. Prior to a new round of initiation, DnaAADP is re-activated to DnaAATP at specific DnaA-reactivating sequences (DARS): DARS1 and DARS216,17. The chromosomal datA, DARS1,and DARS2 regions are non-coding and act in a chaperone-like manner to modulate DnaAATP/DnaAADP interconversion. These regions, located outside the origin of replication, enable the assembly of a DnaA complex for either the inactivation (datA;14) or activation (DARS1 and DARS2;17) of DnaA. Deleting DARS2 in a cell does not alter mass doubling time but results in asynchronous replication initiation15,16,18. However, DARS2-deficient cells have a fitness cost compared to an otherwise isogenic wildtype during both continuous growth competition in rich medium or during the establishment of colonization in the mouse intestine18. This indicates that even minor changes in asynchrony/origin concentration have a negative effect on bacterial fitness. In E. coli, there is a selective pressure to maintain chromosome symmetry (i.e., two nearly equal length replication arms)19. The datA, DARS1, and DARS2 regions have the same relative distance to oriC in all E. coli strains sequenced18, despite large variations in chromosome size.
Here, we use the DARS2 region of E. coli as an example for the identification of the chromosomal position(s) optimal for its function. DARS2 was inserted into the NKBOR transposon, and the resultant NKBOR::DARS2 transposon subsequently inserted randomly into the genome of MG1655 &#916;DARS2. We thus generated a collection of cells, each possessing DARS2 placed at a different location on the chromosome. An in vitro competition experiment, where all cells in the collection were pooled and competed against each other during continuous growth in LB for an estimated 700 generations, was performed. The outcome of the competition experiment was monitored/determined using Southern blot, easy gene walking, and whole-genome sequencing (WGS; Figure 1). End-point clones resolved by easy gene walking were characterized by flow cytometry to evaluate cell-cycle parameters. In a flow cytometric analysis, cell size, DNA content, and initiation synchrony can be measured for a large number of cells. During flow cytometry, a flow of single cells passes a light beam of the appropriate wavelength to excite the stained DNA, which is then simultaneously registered by photomultipliers that collect the emitted fluorescence, a measure of DNA content, provided the cells are stained for DNA. The forward-scattered light is a measure of cell mass20.
The in vitro competition experiment we present here is used to address questions relating to the importance of the chromosomal position and genomic context of the genetic element. The method is unbiased and easy to use.

<table width="819">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">Autoclaved Mili-Q water</td>
			<td style="width:164px;"></td>
			<td style="width:119px;">None</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">Electroporation Cuvettes, 0.1 cm</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">P41050</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">Bio-Rad MicroPulser Electroporation System</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:119px;">165-2100</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">LB Broth</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">12780029&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">LB Agar, powder (Lennox L agar)</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">22700025</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">Glycerol</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">17904</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Fisherbrand&#160;Plastic Petri Dishes</td>
			<td style="width:164px;">Fisher Scientific</td>
			<td style="width:119px;">S33580A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Falcon 50mL Conical Centrifuge Tubes</td>
			<td style="width:164px;">Fisher Scientific</td>
			<td style="width:119px;">14-432-22</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Falcon 15mL Conical Centrifuge Tubes</td>
			<td style="width:164px;">Fisher Scientific</td>
			<td style="width:119px;">14-959-53A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Nunc&#160;CryoTubes</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">V7634&#160;</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">Phusion High-Fidelity DNA Polymerase (2 U/&#181;L)</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">F530S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">dATP, [&#945;-32P]- 3000Ci/mmol 10mCi/ml, 250 &#181;Ci</td>
			<td style="width:164px;">PerkinElmer</td>
			<td style="width:119px;">BLU012H250UC</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">DECAprime II DNA Labeling Kit</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">AM1455</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="width:369px;height:20px;">Spectrophotometer&#160; SF/MBV/03.32</td>
			<td style="width:164px;">Pharmacia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Hermle Centrifuge&#160;&#160;&#160; SF/MBV/03.46</td>
			<td style="width:164px;">Hermle</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Ole Dich Centrifuge&#160; SF/MBV/03.29</td>
			<td style="width:164px;">Ole Dich</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Eppendorftubes 1.5 mL</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">T9661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Eppendorftubes 2.0 mL</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">T2795</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Chloride</td>
			<td>Merck</td>
			<td>6404</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">96% Ethanol</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">16368</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Trizma HCl</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">T-3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Phenol Ultra Pure</td>
			<td>BRL</td>
			<td>5509UA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Chloroform</td>
			<td>Merck</td>
			<td>2445</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Ribonuclease A type II A</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td>R5000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Sodiumdodecylsulphate (SDS)</td>
			<td>Merck</td>
			<td>13760</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Lysozyme</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td>L 6876</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Isopropanol</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td>405-7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">0.5M Na-EDTA pH 8.0</td>
			<td>BRL</td>
			<td>5575 UA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Kanamycin sulfate</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">10106801001</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">PvuI (10 U/&#181;L)</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">ER0621</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">UltraPure Agarose</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">16500500</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="width:369px;height:42px;">DNA Gel Loading Dye (6X)</td>
			<td style="width:164px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">R0611</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Tris-Borate-EDTA buffer</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">T4415</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Ethidium bromide</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">E7637</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Hydrochloric acid</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">433160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Sodium Hydroxide</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">71687</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Whatman&#160;3MM papers</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">WHA3030931</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">SSC Buffer 20&#215; Concentrate</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">S6639</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Amersham Hybond-N+</td>
			<td style="width:164px;">GE Healthcare</td>
			<td style="width:119px;">RPN119B</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Ficoll&#160;400</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">F8016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Polyvinylpyrrolidone</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">PVP40</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Bovine Serum Albumin - Fraction V</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">85040C</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Deoxyribonucleic acid sodium salt from salmon testes</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">D1626</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Carestream Kodak &#160;BioMax &#160;light film</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">Z373494</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">GenElute &#160;Gel Extraction Kit</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">NA1111&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">GenElute &#160;PCR Clean-Up Kit</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">NA1020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">T100&#160; Thermal Cycler</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">SmartSpec Plus Spectrophotometer</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Rifampicin</td>
			<td style="width:164px;">Serva</td>
			<td style="width:119px;">34514.01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Cephalexin</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">C4895</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Mithramycin</td>
			<td style="width:164px;">Serva</td>
			<td>29803.02</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Magnesium chloride hexahydrate</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:119px;">246964</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:369px;height:21px;">Apogee A10 instrument</td>
			<td style="width:164px;">Apogee</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

determination of the optimal chromosomal location(s) for a dna element in escherichia coli using a novel transposon-mediated approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

A Southern blot was done to verify that DARS2 was distributed randomly throughout the chromosome in the transposon library (t = 0) and that the fittest clones would persist over time. The Southern blot was performed on DNA extracted from the initial transposon pool (at t = 0) and every estimated 100 out of 700 generations of competition (Figure 3). Here, the total cellular DNA from each time-point was digested with the PvuI restriction enzym...

Watch this Scientific Journal Video about Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach at JoVE.com

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

determination-optimal-chromosomal-location-s-for-dna-element

Research

JoVE Journal

Genetics

7.5K Views.  University of Copenhagen. Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

Video: Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. To assess the impact of PM on nuclear genetic integrity, structural chromosomal aberrations are scored in the metaphase spreads of mouse RAW264.7 macrophage cells. PM is collected from ambient air with a high volume total suspended particles sampler. The collected material is solubilized and filtered to retain the water-soluble, fine portion. The particles are characterized for chemical composition by nuclear magnetic resonance (NMR) spectroscopy. Different concentrations of particle suspension are added onto an in vitro culture of RAW264.7 mouse macrophages for a total exposure time of 72 hr, along with untreated control cells. At the end of exposure, the culture is treated with colcemid to arrest cells in metaphase. Cells are then harvested, treated with hypotonic solution, fixed in acetomethanol, dropped onto glass slides and finally stained with Giemsa solution. Slides are examined to assess the structural chromosomal aberrations (CAs) in metaphase spreads at 1,000X magnification using a bright-field microscope. 50 to 100 metaphase spread are scored for each treatment group. This technique is adapted for the detection of structural chromosomal aberrations (CAs), such as chromatid-type breaks, chromatid-type exchanges, acentric fragments, dicentric and ring chromosomes, double minutes, endoreduplication, and Robertsonian translocations in vitro after exposure to PM. It is a powerful method to associate a well-established cytogenetic endpoint to epigenetic alterations.

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

This protocol describes techniques for the quantification and characterization of chromosomal aberrations in vitro in RAW264.7 mouse macrophages after treatment with ambient air particulate matter.

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. ...

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and microbial populations. Traditional methods for assessing genetic heterogeneity have been limited by low resolution, low sensitivity, and/or low specificity. Single cell sequencing has emerged as a powerful tool for detecting genetic heterogeneity with high resolution, high sensitivity and, when appropriately analyzed, high specificity. Here we provide a protocol for the isolation, whole genome amplification, sequencing, and analysis of single cells. Our approach allows for the reliable identification of megabase-scale copy number variants in single cells. However, aspects of this protocol can also be applied to investigate other types of genetic alterations in single cells.

Single cell sequencing is an increasingly popular and accessible tool for addressing genomic changes at high resolution. We provide a protocol that uses single cell sequencing to identify copy number alterations in single cells.

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Genome-wide Determination of Mammalian Replication Timing by DNA Content Measurement

Replication of the genome occurs during S phase of the cell cycle in a highly regulated process that ensures the fidelity of DNA duplication. Each genomic region is replicated at a distinct time during S phase through the simultaneous activation of multiple origins of replication. Time of replication (ToR) correlates with many genomic and epigenetic features and is linked to mutation rates and cancer. Comprehending the full genomic view of the replication program, in health and disease is a major future goal and challenge.
This article describes in detail the &#34;Copy Number Ratio of S/G1 for mapping genomic Time of Replication&#34; method (herein called: CNR-ToR), a simple approach to map the genome wide ToR of mammalian cells. The method is based on the copy number differences between S phase cells and G1 phase cells. The CNR-ToR method is performed in 6 steps: 1. Preparation of cells and staining with propidium iodide (PI); 2. Sorting G1 and S phase cells using fluorescence-activated cell sorting (FACS); 3. DNA purification; 4. Sonication; 5. Library preparation and sequencing; and 6. Bioinformatic analysis. The CNR-ToR method is a fast and easy approach that results in detailed replication maps.

We describe here a relatively fast and simple approach for mapping genome-wide mammalian replication timing, from cell isolation to the basic analysis of the sequencing results. A genomic map of a representative replication program will be provided following the protocol.

Replication of the genome occurs during S phase of the cell cycle in a highly regulated process that ensures the fidelity of DNA duplication. Each genomic ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

This article demonstrates a detailed protocol for DNA isolation and high-throughput sequencing library construction from herbarium material including rescue of exceptionally poor-quality DNA.

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to control gene expression. These regulatory proteins control gene expression either at the level of DNA (transcription) or at the level of RNA (pre-mRNA splicing, polyadenylation, mRNA transport, decay, and translation). Identification of regulatory sequences helps understand not only how a gene is switched on or off, but also which downstream genes are regulated by a particular regulatory protein. Here, we describe a one-step approach that allows saturation mutagenesis of a protein binding site in RNA. It involves doping DNA template with non-wild-type nucleotides within the binding site, synthesis of separate RNAs with each phosphorothioate nucleotide, and isolation of the bound fraction following incubation with protein. Interference from non-wild-type nucleotides results in their preferential exclusion from the protein-bound fraction. This is monitored by gel electrophoresis following selective chemical cleavage with iodine of phosphodiester bonds containing phosphorothioates (phosphorothioate mutagenesis or PTM). This single-step saturation mutagenesis approach is applicable to the characterization of any protein binding site in RNA.

Proteins that bind specific RNA sequences play critical roles in gene expression. Detailed characterization of these binding sites is crucial for our understanding of gene regulation. Here, a single-step approach for saturation mutagenesis of protein-binding sites in RNA is described. This approach is relevant for all protein-binding sites in RNA.

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol for transferring gene deletion mutations from one Escherichia coli strain to another by using generalized transduction with the bacteriophage P1. This method requires that the mutation be selectable (e.g., based on gene disruptions using antibiotic cassette insertions). Such antibiotic cassettes can be mobilized from a donor strain and introduced into a recipient strain of interest to quickly and easily generate a gene deletion mutant. The antibiotic cassette can be designed to include flippase recognition sites that allow the excision of the cassette by a site-specific recombinase to produce a clean knock-out with only a ~100-base-pair-long scar sequence in the genome. We demonstrate the protocol by knocking out the tamA gene encoding an assembly factor involved in autotransporter biogenesis and test the effect of this knock-out on the biogenesis and function of two trimeric autotransporter adhesins. Though gene deletion by P1 transduction has its limitations, the ease and speed of its implementation make it an attractive alternative to other methods of gene deletion.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol ...

Using In Vitro and In-cell SHAPE to Investigate Small Molecule Induced Pre-mRNA Structural Changes

In the process of drug development of RNA-targeting small molecules, elucidating the structural changes upon their interactions with target RNA sequences is desired. We herein provide a detailed in vitro and in-cell selective 2&#39;-hydroxyl acylation analyzed by primer extension (SHAPE) protocol to study the RNA structural change in the presence of an experimental drug for spinal muscular atrophy (SMA), survival of motor neuron (SMN)-C2, and in exon 7 of the pre-mRNA of the SMN2 gene. In in vitro SHAPE, an RNA sequence of 140 nucleotides containing SMN2 exon 7 is transcribed by T7 RNA polymerase, folded in the presence of SMN-C2, and subsequently modified by a mild 2&#39;-OH acylation reagent, 2-methylnicotinic acid imidazolide (NAI). This 2&#39;-OH-NAI adduct is further probed by a 32P-labeled primer extension and resolved by polyacrylamide gel electrophoresis (PAGE). Conversely, 2&#39;-OH acylation in in-cell SHAPE takes place in situ with SMN-C2 bound cellular RNA in living cells. The pre-mRNA sequence of exon 7 in the SMN2 gene, along with SHAPE-induced mutations in the primer extension, was then amplified by PCR and subject to next-generation sequencing. Comparing the two methodologies, in vitro SHAPE is a more cost-effective method and does not require computational power to visualize results. However, the in vitro SHAPE-derived RNA model sometimes deviates from the secondary structure in a cellular context, likely due to the loss of all interactions with RNA-binding proteins. In-cell SHAPE does not need a radioactive material workplace and yields a more accurate RNA secondary structure in the cellular context. Furthermore, in-cell SHAPE is usually applicable for a larger range of RNA sequences (~1,000 nucleotides) by utilizing next-generation sequencing, compared to in vitro SHAPE (~200 nucleotides) that usually relies on PAGE analysis. In case of exon 7 in SMN2 pre-mRNA, the in vitro and in-cell SHAPE derived RNA models are similar to each other.

Detailed protocols for both in vitro and in-cell selective 2&#39;-hydroxyl acylation analyzed by primer extension (SHAPE) experiments to determine the secondary structure of pre-mRNA sequences of interest in the presence of an RNA-targeting small molecule are presented in this article.

In the process of drug development of RNA-targeting small molecules, elucidating the structural changes upon their interactions with target RNA sequences ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for reversible and tunable expression control of an endogenous gene of interest in living model systems. The REMOTE-control system employs enhanced lac repression and tet activation systems to achieve down- or upregulation of a target gene within a single biological system. Tight repression can be achieved from repressor binding sites flexibly located far downstream of a transcription start site by inhibiting transcription elongation. Robust upregulation can be attained by enhancing the transcription of an endogenous gene by targeting tet transcriptional activators to the cognate promoter. This reversible and tunable expression control can be applied and withdrawn repeatedly in organisms. The potency and versatility of the system, as demonstrated for endogenous Dnmt1 here, will allow more precise in vivo functional analyses by enabling investigation of gene function at various expression levels and by testing the reversibility of a phenotype.

This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Mass Spectrometry-Based Proteomics Analyses Using the OpenProt Database to Unveil Novel Proteins Translated from Non-Canonical Open Reading Frames

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame (ORF) annotation impose two arbitrary criteria: a minimum length of 100 codons and a single ORF per transcript. However, a growing number of studies report expression of proteins from allegedly non-coding regions, challenging the accuracy of current genome annotations. These novel proteins were found encoded either within non-coding RNAs, 5' or 3' untranslated regions (UTRs) of mRNAs, or overlapping a known coding sequence (CDS) in an alternative ORF. OpenProt is the first database that enforces a polycistronic model for eukaryotic genomes, allowing annotation of multiple ORFs per transcript. OpenProt is freely accessible and offers custom downloads of protein sequences across 10 species. Using OpenProt database for proteomic experiments enables novel proteins discovery and highlights the polycistronic nature of eukaryotic genes. The size of OpenProt database (all predicted proteins) is substantial and need be taken in account for the analysis. However, with appropriate false discovery rate (FDR) settings or the use of a restricted OpenProt database, users will gain a more realistic view of the proteomic landscape. Overall, OpenProt is a freely available tool that will foster proteomic discoveries.

OpenProt is a freely accessible database that enforces a polycistronic model of eukaryotic genomes. Here, we present a protocol for the use of OpenProt databases when interrogating mass spectrometry datasets. Using OpenProt database for analysis of proteomic experiments allows for discovery of novel and previously undetectable proteins.

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame ...

Use of Frozen Tissue in the Comet Assay for the Evaluation of DNA Damage

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other environmental stressors. Use of the comet assay in regulatory testing for genotoxic potential in rodents has been driven by adoption of an Organisation for Economic Co-operation and Development (OECD) test guideline in 2014. Comet assay slides are typically prepared from fresh tissue at the time of necropsy; however, freezing tissue samples can avoid logistical challenges associated with simultaneous preparation of slides from multiple organs per animal and from many animals per study. Freezing also enables shipping samples from the exposure facility to a different laboratory for analysis, and storage of frozen tissue facilitates deferring a decision to generate DNA damage data for a given organ. The alkaline comet assay is useful for detecting exposure-related DNA double- and single-strand breaks, alkali-labile lesions, and strand breaks associated with incomplete DNA excision repair. However, DNA damage can also result from mechanical shearing or improper sample processing procedures, confounding the results of the assay. Reproducibility in collection and processing of tissue samples during necropsies may be difficult to control due to fluctuating laboratory personnel with varying levels of experience in harvesting tissues for the comet assay. Enhancing consistency through refresher training or deployment of mobile units staffed with experienced laboratory personnel is costly and may not always be feasible. To optimize consistent generation of high quality samples for comet assay analysis, a method for homogenizing flash frozen cubes of tissue using a customized tissue mincing device was evaluated. Samples prepared for the comet assay by this method compared favorably in quality to fresh and frozen tissue samples prepared by mincing during necropsy. Moreover, low baseline DNA damage was measured in cells from frozen cubes of tissue following prolonged storage.

This protocol describes several procedures for preparing high quality frozen tissue samples at the time of necropsy for use in the comet assay to assess DNA damage: 1) minced tissue, 2) scraped epithelial cells from the gastrointestinal tract, and 3) cubed tissue samples, requiring homogenization using a tissue mincing device.

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other ...