Name: determination of the optimal chromosomal location(s) for a dna element in escherichia coli using a novel transposon-mediated approach
Uploaded: 2017-09-11T13:00:00.000+00:00
Duration: 11 min 12 s
Description: Watch this Scientific Journal Video about Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach at JoVE.com

저자는 세균성 긴장 응답 및 지 속성 (BASP) Novo Nordisk 기초, Lundbeck 재단 그리고 센터를 통해 덴마크 국립 연구 재단 (DNRF120)에서 교부 금에 의해 투자 되었다.

1. Transposon 도서관의 컬렉션 참고: 염색체 DARS2 로커 스 미니 테네시 10으로 복제 했다-transposon, NKBOR (pNKBOR)에 21, 결과 기반으로 NKBOR:: DARS2 (pJFM1). pNKBOR 온라인 22 얻어질 수 있다. pNKBOR 복제 23 시작자 단백질 π를 필요로 하는 R6K 기반 자살 벡터 이다. 플라스 미드 pJFM1는 따라서 pir 유전자의 염색체 복사본을 포함 하는 E. 콜라이 긴장 (예를 들어, Dh5α λ pir)에 복제할 수 있습니다. 그러나, pJFM1은 Pir 불충분 한 wildtype MG1655로 변형 때 pJFM1 복제할 수 없습니다, NKBOR의 임의 삽입에 의해 생성 된 대 저항 클론의 선택에 지도:: 세균성 염색체로 DARS2. 편의상,이 DARS2 삽입 라고 하. 그림 1 방법론의 도식 프레 젠 테이 션을 참조 하십시오.
<ol><li>준비 electrocompetent MG1655 Δ 적극적으로 성장에서 DARS2 Lysogeny 국물 (파운드)에서 37 ° C 24 성장 세포.</li>
	<li>Electroporate pJFM1 electrocompetent MG1655 Δ로 DARS2, 곤잘레스 외. 따라 24 electrocompetent 대장균 MG1655 Δ의 <ol><li>40 (물 1 µ L)에서 pJFM1의 추가 1 µ g µ L DARS2 미리 냉장, 무 균 0.2 cm 간격 베트에이 혼합물을 전송. Electroporation 챔버에는 베트를 삽입 합니다. 18 Electroporate kV, 500 Ω 및 25 µ F; 시간 상수 ~5.0 ms, 그리고 아무 아크가 발생 한다.</li>
		<li>신속 하 게 미리 데워 파운드 국물과 15 mL 테스트 튜브에 1 mL에 resuspending에 의해 세균성 정지 복구.</li>
		<li>셀 항생제 선택 없이 30 분 동안 37 ° C에서 화난된 성장 조건 하에서 배양 하 여 복구 하자. 50µg/mL 대 보충 파운드 한 천 배지 위에 박테리아 접시 하 고 37 ° C에서 밤새 품 어.</li>
	</ol></li> <li>는 electroporation에서 식민지를 계산: 한 식민지는 것으로 간주 한 염색체 transposon 삽입. 
	참고: 식민지는 식민지 카운터 또는 눈으로 계산 될 수 있습니다. 식민지의 수는 각 클론의 염색체에 위치한 transposons 분리 평균 거리에 반비례 한다.</li>
	<li>추가 1 mL 각 파운드 국물의 접시와 모든 식민지를 씻어; 파운드 국물의 1 mL ~ 100000 식민지 씻어 충분 해야 한다. 다시 파운드 국물 세균 농도 증가 동일한 1 mL를 사용 하 여. 같은 50 mL 튜브에 모든 식민지 수영장.</li>
	<li>소용돌이 튜브 및 동결 시작 물자 (t = 0). 그것을 고정, 얼음에 50% 글리세롤의 1 mL와 함께 셀 서 스 펜 션의 1 mL를 혼합 한다. 10 분 동안 얼음 건조 튜브를 전송 합니다. 일단 문화, 냉동-80 ° C 냉동 고에 그들을 전송. 
	참고:이 단계에서 50000 CFU/mL의 최소의 셀 농도으로 예상 된다.</li>
</ol> 2. 파운드에 경쟁 실험 <ol><li>녹여 얼음에-80 ° C에서 transposon 라이브러리. Pipetting으로 믹스.</li>
	<li>Transposon 라이브러리 15 mL 테스트 튜브에 파운드의 10 mL를의 전송 100 µ L.</li>
	<li>고정 단계를 37 ° C에서 8 h에 대 한 연속 진동 (250rpm) 의해 화난 세포 성장 (즉, OD 600 ~ 4.0 =). 원하는 대로 다른 성장 조건에 이러한 매개 변수를 조정.</li>
	<li>신선한 prewarmed 매체에 연속 전송에 의해 세균성 인구 모든 ~ 10 세대를 전파합니다. 이렇게 신선한 파운드의 10 mL를 이전 고정 단계 문화 10 µ L를 전송 하 고 다른 8 h에 대 한 성장 하는 고정 단계로 (즉, OD 600 ~ 4.0 =). 
	참고: 시작 및 끝 광학 밀도 동일 인으로 빌드하기 희석에 해당 ~ 10 세대의 성장 (2 10 = 1024). 세균성 인구 중 신선한 prewarmed 매체에 직접 전파 하거나 저장할 수 0-4 ° C (얼음)에 다음 날을 전파 하 고. 파운드는 여기 많은 휴대폰 doublings에 짧은 가능한 (22 분 가까이 두 배로 시간) 시간을 보장 하기 위해 사용 되었다.</li>
	<li>경쟁의 각 100 세대, 이후 저장-80 ° C에서 5 1 mL 샘플 (단계 3.3에서에서 설명).</li>
	<li>개별 transposon 삽입을 포함 하는 셀 간의 체력 차이 작은 것으로 예상 된다, 만약 계속 경쟁의 기간 긴, 여기, 700 세대 (t = 700) 사용 되었다.</li>
</ol> 3. 감시 하는 경쟁 실험 동안 남쪽 오 점 분석 <ol><li>특정 뇌관을 사용 하 여 중 합 효소 연쇄 반응 (PCR) 증폭을 수행 하 여 오 (1-kb 섹션에서 NKBOR의) 남부에 대 한 조사를 준비: NKBOR_Probe_FW : gatgttggacgagtcggaat 및 NKBOR_Probe_RV: cgttacatccctggcttgtt.
	<li>품 30 98 ° C에 <ol>초기 변성에 대 한 s. 그런 다음 10 98 ° C에서 35 주기를 수행 s, 60 ° C 30에 대 한 s, 그리고 45 72 ° C s. 마지막 확장에 대 일 분을 위한 72 ° C 사용 
		참고: PCR 반응에 대 한 서식 파일은 순화 pNKBOR 플라스 미드 21.</li>
		<li>스미스 25에 따라 결과 PCR 파편 [α-32 P] dATP 임의의 뇌관 시스템을 사용 하 여 레이블.</li>
	</ol></li> <li>T Løbner Olesen 및 폰 Freiesleben 26에 따르면 총 세포질 DNA 준비 = 0 및 선택한 시간 포인트 t까지 700 세대 경쟁의 추정 =.</li>
	<li>소화 Pvu을 인하 하지 지역에만 한 번 관심 영역을 포함 하는 NKBOR 나 프로브에 의해 보호와 총 세포질 DNA; 1 단위의 Pvu 나 기판 DNA의 완전히 다이제스트 1 µ g를 사용할 수 있습니다. 
	참고: 프로브 삽입 사이트에 따라 다양 한 길이의 염색체 DNA 함께 transposon의 일부가 들어 있는 조각 인식 합니다.</li>
	<li>Løbner Olesen 및 폰 Freiesleben 26에 따라 0.7 %agarose 젤을 사용 하 여 남쪽 오 점 수행.</li>
</ol> 4. 적자 클론의 식별 <ol><li>사용 쉬운 유전자 걷기, 해리슨 그 외 여러분에 의해 설명 된 대로 27, 700 예상된 세대 경쟁; 후 단일 클론 (파운드 플레이트에 고립 된)에서 DARS2 삽입 사이트를 식별 하 더 밴드 남쪽 오 점에 더 격리 하는 데 필요한 모든 transposon 삽입 커버.
	<ol><li>격리 PCR 템플릿 genomic DNA 50 µ g/mL 대를 포함 하는 파운드 한 천 격판덮개에 박테리아를 확산 하 고 37 ° C에서 밤새 품 어. 37 ° C에서 파운드 국물에서 숙박 한 식민지를 성장 한 이후에 압력가 증류수 200 µ L로 20 µ L을 전송 (또는 DNA 정화 단계 3.2에서 사용).
		<li>혼합 소용돌이 <ol>입니다. 위한 10 분 및 5 분에 대 한 최대 속도 원심 분리기 저장 세포 lysate 미래 사용을 위한-20 ° C에서 100 ° C에서 혼합 열.</li>
		</ol></li> <li>선택의 transposon 내 anneal를 3 중첩 된 뇌관 디자인 (PCR 전략의 그래픽 표현에 대 한 그림 2 참조). 
		참고: 중첩 된 뇌관 3 알려진된 5에 가장 가까운 거짓말 확인 해야 중첩 된 뇌관 디자인 &#39; transposon DNA, 중첩 프라이 머 2와 1의 끝. 중첩 된 뇌관 3와 5 사이 간격 &#39; 알려진된 t의 끝ransposon DNA (사이트를 찾을 수 있는 특정 염색체 transposon 삽입) 알 수 없는 DNA에 알려진된 DNA에서 시퀀스 read-through에 대 한 충분 해야 한다. NKBOR에 대 한 다음 중첩 된 뇌관을 사용 되었다: pNKBOR_Nested3_RV: gcagggctttattgattcca, pNKBOR_Nested2_RV: tcagcaacaccttcttcacg, 및 pNKBOR_Nested1_RV: actttctggctggatgatgg. 알려진된 제한 효소의 인식 사이트를 포함 하는 임의의 뇌관도 사용 됩니다. 결과 보장 하기 위해, 하나는 적어도 두 개의 다른 무작위 뇌관을 사용 해야 합니다. 제한 효소 (e.g.,Sau 3AI 및 힌 dIII)에 대 한 제한 사이트 있어야 3 &#39; 끝과 앞 10 임의의 기지 그래서 그 5 &#39;-NNNNNNNNNNGATC-3 &#39; 5 &#39;-NNNNNNNNNNAAGCTT-3 &#39;는 뇌관 포함 된 Sau 3AI 사이트 (GATC) 힌 dIII 사이트 (AAGCTT), 각각, 어디 N = A, T, G, 또는 C.</li>
		<li>20에서 게놈 DNA의 사용 200 ng µ L PCR 반응. 30에 대 한 98 ° C에 품 어 초기 변성에 대 한 s. 30에 대 한 98 ° C에서 25 주기를 수행 15 50 ° C s s, 그리고 4 분 동안 72 ° C. 마지막 확장에 대 한 사용 하 여 72 ° C 10 분 사용 뇌관 쌍 구성 된 중첩 된 뇌관 1 무작위 뇌관 중 하나.</li>
		<li>뇌관 쌍 뇌관 2 중첩 및 두 번째 증폭에서 동일한 무작위 뇌관의 구성 된 그것의 이전 반응의 1 µ L를 사용 하 여 서식 파일로 사용.</li>
		<li>반복 단계 4.1.4 뇌관 3 중첩 된 동일한 임의의 뇌관의 구성 된 뇌관 쌍.</li>
		<li>는 1.5 %agarose 젤에 ethidium 평범한 사람으로 얼룩 최종 PCR 반응에서 제품을 실행합니다. 100-800 bp 범위에서 밴드를 잘라 하 고 어떤 상업적인 DNA 젤 추출 키트 제조 업체에 따르면를 사용 하 여 DNA를 분리 &#39; s 방향. 물 15 µ L에서 DNA resuspend. 
		참고: 주의. Ethidium 평범한 사람 독성 그리고 관리와 처리 해야 합니다.</li>
		<li>생어를 사용 하 여 시퀀싱 뇌관으로 뇌관 3 중첩 (4.1.6 단계) 이전 단계에서 격리 하는 밴드 순서는 상업적인 공급자에서 시퀀싱.</li>
	</ol></li> <li>WGS 수행.
	<ol><li>Frimodt 몰 러 외 4에 설명 된 대로 수행 WGS DNA에서 추출한 총에 경쟁 실험 기간 동안 수집 된 샘플을 선택.</li>
	</ol></li> <li>시퀀싱 분석 수행.
	<ol><li>맞춤 짝 간 150을 읽고 NKBOR, AF310136.1 1,904 인접 Ns &#8230; 2,204 씨앗 부분 문자열 (S, 1, 1.15)와의 모호한 문자 (L, 0, 0.9) 최대 수 사이 간격 Bowtie2 28을 사용 하 여.</li>
		<li>정렬 된 읽기를 선택 하 고 다음 다시 두 MG1655 ref를 정렬 | NC_000913.3 및 NKBOR 기가바이트 | AF310136 blastN 29를 사용 하 여</li> <li>할당 전위 접합 MG1655 NKBOR에서 삽입 위치.</li>
	</ol></li></ol> 5. Flow Cytometry <ol><li>cytometry에 대 한 샘플을 수집.
	적어도 10 세대를 위한 지 수 성장 단계에 그것을 유지 하 여 <ol><li>균형 각 문화. OD 600을 확인 하 고 그것은 결코 0.3 초과 확인.</li>
		<li>두 가지 유형의 흐름 샘플을 수집합니다.
		<ol><li>RIF runout에 대 한 RIF-CEF (300 µ g/mL 리 팜 피신과 36 µ g/mL 세 팔 렉 신 12.5 m m NaOH에에서 녹아 있는)의 30 µ L을 포함 하는 15 mL 튜브에 문화의 1 mL을 전송. 동요의 4 h의 최소 37 ° C에서 그것을 두고. 
			참고: 리 팜 피신 직접 차단 하지 복제에의 지속적인 라운드 종료를 계속 하면서 염색체 복제의 개시 합니다. 세 팔 렉 신 세포 분열, 복제 runout (RIF runout)에 완전히 복제 된 염색체를 가진 세포의 축적을 방지 합니다. 리 팜 피신 및 세 팔 렉 신 20 치료 시 완전히 복제 된 염색체의 수는 근원의 수.</li>
			<li>특급-샘플, 전송의 기 하 급수적으로 성장 하는 얼음에 1.5 mL 튜브에 문화 1 mL</li>
		</ol></li></ol></li> <li>셀을 다음과 같이 수정. 4에서 5 분 동안 15000 x g에서 원심 분리 하 여 세포를 수확 ° C. 얼음 10 mM Tris pH 7.5의 100 µ L에 펠 릿을 Resuspend 하 고 차가운 77% 에탄올의 1 mL을 추가. 사용 될 때까지 4 ° C에서 샘플 저장.</li>
	<li>셀 다음과 같이 얼룩. 상쾌한 15 분 제거에 대 한 15000 x g에서 원심 분리 하 여 고정된 셀의 100-300 µ L를 수확 하 고 펠 릿의 130 µ L에서 resuspend &#34; DNA 얼룩이 솔루션 &#34; (90 µ g/mL mithramycin, 20 µ g/mL ethidium 평범한 사람, 10 m m MgCl 2 그리고 10 mM Tris pH 7.5). 얼음에 샘플을 넣어 하 어두운; 샘플에 대 한 준비가 흐름 cytometry 분석 10 분 후 
	참고: 다른 DNA ethidium 평범한 사람 보다 얼룩과 mithramycin 사용된 30 , 31 수.</li>
	<li>흐름 cytometry 분석 셀, 상대 셀 질량 및 상대 DNA 콘텐츠 원본 결정.
	<li>수행 cytometry, 32에서 설명한 대로 <ol>. RIF runout 및 EXP-샘플 교류 cytometer 제조 업체를 사용 하 여 실행 &#39; s 지침 . Mithramycin-및 ethidium 평범한 사람 얼룩이 진 셀 여기 파장 395 및 440 nm을 사용 하 고 565 위 형광 수집 nm.
		<li>셀 번호 히스토그램 대 단일 매개 변수 앞으로 빛 분산형 및 30000 이벤트의 최소 셀 번호 히스토그램 대 형광 강도 특급 샘플 실행 상대 셀 질량과 상대 DNA 콘텐츠를 결정 하려면 <ol> 해당 셀 신호 하.</li>
			<li>사용 앞으로 흩어져 빛 단일 매개 변수 분포를 평균 상대 측정 셀 미사 
			참고: 앞으로 흩어져 빛은 평균 셀 대량 20.</li>
			<li>평균 DNA를 측정 하기 위해 사용 형광 강도 단일 매개 변수 배포판 콘텐츠 20.</li>
			<li>평균 DNA 콘텐츠 평균 셀 대량 20의 비율으로 DNA 농도 얻을.</li>
		</ol></li> <li>셀 당 근원의 수를 결정.
		<ol><li>대 단일 매개 변수 형광 강도를 실행 RIF runout 샘플 셀 셀 신호에 해당 하는 30000 이벤트의 최소 숫자 히스토그램.</li>
			<li>각 염색체의 수를 확인 하려면 사용 하 여 형광 강도 단일 매개 변수 배포판 셀 20.</li>
		</ol></li></ol></li> <li>계산 비동기 인덱스 (Ai).
	<li>계산 Ai, Løbner Olesen 외에 설명 된 대로 <ol> 32, RIF runout 샘플 및 수식 Ai의 형광 강도 단일 매개 변수 배포판을 사용 하 여 = (f3 + f5 + f6 + f7) / (f2 f4 + f8), fx가 x 완전히 복제 된 염색체의 수와 분수 셀. 식 이라고 때 비동기 고려 A &#62; 0.1.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Frimodt-Moller, J., Charbon, G., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+bacterial+chromosome+replication+by+non-coding+regions+outside+the+origin.">Control of bacterial chromosome replication by non-coding regions outside the origin.</a> Curr Genet. , (2016).</li><li>Sherratt, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombination+and+chromosome+segregation.">Recombination and chromosome segregation.</a> Philos Trans R Soc Lond B Biol Sci. 359 (1441), 61-69 (2004).</li><li>Bigot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+motifs+that+control+E.+coli+chromosome+segregation+by+orienting+the+FtsK+translocase.">DNA motifs that control E. coli chromosome segregation by orienting the FtsK translocase.</a> EMBO J. 24 (21), 3770-3780 (2005).</li><li>Frimodt-Moller, J., Charbon, G., Krogfelt, K. A., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Replication+Control+Is+Linked+to+Genomic+Positioning+of+Control+Regions+in+Escherichia+coli.">DNA Replication Control Is Linked to Genomic Positioning of Control Regions in Escherichia coli.</a> PLoS Genet. 12 (9), 1006286 (2016).</li><li>Kornberg, A., Baker, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> DNA Replication, Second Edition. , (1992).</li><li>Kaguni, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+initiation+at+the+Escherichia+coli+chromosomal+origin.">Replication initiation at the Escherichia coli chromosomal origin.</a> Curr Opin Chem Biol. 15 (5), 606-613 (2011).</li><li>Leonard, A. C., Grimwade, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+DnaA+assembly+and+activity:+taking+directions+from+the+genome.">Regulation of DnaA assembly and activity: taking directions from the genome.</a> Annu Rev Microbiol. 65, 19-35 (2011).</li><li>Kurokawa, K., Nishida, S., Emoto, A., Sekimizu, K., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+cycle-coordinated+change+of+the+adenine+nucleotide-bound+forms+of+DnaA+protein+in+Escherichia+coli.">Replication cycle-coordinated change of the adenine nucleotide-bound forms of DnaA protein in Escherichia coli.</a> EMBO J. 18 (23), 6642-6652 (1999).</li><li>Sekimizu, K., Bramhill, D., Kornberg, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATP+activates+dnaA+protein+in+initiating+replication+of+plasmids+bearing+the+origin+of+the+E.+coli+chromosome.">ATP activates dnaA protein in initiating replication of plasmids bearing the origin of the E. coli chromosome.</a> Cell. 50 (2), 259-265 (1987).</li><li>Brendler, T., Austin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+of+SeqA+protein+to+DNA+requires+interaction+between+two+or+more+complexes+bound+to+separate+hemimethylated+GATC+sequences.">Binding of SeqA protein to DNA requires interaction between two or more complexes bound to separate hemimethylated GATC sequences.</a> EMBO J. 18 (8), 2304-2310 (1999).</li><li>Lu, M., Campbell, J. L., Boye, E., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SeqA:+a+negative+modulator+of+replication+initiation+in+E.+coli.">SeqA: a negative modulator of replication initiation in E. coli.</a> Cell. 77 (3), 413-426 (1994).</li><li>Katayama, T., Kubota, T., Kurokawa, K., Crooke, E., Sekimizu, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+initiator+function+of+DnaA+protein+is+negatively+regulated+by+the+sliding+clamp+of+the+E.+coli+chromosomal+replicase.">The initiator function of DnaA protein is negatively regulated by the sliding clamp of the E. coli chromosomal replicase.</a> Cell. 94 (1), 61-71 (1998).</li><li>Kato, J., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hda,+a+novel+DnaA-related+protein,+regulates+the+replication+cycle+in+Escherichia+coli.">Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli.</a> EMBO J. 20 (15), 4253-4262 (2001).</li><li>Kasho, K., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DnaA+binding+locus+datA+promotes+DnaA-ATP+hydrolysis+to+enable+cell+cycle-coordinated+replication+initiation.">DnaA binding locus datA promotes DnaA-ATP hydrolysis to enable cell cycle-coordinated replication initiation.</a> Proc Natl Acad Sci U S A. 110 (3), 936-941 (2013).</li><li>Kitagawa, R., Ozaki, T., Moriya, S., Ogawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negative+control+of+replication+initiation+by+a+novel+chromosomal+locus+exhibiting+exceptional+affinity+for+Escherichia+coli+DnaA+protein.">Negative control of replication initiation by a novel chromosomal locus exhibiting exceptional affinity for Escherichia coli DnaA protein.</a> Genes Dev. 12 (19), 3032-3043 (1998).</li><li>Fujimitsu, K., Senriuchi, T., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+genomic+sequences+of+E.+coli+promote+replicational+initiation+by+directly+reactivating+ADP-DnaA.">Specific genomic sequences of E. coli promote replicational initiation by directly reactivating ADP-DnaA.</a> Genes Dev. 23 (10), 1221-1233 (2009).</li><li>Kasho, K., Fujimitsu, K., Matoba, T., Oshima, T., Katayama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timely+binding+of+IHF+and+Fis+to+DARS2+regulates+ATP-DnaA+production+and+replication+initiation.">Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiation.</a> Nucleic Acids Res. 42 (21), 13134-13149 (2014).</li><li>Frimodt-Moller, J., Charbon, G., Krogfelt, K. A., Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+regions+for+chromosome+replication+are+conserved+with+respect+to+sequence+and+location+among+Escherichia+coli+strains.">Control regions for chromosome replication are conserved with respect to sequence and location among Escherichia coli strains.</a> Front Microbiol. 6, 1011 (2015).</li><li>Bergthorsson, U., Ochman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+chromosome+length+variation+in+natural+isolates+of+Escherichia+coli.">Distribution of chromosome length variation in natural isolates of Escherichia coli.</a> Mol Biol Evol. 15 (1), 6-16 (1998).</li><li>Boye, E., Steen, H. B., Skarstad, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+of+bacteria:+a+promising+tool+in+experimental+and+clinical+microbiology.">Flow cytometry of bacteria: a promising tool in experimental and clinical microbiology.</a> J Gen Microbiol. 129 (4), 973-980 (1983).</li><li>Rossignol, M., Basset, A., Espeli, O., Boccard, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NKBOR,+a+mini-Tn10-based+transposon+for+random+insertion+in+the+chromosome+of+Gram-negative+bacteria+and+the+rapid+recovery+of+sequences+flanking+the+insertion+sites+in+Escherichia+coli.">NKBOR, a mini-Tn10-based transposon for random insertion in the chromosome of Gram-negative bacteria and the rapid recovery of sequences flanking the insertion sites in Escherichia coli.</a> Res Microbiol. 152 (5), 481-485 (2001).</li><li>Shafferman, A., Helinski, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+properties+of+the+beta+origin+of+replication+of+plasmid+R6K.">Structural properties of the beta origin of replication of plasmid R6K.</a> J Biol Chem. 258 (7), 4083-4090 (1983).</li><li>Gonzales, M. F., Brooks, T., Pukatzki, S. U., Provenzano, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+protocol+for+preparation+of+electrocompetent+Escherichia+coli+and+Vibrio+cholerae.">Rapid protocol for preparation of electrocompetent Escherichia coli and Vibrio cholerae.</a> J Vis Exp. (80), (2013).</li><li>Smith, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+primed+labeling+of+DNA.">Random primed labeling of DNA.</a> Methods Mol Biol. 18, 445-447 (1993).</li><li>Lobner-Olesen, A., von Freiesleben, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+replication+incompatibility+in+Dam+methyltransferase+deficient+Escherichia+coli+cells.">Chromosomal replication incompatibility in Dam methyltransferase deficient Escherichia coli cells.</a> EMBO J. 15 (21), 5999-6008 (1996).</li><li>Harrison, R. W., Miller, J. C., D'Souza, M. J., Kampo, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+gene+walking.">Easy gene walking.</a> Biotechniques. 22 (4), 650-653 (1997).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J Mol Biol. 215 (3), 403-410 (1990).</li><li>Stepankiw, N., Kaidow, A., Boye, E., Bates, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+right+half+of+the+Escherichia+coli+replication+origin+is+not+essential+for+viability,+but+facilitates+multi-forked+replication.">The right half of the Escherichia coli replication origin is not essential for viability, but facilitates multi-forked replication.</a> Mol Microbiol. 74 (2), 467-479 (2009).</li><li>Lobner-Olesen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+minichromosomes+in+individual+Escherichia+coli+cells:+implications+for+replication+control.">Distribution of minichromosomes in individual Escherichia coli cells: implications for replication control.</a> EMBO J. 18 (6), 1712-1721 (1999).</li><li>Lobner-Olesen, A., Skarstad, K., Hansen, F. G., von Meyenburg, K., Boye, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DnaA+protein+determines+the+initiation+mass+of+Escherichia+coli+K-12.">The DnaA protein determines the initiation mass of Escherichia coli K-12.</a> Cell. 57 (5), 881-889 (1989).</li><li>Carver, T., Thomson, N., Bleasby, A., Berriman, M., Parkhill, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAPlotter:+circular+and+linear+interactive+genome+visualization.">DNAPlotter: circular and linear interactive genome visualization.</a> Bioinformatics. 25 (1), 119-120 (2009).</li><li>Eckert, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrospective+application+of+transposon-directed+insertion+site+sequencing+to+a+library+of+signature-tagged+mini-Tn5Km2+mutants+of+Escherichia+coli+O157:H7+screened+in+cattle.">Retrospective application of transposon-directed insertion site sequencing to a library of signature-tagged mini-Tn5Km2 mutants of Escherichia coli O157:H7 screened in cattle.</a> J Bacteriol. 193 (7), 1771-1776 (2011).</li><li>van Opijnen, T., Bodi, K. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn-seq:+high-throughput+parallel+sequencing+for+fitness+and+genetic+interaction+studies+in+microorganisms.">Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms.</a> Nat Methods. 6 (10), 767-772 (2009).</li><li>van Opijnen, T., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon+insertion+sequencing:+a+new+tool+for+systems-level+analysis+of+microorganisms.">Transposon insertion sequencing: a new tool for systems-level analysis of microorganisms.</a> Nat Rev Microbiol. 11 (7), 435-442 (2013).</li><li>Jeong, H., Lee, S. J., Kim, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Procedure+for+Adaptive+Laboratory+Evolution+of+Microorganisms+Using+a+Chemostat.">Procedure for Adaptive Laboratory Evolution of Microorganisms Using a Chemostat.</a> J Vis Exp. (115), (2016).</li><li>Bryant, J. A., Sellars, L. E., Busby, S. J., Lee, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome+position+effects+on+gene+expression+in+Escherichia+coli+K-12.">Chromosome position effects on gene expression in Escherichia coli K-12.</a> Nucleic Acids Res. 42 (18), 11383-11392 (2014).</li><li>Blattner, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complete+genome+sequence+of+Escherichia+coli+K-12.">The complete genome sequence of Escherichia coli K-12.</a> Science. 277 (5331), 1453-1462 (1997).</li></ol>

저자는 전혀 경쟁 금융 관심이 없다.

여기에서 사용 하는 방법론-의 상태--예술 기법 유전적 요소의 최적의 게놈 위치에 대 한 어려운 질문에 대답을 활용 합니다. 유전자 요소 (중재는 transposon)의 임의 삽입 수 클론 다음 조사 유전 요소의 최적의 위치를 위해 선택 하는 서로 대하여 경쟁 하기 위해 만들 수 있는 수천의 신속 하 고 쉽게 컬렉션 (즉 적자 클론).
여기, DARS2 미니-테네시10에 삽입 된...

어떤 유전적 요소의 기능 게놈에 있는 그것의 위치에 따라 달라질 수 있습니다. 박테리아에이 주로 결과 방해에서 인접 유전자, 로컬 DNA 토폴로지 및 복제 관련 유전자 노출량의 전사에 의해. 특히, DNA 복제 및 분리의 프로세스 제어, 적어도 부분에서 비 코딩 염색체 지역별1, 그리고이 지역의 적절 한 기능에 따라 달라 집니다 genomic 위치/컨텍스트. 대장균, 예제에서는 여동생에 필요한 dif 사이트 염색체 해상도2; KOPS 시퀀스, 염색체 분리3;에 필요한 및 데이터, DARS1및 DARS2 지역, (아래; 적절 한 염색체 복제 제어에 필요한 4). 우리 여기 DARS2 비 코딩 영역의 연구에 의해 exemplified 임의의 이전, 선택, 그리고 어떤 주어진된 유전 요소의 최적의 유전자 맥락의 결정에 대 한 허용 하는 방법 제시.
대장균, DnaA에 시작자 단백질은 DNA 물가는 단일 복제 원점오릭스, 여 helicase DnaB5,,67의 채용에 대 한 책임. DnaA AAA+ (즉, 다양 한 활동과 관련 된 ATPases)에 속하는 단백질 유사한 높은 ATP 그리고 ADP를 바인딩할 수 및 화력5. DnaAATP 수준 개시8, DnaAATP 에 multimer를 형성에서 봉우리 오릭스 는 DNA 이중 오프닝9트리거합니다. 개시, 후 오릭스 hemimethylated SeqA 단백질의 바인딩을 포함 하는 메커니즘에 의해 격리로 인해 다시 개시에 대 한 일시적으로 사용할 수 없게 만든 오릭스10,11. 격리, 동안 DnaAATP 의 수준을 적어도 두 가지 메커니즘에 의해 감소 된다: DnaA (RIDA)12,13 및 데이터의 규제 비활성화-종속 DnaAATP 가수분해 (DDAH)14 ,15. RIDA와 DDAH 홍보 DnaAADPDnaAATP 의 변환. 개시의 새로운 라운드 전에 DnaAADP 는 특정 DnaA 재가동 시퀀스 (DARS)에 DnaAATP 를 재가동: DARS1 및 DARS216,17. 염색체 데이터, DARS1및 DARS2는 비 코딩 지역과 DnaAATP를 변조 하는 보호자와 같은 방식으로 행동 /DnaAADP interconversion. 복제의 근원 밖에이 지역 활성화 DnaA 복잡 한 어셈블리 중 하나에 대 한 비활성화 (데이터, 14) 또는 활성화 (DARS1 및 DARS2; 17) DnaA의. DARS2 셀에서 삭제 대량 배로 시간 되지만 비동기 복제 개시15,,1618변경 되지 않습니다. 그러나, DARS2-결핍 세포는 피트 니스는 풍부한 매체에서 모두 지속적인 성장 경쟁 하는 동안 또는 마우스 내장18에 있는 식민지의 설립 동안에 그렇지 않으면 isogenic wildtype에 비해 비용. 이 비동기/근원 농도에 사소한 변화 세균성 체력에 부정적인 효과 나타냅니다. 대장균, 선택적 압력 유지 염색체 대칭 (즉, 두 거의 같은 길이의 복제 팔)19있다. 데이터, DARS1및 DARS2 지역에 동일한 상대 거리는 오릭스 모든 대장균 변종 시퀀싱18, 염색체 크기에 큰 변화에도 불구 하 고.
여기, 우리가 그것의 기능에 대 한 최적의 염색체 position(s)의 식별에 대 한 예를 들어 대장균 의 DARS2 지역을 사용합니다. DARS2 NKBOR transposon 및 결과 NKBOR에 삽입 되었다: MG1655의 게놈에 무작위로 삽입 이후DARS2 transposon ΔDARS2. 우리는 따라서 셀의 컬렉션을 생성, 각 보유 DARS2 염색체에 다른 위치에 배치 합니다. 생체 외에서 경쟁 실험, 어디는 컬렉션에 있는 모든 셀 풀링된 되었고 약된 700 세대에 대 한 파운드에서 지속적인 성장을 하는 동안 서로 대하여 경쟁, 수행 되었다. 경쟁 실험의 결과 모니터링/결정 했다 남쪽 오 점, 쉬운 유전자 산책, 그리고 전체 게놈 시퀀싱 (WGS;를 사용 하 여 그림 1)입니다. 끝점 클론 쉬운 유전자 걸어서 해결 cytometry 세포 주기 매개 변수를 평가 하 여 특징 이었다. 흐름 cytometric 분석에 많은 수의 셀에 대 한 셀 크기, DNA 콘텐츠 및 개시 synchrony를 측정할 수 있습니다. Cytometry, 하는 동안 단일 셀의 흐름은 다음 동시에 등록 내보낸된 형광 DNA 콘텐츠, 측정을 수집 하는 photomultipliers에 의해 제공, 스테인드 DNA를 자극 하는 적절 한 파장의 광선 전달 합니다 세포는 DNA에 물 들 다. 앞으로 흩어져 빛 셀 대량20의 측정 이다.
생체 외에서 경쟁 실험 선물이 여기 염색체 위치 및 유전 요소의 게놈 맥락의 중요성에 관한 문제를 해결 하는 데 사용 됩니다. 방법은 공평 하 고 사용 하기 쉬운입니다.

<table><tbody><tr><td>Autoclaved Mili-Q water</td><td></td><td>None</td><td></td></tr><tr><td>Electroporation Cuvettes, 0.1 cm</td><td>Thermo Fisher Scientific</td><td>P41050</td><td></td></tr><tr><td>Bio-Rad MicroPulser Electroporation System</td><td>Bio-Rad</td><td>165-2100</td><td></td></tr><tr><td>LB Broth</td><td>Thermo Fisher Scientific</td><td>12780029&amp;nbsp;</td><td></td></tr><tr><td>LB Agar, powder (Lennox L agar)</td><td>Thermo Fisher Scientific</td><td>22700025</td><td></td></tr><tr><td>Glycerol</td><td>Thermo Fisher Scientific</td><td>17904</td><td></td></tr><tr><td>Fisherbrand&amp;nbsp;Plastic Petri Dishes</td><td>Fisher Scientific</td><td>S33580A</td><td></td></tr><tr><td>Falcon 50mL Conical Centrifuge Tubes</td><td>Fisher Scientific</td><td>14-432-22</td><td></td></tr><tr><td>Falcon 15mL Conical Centrifuge Tubes</td><td>Fisher Scientific</td><td>14-959-53A</td><td></td></tr><tr><td>Nunc&amp;nbsp;CryoTubes</td><td>Sigma-Aldrich</td><td>V7634&amp;nbsp;</td><td></td></tr><tr><td>Phusion High-Fidelity DNA Polymerase (2 U/&amp;micro;L)</td><td>Thermo Fisher Scientific</td><td>F530S</td><td></td></tr><tr><td>dATP, [&amp;alpha;-32P]- 3000Ci/mmol 10mCi/ml, 250 &amp;micro;Ci</td><td>PerkinElmer</td><td>BLU012H250UC</td><td></td></tr><tr><td>DECAprime II DNA Labeling Kit</td><td>Thermo Fisher Scientific</td><td>AM1455</td><td></td></tr><tr><td>Spectrophotometer&amp;nbsp; SF/MBV/03.32</td><td>Pharmacia</td><td></td><td></td></tr><tr><td>Hermle Centrifuge&amp;nbsp;&amp;nbsp;&amp;nbsp; SF/MBV/03.46</td><td>Hermle</td><td></td><td></td></tr><tr><td>Ole Dich Centrifuge&amp;nbsp; SF/MBV/03.29</td><td>Ole Dich</td><td></td><td></td></tr><tr><td>Eppendorftubes 1.5 mL</td><td>Sigma-Aldrich</td><td>T9661</td><td></td></tr><tr><td>Eppendorftubes 2.0 mL</td><td>Sigma-Aldrich</td><td>T2795</td><td></td></tr><tr><td>Sodium Chloride</td><td>Merck</td><td>6404</td><td></td></tr><tr><td>96% Ethanol</td><td>Sigma-Aldrich</td><td>16368</td><td></td></tr><tr><td>Trizma HCl</td><td>Sigma-Aldrich</td><td>T-3253</td><td></td></tr><tr><td>Phenol Ultra Pure</td><td>BRL</td><td>5509UA</td><td></td></tr><tr><td>Chloroform</td><td>Merck</td><td>2445</td><td></td></tr><tr><td>Ribonuclease A type II A</td><td>Sigma-Aldrich</td><td>R5000</td><td></td></tr><tr><td>Sodiumdodecylsulphate (SDS)</td><td>Merck</td><td>13760</td><td></td></tr><tr><td>Lysozyme</td><td>Sigma-Aldrich</td><td>L 6876</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma-Aldrich</td><td>405-7</td><td></td></tr><tr><td>0.5M Na-EDTA pH 8.0</td><td>BRL</td><td>5575 UA</td><td></td></tr><tr><td>Kanamycin sulfate</td><td>Sigma-Aldrich</td><td>10106801001</td><td></td></tr><tr><td>PvuI (10 U/&amp;micro;L)</td><td>Thermo Fisher Scientific</td><td>ER0621</td><td></td></tr><tr><td>UltraPure Agarose</td><td>Thermo Fisher Scientific</td><td>16500500</td><td></td></tr><tr><td>DNA Gel Loading Dye (6X)</td><td>Thermo Fisher Scientific</td><td>R0611</td><td></td></tr><tr><td>Tris-Borate-EDTA buffer</td><td>Sigma-Aldrich</td><td>T4415</td><td></td></tr><tr><td>Ethidium bromide</td><td>Sigma-Aldrich</td><td>E7637</td><td></td></tr><tr><td>Hydrochloric acid</td><td>Sigma-Aldrich</td><td>433160</td><td></td></tr><tr><td>Sodium Hydroxide</td><td>Sigma-Aldrich</td><td>71687</td><td></td></tr><tr><td>Whatman&amp;nbsp;3MM papers</td><td>Sigma-Aldrich</td><td>WHA3030931</td><td></td></tr><tr><td>SSC Buffer 20&amp;times; Concentrate</td><td>Sigma-Aldrich</td><td>S6639</td><td></td></tr><tr><td>Amersham Hybond-N+</td><td>GE Healthcare</td><td>RPN119B</td><td></td></tr><tr><td>Ficoll&amp;nbsp;400</td><td>Sigma-Aldrich</td><td>F8016</td><td></td></tr><tr><td>Polyvinylpyrrolidone</td><td>Sigma-Aldrich</td><td>PVP40</td><td></td></tr><tr><td>Bovine Serum Albumin - Fraction V</td><td>Sigma-Aldrich</td><td>85040C</td><td></td></tr><tr><td>Deoxyribonucleic acid sodium salt from salmon testes</td><td>Sigma-Aldrich</td><td>D1626</td><td></td></tr><tr><td>Carestream Kodak &amp;nbsp;BioMax &amp;nbsp;light film</td><td>Sigma-Aldrich</td><td>Z373494</td><td></td></tr><tr><td>GenElute &amp;nbsp;Gel Extraction Kit</td><td>Sigma-Aldrich</td><td>NA1111&amp;nbsp;</td><td></td></tr><tr><td>GenElute &amp;nbsp;PCR Clean-Up Kit</td><td>Sigma-Aldrich</td><td>NA1020</td><td></td></tr><tr><td>T100&amp;nbsp; Thermal Cycler</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>SmartSpec Plus Spectrophotometer</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>Rifampicin</td><td>Serva</td><td>34514.01</td><td></td></tr><tr><td>Cephalexin</td><td>Sigma-Aldrich</td><td>C4895</td><td></td></tr><tr><td>Mithramycin</td><td>Serva</td><td>29803.02</td><td></td></tr><tr><td>Magnesium chloride hexahydrate</td><td>Sigma-Aldrich</td><td>246964</td><td></td></tr><tr><td>Apogee A10 instrument</td><td>Apogee</td><td></td><td></td></tr></tbody></table>

determination of the optimal chromosomal location(s) for a dna element in escherichia coli using a novel transposon-mediated approach

특정된 DNA 요소의 최적의 염색체 position(s)는 / transposon 중재 무작위 삽입 휘트니스 선택에 의해 다음에 의해 결정 되었다. 박테리아, 유전적 요소의 기능에 유전 맥락의 영향을 평가 하기 위해 어려울 수 있습니다. 토폴로지 효과, 이웃 유전자 또는 유전자 복제 관련 된 복용량, transcriptional 방해를 포함 하 여 몇 가지 메커니즘 주어진 유전적 요소의 기능 영향을 줄 수 있습니다. 여기, 대장균 및 간단한 성장 경쟁을 사용 하 여 가장 유리한 위치 실험 선택의 염색체에 DNA 요소의 임의의 통합을 허용 하는 방법을 설명 합니다. 메서드를 사용 하면 임의의 삽입, 성장 혜택, 실험적인 요구에 쉽게 조절 절차 적자 clone(s)의 선택과 결합의 잘 설명된 transposon-기반 시스템의 활용. 복잡 한 다중 클론 인구에 전체 게놈 시퀀싱 또는 선택 된 클론의 급속 한 식별에 대 한 쉬운 유전자 적자 clone(s)의 성격을 결정할 수 있습니다. 여기, 비 코딩 DNA 영역 DARS2, 대장균의 염색체 복제의 개시를 제어 하는 예제로 사용 되었다. DARS2 의 기능 유전자 복제 관련 된 복용량;에 의해 영향을 받을 것으로 알려져 가까이 DARS2 는 더 활성화 된다 DNA 복제의 기원에 가져옵니다. DARS2 DARS2의 염색체에 무작위로 삽입 된-변형 삭제. 개별 삽입을 포함 하는 결과 클론 풀링된 그리고 세대의 수백을 위해 서로 경쟁 했다. 마지막으로, 적자 클론 특징 되었고 DARS2 원래 DARS2 위치에 가까운 근접에서 삽입 포함 발견.

남쪽 오 점 DARS2 transposon 라이브러리에 염색체에 걸쳐 무작위로 배포 했다 확인 이루어졌다 (t = 0) 적자 클론 시간이 지남에 유지할 것 이다 그. 남쪽 오 점 초기 transposon 풀에서 추출한 DNA에서 수행 되었다 (t = 0)과 경쟁 (그림 3)의 700 세대에서 모든 예상된 100. 여기, 각 시간 점에서 총 세포 DNA가 나 제한 효소, 잘라 transposon NKBOR 알려진 Pvu?...

Watch this Scientific Journal Video about Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach at JoVE.com

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

여기, 비 코딩 DNA 요소의 transposon 중재 무작위 삽입의 힘의 최적의 염색체 위치를 해결 하기 위해 사용 되었다.

소설 Transposon 중재 방식을 사용 하 여 대장균 의 DNA 요소에 대 한 최적의 염색체 위치 결정

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

determination-optimal-chromosomal-location-s-for-dna-element

Research

JoVE Journal

Genetics

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

7.5K 조회수.  University of Copenhagen. 여기, 비 코딩 DNA 요소의 transposon 중재 무작위 삽입의 힘의 최적의 염색체 위치를 해결 하기 위해 사용 되었다.

비디오: Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia coli, these transfer proteins make up a DNA transfer machinery known as the mating pair formation, or DNA transfer complex, which facilitates conjugative plasmid transfer. The objective of this paper is to provide a method that can be used to determine the role of a specific transfer protein that is involved in conjugation using a series of deletions and/or point mutations in combination with mating assays. The target gene is knocked out on the conjugative plasmid and is then provided in trans through the use of a small recovery plasmid harboring the target gene. Mutations affecting the target gene on the recovery plasmid can reveal information about functional aspects of the target protein that result in the alteration of mating efficiency of donor cells harboring the mutated gene. Alterations in mating efficiency provide insight into the role and importance of the particular transfer protein, or a region therein, in facilitating conjugative DNA transfer. Coupling this mating assay with detailed three-dimensional structural studies will provide a comprehensive understanding of the function of the conjugative transfer protein as well as provide a means for identifying and characterizing regions of protein-protein interaction.

Here, we present a protocol to knockout a gene of interest involved in plasmid conjugation and subsequently analyze the impact of its absence using mating assays. The function of the gene is further explored to a specific region of its sequence using deletion or point mutations.

접합에 참여 전송 단백질의 서열 별 분석을위한 공역 결합 분석 실험

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia ...

연구

유전학

Site-specific Bacterial Chromosome Engineering: &#934;C31 Integrase Mediated Cassette Exchange (IMCE)

The bacterial chromosome may be used to stably maintain foreign DNA in the mega-base range1. Integration into the chromosome circumvents issues such as plasmid replication, plasmid stability, plasmid incompatibility, and plasmid copy number variance. This method uses the site-specific integrase from the Streptomyces phage (&Phi;) C312,3. The &Phi;C31 integrase catalyzes a direct recombination between two specific DNA sites: attB and attP (34 and 39 bp, respectively)4. This recombination is stable and does not revert5. A "landing pad" (LP) sequence consisting of a spectinomycin- resistance gene, aadA (SpR), and the E. coli &szlig;-glucuronidase gene (uidA) flanked by attP sites has been integrated into the chromosomes of Sinorhizobium meliloti, Ochrobactrum anthropi, and Agrobacterium tumefaciens in an intergenic region, the ampC locus, and the tetA locus, respectively. S. meliloti is used in this protocol. Mobilizable donor vectors containing attB sites flanking a stuffer red fluorescent protein (rfp) gene and an antibiotic resistance gene have also been constructed. In this example the gentamicin resistant plasmid pJH110 is used. The rfp gene6 may be replaced with a desired construct using SphI and PstI. Alternatively a synthetic construct flanked by attB sites may be sub-cloned into a mobilizable vector such as pK19mob7. The expression of the &Phi;C31 integrase gene (cloned from pHS628) is driven by the lac promoter, on a mobilizable broad host range plasmid pRK78139.
A tetraparental mating protocol is used to transfer the donor cassette into the LP strain thereby replacing the markers in the LP sequence with the donor cassette. These cells are trans-integrants. Trans-integrants are formed with a typical efficiency of 0.5%. Trans-integrants are typically found within the first 500-1,000 colonies screened by antibiotic sensitivity or blue-white screening using 5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid (X-gluc). This protocol contains the mating and selection procedures for creating and isolating trans-integrants.

A quick and efficient method to integrate foreign DNA of interest into pre-made acceptor strains, termed landing pad strains, is described. The method allows site-specific integration of a DNA cassette into the engineered landing pad locus of a given strain, through conjugation and expression of the &#934;C31 integrase.

사이트 특정 박테리아 염색체 공학 : ΦC31 Integrase 중재 카세트 거래소 (IMCE)

The bacterial chromosome may be used to stably maintain foreign DNA in the mega-base range1. Integration into the chromosome circumvents issues such as ...

생체공학

High-Resolution Comparison of Bacterial Conjugation Frequencies

Bacterial conjugation is an important step in the horizontal transfer of antibiotic resistance genes via a conjugative DNA element. In-depth comparisons of conjugation frequency under different conditions are required to understand how the conjugative element spreads in nature. However, conventional methods for comparing conjugation frequency are not appropriate for in-depth comparisons because of the high background caused by the occurrence of additional conjugation events on the selective plate. We successfully reduced the background by introducing a most probable number (MPN) method and a higher concentration of antibiotics to prevent further conjugation in selective liquid medium. In addition, we developed a protocol for estimating the probability of how often donor cells initiate conjugation by sorting single donor cells into recipient pools by fluorescence-activated cell sorting (FACS). Using two plasmids, pBP136 and pCAR1, the differences in conjugation frequency in Pseudomonas putida cells could be detected in liquid medium at different stirring rates. The frequencies of conjugation initiation were higher for pBP136 than for pCAR1. Using these results, we can better understand the conjugation features in these two plasmids.

With an aim to understand the behaviors of various bacterial conjugative DNA elements under different conditions, we describe a protocol for detecting differences in conjugation frequency, with high resolution, to estimate how efficiently the donor bacterium initiates conjugation.

세균성 활용 주파수의 고해상도 비교

Bacterial conjugation is an important step in the horizontal transfer of antibiotic resistance genes via a conjugative DNA element. In-depth comparisons ...

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol for transferring gene deletion mutations from one Escherichia coli strain to another by using generalized transduction with the bacteriophage P1. This method requires that the mutation be selectable (e.g., based on gene disruptions using antibiotic cassette insertions). Such antibiotic cassettes can be mobilized from a donor strain and introduced into a recipient strain of interest to quickly and easily generate a gene deletion mutant. The antibiotic cassette can be designed to include flippase recognition sites that allow the excision of the cassette by a site-specific recombinase to produce a clean knock-out with only a ~100-base-pair-long scar sequence in the genome. We demonstrate the protocol by knocking out the tamA gene encoding an assembly factor involved in autotransporter biogenesis and test the effect of this knock-out on the biogenesis and function of two trimeric autotransporter adhesins. Though gene deletion by P1 transduction has its limitations, the ease and speed of its implementation make it an attractive alternative to other methods of gene deletion.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

Excisable 항 생 저항 카세트와 P1 변환 하 여 대장균 에서 생산 유전자 삭제

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol ...

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below outlines a method for high efficiency transfer between bacterial strains of a plasmid harboring a transposon containing a kanamycin resistance marker. The plasmid-borne transposase is encoded by a variant tnp gene that inserts the transposon into the genome of the recipient strain with very low insertional bias. This method thus allows the creation of large mutant libraries in which transposons have been inserted into unique genomic positions in a recipient strain of either Escherichia coli or Shigella flexneri bacteria. By using bacterial conjugation, as opposed to other methods such as electroporation or chemical transformation, large libraries with hundreds of thousands of unique clones can be created. This yields high-density insertion libraries, with insertions occurring as frequently as every 4-6 base pairs in non-essential genes. This method is superior to other methods as it allows for an inexpensive, easy to use, and high efficiency method for the creation of a dense transposon insertion library. The transposon library can be used in downstream applications such as transposon sequencing (Tn-Seq), to infer genetic interaction networks, or more simply, in mutational (forward genetic) screens.

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Presented here is a simple method for creating a high-density transposon insertion library in Escherichia coli or Shigella flexneri using bacterial conjugation. This protocol allows the creation of a collection of hundreds of thousands of unique mutants in bacteria by the random genomic insertion of a transposon.

밀도 Transposon 삽입 라이브러리를 사용 하 여 세균성 활용 Enterobacterial 종자와 같은 대장균 또는 Shigella flexneri 의 창조

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below ...

면역학 및 감염병학

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

에 박테리아 기능 네트워크 및 경로를 매핑<em&gt; 대장균</em&gt; 합성 유전자 배열을 사용하여

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

생물학

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can be generated using a transposome. The commercially available, Tn5-derived transposome used in this protocol consists of a linear segment of DNA containing an R6K&#947; replication origin, a gene for kanamycin resistance and two mosaic sequence ends, which serve as transposase binding sites. The transposome, provided as a DNA/transposase protein complex, is introduced by electroporation into the prototrophic strain, Enterobacter sp. YSU, and randomly incorporates itself into this host&#8217;s genome. Transformants are replica plated onto Luria-Bertani agar plates containing kanamycin, (LB-kan) and onto M-9 medium agar plates containing kanamycin (M-9-kan). The transformants that grow on LB-kan plates but not on M-9-kan plates are considered to be auxotrophs. Purified genomic DNA from an auxotroph is partially digested, ligated and transformed into a pir+ Escherichia coli (E. coli) strain. The R6K&#947; replication origin allows the plasmid to replicate in pir+ E. coli strains, and the kanamycin resistance marker allows for plasmid selection. Each transformant possesses a new plasmid containing the transposon flanked by the interrupted chromosomal region. Sanger sequencing and the Basic Local Alignment Search Tool (BLAST) suggest a putative identity of the interrupted gene. There are three advantages to using this transposome mutagenesis strategy. First, it does not rely on the expression of a transposase gene by the host. Second, the transposome is introduced into the target host by electroporation, rather than by conjugation or by transduction and therefore is more efficient. Third, the R6K&#947; replication origin makes it easy to identify the mutated gene which is partially recovered in a recombinant plasmid. This technique can be used to investigate the genes involved in other characteristics of Enterobacter sp. YSU or of a wider variety of bacterial strains.

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Enterobacter sp. YSU grows in glucose minimal salts medium. Auxotrophs are generated by transforming it with a transposome which randomly inserts itself into the host genome. Mutants are found by replica plating from complex medium to minimal medium. Interrupted genes are identified by gene rescue and sequencing.

생성<em&gt; 엔테로 박터</em&gt; SP. YSU 영양 요구는 트랜스포존 돌연변이 유발을 사용하여

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can ...

Generating Transposon Insertion Libraries in Gram-Negative Bacteria for High-Throughput Sequencing

Transposon sequencing (Tn-seq) is a powerful method that combines transposon mutagenesis and massive parallel sequencing to identify genes and pathways that contribute to bacterial fitness under a wide range of environmental conditions. Tn-seq applications are extensive and have not only enabled examination of genotype-phenotype relationships at an organism level but also at the population, community and systems levels. Gram-negative bacteria are highly associated with antimicrobial resistance phenotypes, which has increased incidents of antibiotic treatment failure. Antimicrobial resistance is defined as bacterial growth in the presence of otherwise lethal antibiotics. The &#8220;last-line&#8221; antimicrobial colistin is used to treat Gram-negative bacterial infections. However, several Gram-negative pathogens, including Acinetobacter baumannii can develop colistin resistance through a range of molecular mechanisms, some of which were characterized using Tn-seq. Furthermore, signal transduction pathways that regulate colistin resistance vary within Gram-negative bacteria. Here we propose an efficient method of transposon mutagenesis in A. baumannii that streamlines generation of a saturating transposon insertion library and amplicon library construction by eliminating the need for restriction enzymes, adapter ligation, and gel purification. The methods described herein will enable in-depth analysis of molecular determinants that contribute to A. baumannii fitness when challenged with colistin. The protocol is also applicable to other Gram-negative ESKAPE pathogens, which are primarily associated with drug resistant hospital-acquired infections.

We describe a method to generate saturating transposon mutant libraries in Gram-negative bacteria and subsequent preparation of DNA amplicon libraries for high-throughput sequencing. As an example, we focus on the ESKAPE pathogen, Acinetobacter baumannii, but this protocol is amenable to a wide range of Gram-negative organisms.

고처리량 시퀀싱을 위한 그람 음성 박테리아에 트랜스포슨 삽입 라이브러리 생성

Transposon sequencing (Tn-seq) is a powerful method that combines transposon mutagenesis and massive parallel sequencing to identify genes and pathways ...

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

Inferring the function of genes by manipulating their activity is an essential tool for understanding the genetic underpinnings of most biological processes. Advances in molecular microbiology have seen the emergence of diverse mutagenesis techniques for the manipulation of genes. Among them, transposon-insertion sequencing (Tn-seq) is a valuable tool to simultaneously assess the functionality of many candidate genes in an untargeted way. The technique has been key to identify&#160;molecular mechanisms for the colonization of eukaryotic hosts in several pathogenic microbes and a few beneficial symbionts.
Here, Tn-seq is established as a method to identify colonization factors in a mutualistic Burkholderia gladioli symbiont of the beetle Lagria villosa. By conjugation, Tn5 transposon-mediated insertion of an antibiotic-resistance cassette is&#160;carried out at random genomic locations in B. gladioli. To identify the effect of gene disruptions on the ability of the bacteria to colonize the beetle host, the generated B. gladioli transposon-mutant library is inoculated on the beetle eggs, while a control is grown in vitro in a liquid culture medium. After allowing sufficient time for colonization, DNA is extracted from the in vivo and in vitro grown libraries. Following a DNA library preparation protocol, the DNA samples are prepared for transposon-insertion sequencing. DNA fragments that contain the transposon-insert edge and flanking bacterial DNA are selected, and the mutation sites are determined by sequencing away from the transposon-insert edge. Finally, by analyzing and comparing the frequencies of each mutant between the in vivo and in vitro libraries, the importance of specific symbiont genes during beetle colonization can be predicted.

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

This is an adapted method for identifying candidate insect colonization factors in a Burkholderia beneficial symbiont. The beetle host is infected with a random mutant library generated via transposon mutagenesis, and library complexity after colonization is compared to a control grown in vitro.

라그리아 빌로사 딱정벌레의 부르크홀더리아 글래디올리 공생에서 세균 식민지 요인을 해명하는 도구로 트랜스포슨 삽입 시퀀싱

Inferring the function of genes by manipulating their activity is an essential tool for understanding the genetic underpinnings of most biological ...

Real-Time Quantification of the Effects of IS200/IS605 Family-Associated TnpB on Transposon Activity

Here, a protocol is outlined to perform live, real-time imaging of transposable element activity in live bacterial cells using a suite of fluorescent reporters coupled to transposition. In particular, it demonstrates how real-time imaging can be used to assess the effects of the accessory protein TnpB on the activity of the transposable element IS608, a member of the IS200/IS605 family of transposable elements. The IS200/IS605 family of transposable elements are abundant mobile elements connected with one of the most innumerable genes found in nature, tnpB. Sequence homologies propose that the TnpB protein may be an evolutionary precursor to CRISPR/Cas9 systems. Additionally, TnpB has received renewed interest, having been shown to act as a Cas-like RNA-guided DNA endonuclease. The effects of TnpB on the transposition rates of IS608 are quantified, and it is demonstrated that the expression of TnpB of IS608 results in ~5x increased transposon activity compared to cells lacking TnpB expression.

A protocol is outlined to perform live real-time imaging to quantify how the accessory protein TnpB affects the dynamics of transposition in individual live Escherichia coli cells.

트랜스포존 활성에 대한 IS200/IS605 계열 관련 TnpB의 영향에 대한 실시간 정량화

Here, a protocol is outlined to perform live, real-time imaging of transposable element activity in live bacterial cells using a suite of fluorescent ...