The authors thank Dr. IC Bruce for critical comments and reading the manuscript. This work was supported by grants from the National Natural Science Foundation of China (31430059, 31701272, 31730061, 81470399, and 31521062), AstraZeneca Asia, and Emerging Market Innovative Medicine and Early Development.

All animal procedures used a zebrafish protocol approved by the Institutional Animal Care and Use Committee at Peking University, which is fully accredited by Association for Assessment and Accreditation of Laboratory Animal Care.
1. Preparation of Tricaine Solution
<ol>
	<li>To prepare tricaine stock solution, add 400 mg ethyl 3-aminobenzoate methanesulfonate powder to 97.9 mL distilled water, and then add 2.1 mL of 1 M Tris (pH 9.5) to adjust the pH to ~7. Store the stock solution at 4 &#176;C.</li>
	<li>To prepare tricaine working solution, add 4.2 mL tricaine stock solution to 100 mL aquarium system water.</li>
</ol>
2. Adult Zebrafish Ventricular Resection
<ol>
	<li>Prepare instruments and materials for the surgery which include a piece of sponge, a Petri dish filled with tricaine working solution, a plastic pipette, a stereomicroscope, two sharp forceps, iridectomy scissors, and elbow tweezers (Figure 1).</li>
	<li>Prepare a small groove of the size of 4 cm x 0.5 cm and 0.5 cm in depth on a sponge to hold the zebrafish during the ventricular resection surgery.</li>
	<li>Fill a 3 L zebrafish tank with half a tank of zebrafish system water that is made by using 60 mg/L sea salts in dH2O for the recovery of the injured fish.</li>
	<li>Anesthetize the fish in a 10 cm Petri dish with tricaine solution until the gill movements decrease to one per second and keep the fish for at least 30 s to ensure that it is fully anesthetized.</li>
	<li>Transfer the anesthetized fish with the elbow tweezers to the groove in a moist sponge ventral side up. Visually locate the margin of the beating heart, and then locate the heart under a stereomicroscope.</li>
	<li>Use the iridectomy scissors to make a small incision of about 1 mm that penetrates the skin and muscles, and carefully tear the silvery epithelial layer of the pericardial sac with the forceps tips to access the heart. Do not insert the forceps too deep into the cavity to avoid the heart injury. 
	NOTE: At this point, keep in mind to avoid extensive bleeding. Exclude the fish from the experiment if extensive bleeding occurs, since the excessive bleeding is mainly caused by the accidental injury to the heart and so will result in misleading results.</li>
	<li>Expose the ventricle by gently holding its apex with sharp forceps using the non-dominant hand or by applying gentle abdominal pressure. Then, with the other hand, remove ~20% of the ventricle at the apex using the iridectomy scissors. 
	NOTE: No extensive bleeding should occur at this point.</li>
	<li>Use a wet napkin to cover the incision, as the wounds bleed profusely for 15&#8211;45 s before clotting, and then put the fish back into the tank with system water. 
	NOTE: It is not necessary to suture the incision.</li>
	<li>Make sure that the fish regains gill movements within 1 min and then resumes swimming. If the fish does not show gill movements after 50 s in water, facilitate it by squirting water into the gills using a plastic pipette until the fish resumes active ventilation.</li>
	<li>Maintain the fish in the recycle system after the ventricular resection. 
	NOTE: No special cares are necessary compared with the normal fish. The death rate of adult zebrafish ventricular resection is about 5&#8211;10%. Almost all death happens within 24 h after the surgery.</li>
</ol>
3. Preparation of siRNA-encapsulated Nanoparticles
<ol>
	<li>Synthesize the f-PAM4-PEG-R9 dendrimer. 
	NOTE: The synthesis of f-PAM4-PEG-R9 dendrimer materials was performed as described previously37 with some modifications. The length of &#945;, &#969;-dipyridyl disulfido polyethylene glycol (Py-PEG-Py) were reduced to a molecular weight of 1,000 to maximize the encapsulation of siRNAs (Figure 2B).</li>
	<li>Dry 10 mg of the cystamine core of G4.0 polyamidoamine (termed PAMAM) using vacuum dryer at 45 &#176;C for 1 h and then dissolve the PAMAM in 2 mL Dulbecco&#39;s phosphate-buffered saline (DPBS, a balanced salt solution used for a variety of cell culture applications).</li>
	<li>Dissolve 1.7 mg tris(2-carboxyethyl) phosphine (TCEP) in 1 mL DPBS, mix with the PAMAM solution prepared in 3.2 and leave at room temperature with gentle stirring for 8 h. 
	NOTE: TCEP is ten-fold in molar ratio excess to the disulfide bonds of the PAMAM.</li>
	<li>Remove excessive TCEP by ultrafiltration. Add DPBS to the above PAMAM-TCEP mixture to reach the volume of 10 mL and the solution is transferred into a 3 kDa MWCO (molecular weight cut off) ultrafiltration tube. After the centrifugation at 3,000 g for 15 min, discard the solution in the collection tube. Add DPBS to the filter device up to 10 mL and gently pipette the sample multiple times and centrifuge again. Repeat this step for 4 times. After the last filtration, aspirate the sample from the filter device. 
	NOTE: The product of this step is reduced PAMAM (termed f-PAM4).</li>
	<li>Dissolve 14 mg Py-PEG-Py in 1 mL DPBS, mix with the f-PAM4 solution and leave it with gentle stirring at room temperature for 3 h. Then remove the excessive Py-PEG-Py by the ultrafiltration step as described in 3.4. After the last filtration, aspirate the sample from the filter device. 
	NOTE: The product is named as f-PAM4-PEG-Py. The amount of Py-PEG-Py is 10-fold in the molar ratio to the thiol groups in the f-PAM4.</li>
	<li>Dissolve 6.4 mg of Cysteine terminated R9 Peptide (Ac-CRRRRRRRRR-NH2) in 1 mL DPBS, mix with f-PAM4-PEG-Py and gently stir for 8 h at room temperature. Purify the final product, called f-PAM4-PEG-R9, by the ultrafiltration step as described in 3.4 except that DPBS is changed to deionized water. Lyophilize the product by using a freeze vacuum dryer. 
	NOTE: The products in 3.5 and 3.6 before lyophilization are stored at -20 &#8451; for at least 1 month. After the lyophilization of f-PAM4-PEG-R9, the samples are stored at -20 &#8451; for at least 2 months.</li>
	<li>To determine the degree of PEG and peptide modification, dissolve 5 mg of the f-PAM4-PEG-Py in the D2O (Deuterium oxide) and transfer it into the NMR (Nuclear Magnetic Resonance) sample tube. Perform 1H-NMR spectral analysis at 400 MHz and analyze the data using NMR data analysis software37. 
	NOTE: Specifically, the representative PAMAM peaks (-NCH2CH2CO-), PEG peaks (-OCH2CH2-), and arginine residue peaks (-HCCH2CH2CH2NH-) in the peptides are expected to be in the ranges 2.4&#8211;2.6, 3.7&#8211;3.8, and 1.6&#8211;1.8 ppm, respectively. Determine the degree of modification of the PEG and R9 relative to the PAMAM by calculating the integrals of the PEG and R9 peaks to the PAMAM peaks. The modification degree of PEG is 100% and the R9 modification is at least 50%. The 1H-NMR spectral analyses are performed in the core facility of the institution.</li>
	<li>Dissolve the f-PAM4-PEG-R9 dendrimer powder in PBS to 4 mg/mL and make aliquots of the solution for one-time use. 
	NOTE: The dendrimer solution can be stored at -20 &#176;C for at least one month, without repeated freezing and thawing.</li>
	<li>Dissolve the cyanine dyes-labeled siRNAs (termed Cy5-siRNA), Aldh1a2 siRNA or scrambled negative control siRNA in distilled water to 10 &#181;M. 
	NOTE: Use the cyanine dyes-labeled siRNAs to evaluate whether the nanoparticle encapsulated siRNA can enter the fish heart (Figure 2A-B). This protocol takes aldh1a2 as an example gene to determine the efficiency of delivery of f-PAM4-PEG-R9 dendrimer-encapsulated siRNA. The sequences of the siRNAs are: Cy5-siRNA antisense strand: 5&#8242;-ACGUGACACGUUCGGAGAAdTdT-3&#8242;, siAldh1a2 antisense strand: 5&#39;-UUCAGGACAACCGUGUUCCdTdT-3&#39; and scrambled negative control siRNA antisense strand: 5&#39;-ACGUGACACGUUCGGAGAAdTdT-3&#39;.</li>
	<li>To prepare the siRNA-encapsulated nanoparticle solution, mix siRNA with an equal volume of dendrimer solution, and incubate the sample at room temperature for 20 min. Freshly prepare the siRNA-nanoparticle solution before use. 
	NOTE: The volume of siRNA-encapsulated nanoparticle solution depends on the number of fish going to be injected. For example, prepare at least 120 &#181;L dendrimer solution (mix 60 &#181;L siRNA solution and 60 &#181;L dendrimer solution) for the injection of 10 fish (~10 &#181;L per fish), counting in the loss of solution.</li>
</ol>
4. Injection of siRNA-encapsulated Nanoparticles into Adult Zebrafish Heart
<ol>
	<li>As described above, prepare a piece of sponge with a groove, a 10 cm Petri dish filled with tricaine solution, a plastic pipette, a stereomicroscope, elbow tweezers, and an insulin syringe (Figure 1), as well as a fish tank with system water for housing the fish after injection.</li>
	<li>Allow the injured zebrafish prepared in steps 2.1&#8211;2.10 to recover for 1 day after ventricular resection, and then anesthetize the 1 dpa (days post-amputation) fish in tricaine solution as described in 2.4.</li>
	<li>Transfer the anesthetized fish, ventral side up, to the groove in the moist sponge using the elbow tweezers. Locate the beating heart under the stereomicroscope.</li>
	<li>Load 10 &#181;L of the siRNA-encapsulated nanoparticle solution into the insulin syringe. Avoid bubbles as much as possible.</li>
	<li>Immobilize the fish by gently using the elbow tweezers to hold the thoracic region with the non-dominant hand. Do not clamp the fish too tightly. 
	NOTE: Keep in mind that no extensive bleeding should occur during the injection.</li>
	<li>Hold the filled insulin syringe at ~30&#176; and inject ~10 &#181;L of solution into the thoracic cavity using the other hand (Supplemental Figure 1). 
	NOTE: The solution sometimes flows out during the injection, but this does not affect the siRNA effect. The siRNA-nanoparticle solution can be injected once a day for several days to one month, depending on a specific experimental plan. Inject a fish with one type of siRNA each time. If more than two types of siRNA need to be injected into one fish, inject one type of siRNA each time, and then inject another type of siRNA 1 h later. In this protocol, only one type of siRNA per fish was injected.</li>
	<li>Transfer the fish to the tank with the system water. 
	NOTE: The fish are expected to restart ventilation within 1 min, and then resume swimming. The injection of siRNA-encapsulated nanoparticles or siRNA normally does not cause death in adult zebrafish.</li>
</ol>
5. Heart Collection, Fixation, and Evaluation of the Efficiency of siRNA Delivery
<ol>
	<li>Prepare 1 mL of 4% paraformaldehyde solution in a microcentrifuge tube for each group.</li>
	<li>Anesthetize the fish in tricaine solution at selected days after injections. Place the fish supinely into the groove in a moist sponge. Make a large incision in the thoracic region and open widely with the tweezers. Grip the outflow tract and pull out the whole heart carefully with the tweezers.</li>
	<li>Rinse the heart with PBS and rapidly remove extra liquid with a napkin. Put up to 10 hearts into a 1.5 mL microcentrifuge tube with 1 mL paraformaldehyde. Gently invert the tube several times, and keep overnight at 4 &#176;C.</li>
	<li>Measure the fluorescence intensity of Cy5-siRNAs-injected hearts using the in vivo imaging system (Supplemental Figure 2). Use 3&#8211;4 zebrafish hearts for each group in this study.</li>
	<li>Mount the fixed hearts with either paraffin or OCT compound (Embedding Medium for Frozen Tissue Specimens to ensure Optimal Cutting Temperature).</li>
</ol>
6. Evaluation of Nanoparticle-mediated siRNA Gene-silencing
<ol>
	<li>Prepare an insulated container and long tweezers. Pour in liquid nitrogen to a third of the volume of the container.</li>
	<li>Anesthetize the fish in tricaine solution at 2 dpa. Dissect the hearts as described in 5.2, and then remove the outflow tract and atrium. 
	NOTE: The fish can recover from the surgery in one day and then injected at 1 dpa with either scrambled siRNA-encapsulated nanoparticles (siNC) as a negative control or aldh1a2 siRNA-encapsulated nanoparticles (siAldh1a2).</li>
	<li>Transfer the ventricles into a 1.5 mL microcentrifuge tube using the tweezers, cover the tube lid, and immediately place the tube into the insulated container with liquid nitrogen. Let the tubes float on the liquid nitrogen for a few min. Use the long tweezers to remove tubes from the container.</li>
	<li>Repeat steps 6.2 and 6.3 until all ventricles are collected. Use 6&#8211;10 hearts for each group.</li>
	<li>Extract the total RNA of hearts with RNA isolation reagent.Assess the expression levels of the respective genes by quantitative RT-PCR using primers Gapdh F: GATACACGGAGCACCAGGTT; Gapdh R: GCCATCAGGTCACATACACG; Aldh1a2 F: TGAGCGAGGAGCAGCAGAGA; Aldh1a2 R: TCCACGAAGAAGCCTTTAGTAGCA.</li>
</ol>

The authors have nothing to disclose.

The zebrafish is fully capable of regenerating a variety of organs including the adult heart5. While transgenic and genetic methods are well-developed for studying gene functions in the embryos of zebrafish, investigators are still faced with the daunting task of generating conditional mutant alleles in zebrafish45,46. Thus, transgenic dominant-negative mutants or small-molecule inhibitors are frequently used to address gene functions in a...

Myocardial infarction has become a major health threat, leading to a tremendous economic burden around the world1. The adult mammalian heart fails to regenerate and replenish the lost cardiomyocytes on a macroscopic scale after the injury, leading to the formation of scar tissues and subsequent heart failure. Unlike mammals, the zebrafish is capable of heart regeneration, primarily through the robust myocardial proliferation after different types of heart injury, making it an ideal model organism for investigating the molecular mechanisms of heart regeneration2,3,4,5,6,7,8. Deciphering the endogenous mechanisms underlying zebrafish heart regeneration is an exciting area of research in the search for novel therapeutic strategies to improve human heart regeneration9.
Genetic manipulation methods are available in zebrafish. These consist of morpholinos (MO) that are also widely used in frogs, chick, and mammals besides in zebrafish10,11,12,13. MO has efficient knockdown of target gene expression in the adult zebrafish fin, brain, and retina14,15,16,17,18,19. Locked-nucleic acid (LNA) is another artificial oligonucleotide used to knock down endogenous gene expression not only in zebrafish embryos but also in adult animal organs20,21,22,23,24. However, the lack of effective loss-of-function methods for adults&#39; hearts remains an obstacle in studying the molecular mechanisms of organ regeneration. At present, small-molecule inhibitors or transgenic expression of dominant-negative mutants are primarily used to block the function of a certain gene or pathway to study its function in the adult zebrafish heart regeneration25,26,27. However, not all genes or signaling pathways are applicable for these methods.
Small-interfering RNAs (siRNAs) are widely used for the loss-of-function analysis in mammalian cells and embryos of model organisms, as well as adult organs for preclinical studies in animal models28,29,30,31,32. siRNAs have been effectively used to silence genes in tumors33,34,35 and in cardiomyocytes36,37,38,39,40&#160;via different delivery systems. Recently, we developed efficient siRNA-encapsulated nanoparticle gene-silencing in the regenerating adult heart using several different nanoparticles41,42,43, providing a novel tool for functional studies of genes in adult zebrafish organs. Based on our previous studies41,42,43, here we present a simple, practical, yet powerful protocol for siRNA gene-silencing in the regenerating adult zebrafish heart using f-PAMAM-PEG-R9 dendrimers. Aldh1a2 (aldehyde dehydrogenase 1 family, member A2) gene was upregulated after zebrafish apex resection and ablation of Aldh1a2 blocked the cardiac regeneration44. Here we take aldh1a2 gene as an example to test the gene knockdown efficiency mediated by nanoparticle-encapsulated siRNA injection. This protocol contains a procedure for zebrafish heart resection, chemical synthesis of nanoparticles, and a delivery method on siRNA-encapsulated nanoparticles into adult zebrafish heart.

<table><tbody><tr><td>tricaine</td><td>Sigma</td><td>E10521</td><td>Store at 4 &amp;deg;C</td></tr><tr><td>stereomicroscope</td><td>Leica&amp;nbsp;</td><td>S8AP0</td><td></td></tr><tr><td>sharp forcep</td><td>WPI</td><td>14098</td><td></td></tr><tr><td>iridectomy scissors</td><td>WPI</td><td>501778</td><td></td></tr><tr><td>elbow tweezers</td><td>Suzhou Liuliu</td><td>SE05Cr</td><td></td></tr><tr><td>&amp;alpha;,&amp;omega;-dipyridyl disulfido polyethylene glycol(Py-PEG-Py)</td><td>Biomatrik (Jiaxing) Inc.</td><td>5239</td><td></td></tr><tr><td>core of G4.0 polyamidoamine (PAMAM)</td><td>Andrews ChemServices</td><td>AuCS-297</td><td></td></tr><tr><td>vacuum drying equipment</td><td>Yiheng</td><td>DZF-6020</td><td></td></tr><tr><td>Dulbecco&#039;s phosphate-buffered saline (DPBS)</td><td>Gibco</td><td>14190144</td><td></td></tr><tr><td>tris(2-carboxyethyl)phosphine(TCEP)</td><td>Alfar Aesar</td><td>51805-45-9</td><td>Causes severe skin burns and eye damage. Causes serious eye damage.</td></tr><tr><td>ultrafiltration tube</td><td>Millipore</td><td>UFC900308</td><td></td></tr><tr><td>freeze dryer</td><td>Martin Christ</td><td>Alpha 2-4 Ldplus</td><td></td></tr><tr><td>NMR spectrometer</td><td>Bruker</td><td>AV400</td><td></td></tr><tr><td>Deuterium oxide(D&lt;sub&gt;2&lt;/sub&gt;O)</td><td>J&amp;amp;K</td><td>174611</td><td></td></tr><tr><td>NMR sample tube</td><td>J&amp;amp;K</td><td>WG-1000-7-50</td><td></td></tr><tr><td>3 kDa MWCO ultrafiltration tube</td><td>Merck</td><td>UFC900308</td><td></td></tr><tr><td>sea salts</td><td>Instant Ocean&amp;reg;</td><td>SS15-10</td><td></td></tr></tbody></table>

nanoparticle-mediated sirna gene-silencing in adult zebrafish heart

Mammals have a very limited capacity to regenerate the heart after myocardial infarction. On the other hand, the adult zebrafish regenerates its heart after apex resection or cryoinjury, making it an important model organism for heart regeneration study. However, the lack of loss-of-function methods for adult organs has restricted insights into the mechanisms underlying heart regeneration. RNA interference via different delivery systems is a powerful tool for silencing genes in mammalian cells and model organisms. We have previously reported that siRNA-encapsulated nanoparticles successfully enter cells and result in a remarkable gene-specific knockdown in the regenerating adult zebrafish heart. Here, we present a simple, rapid, and efficient protocol for the dendrimer-mediated siRNA delivery and gene-silencing in the regenerating adult zebrafish heart. This method provides an alternative approach for determining gene functions in adult organs in zebrafish and can be extended to other model organisms as well.

To determine the efficiency of the dendrimer-mediated siRNA delivery, we resected the apex of the ventricle of the zebrafish heart, then injected about 10 &#181;L of dendrimer only (mock group), Cy5-siRNA only (naked group), or f-PAMAM-PEG-R9 dendrimer-encapsulated Cy5-siRNA (Cy5-siRNA group) intrapleurally, respectively (Figure 2A-B). The fluorescence signal was detectable in the hearts injected with dendrimer-encapsulated Cy5-siRNA at 3, 24...

Watch this Scientific Journal Video about Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart at JoVE.com

Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart

It remains a major challenge to develop conditional gene-knockout or effective gene-knockdown in adult zebrafish organs. Here we report a protocol for performing nanoparticle-mediated siRNA gene-silencing in adult zebrafish heart, thus providing a new loss-of-function method for studying adult organs in zebrafish and other model organisms.

Mammals have a very limited capacity to regenerate the heart after myocardial infarction. On the other hand, the adult zebrafish regenerates its heart ...

nanoparticle-mediated-sirna-gene-silencing-in-adult-zebrafish-heart

Research

JoVE Journal

Developmental Biology

8.1K Views.  Peking University. Het blijft een grote uitdaging om voorwaardelijke gen-knock-out of effectief gen-knockdown in volwassen zebrafish organen. Wij rapporteren hier een protocol voor presterende nanoparticle-gemedieerde siRNA gen-zwijgen in volwassen zebrafish hart, waardoor een nieuwe methode van het verlies-van-functie voor het bestuderen van volwassen organen in zebrafish en andere modelorganismen.

Video: Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart

Large-scale Zebrafish Embryonic Heart Dissection for Transcriptional Analysis

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the cardiac transcriptome from being masked by the global embryonic transcriptome, it is necessary to collect sufficient numbers of hearts for further analyses. Furthermore, as zebrafish cardiac development proceeds rapidly, heart collection and RNA extraction methods need to be quick in order to ensure homogeneity of the samples. Here, we present a rapid manual dissection protocol for collecting functional/beating hearts from zebrafish embryos. This is an essential prerequisite for subsequent cardiac-specific RNA extraction to determine cardiac-specific gene expression levels by transcriptome analyses, such as quantitative real-time polymerase chain reaction (RT-qPCR). The method is based on differential adhesive properties of the zebrafish embryonic heart compared with other tissues; this allows for the rapid physical separation of cardiac from extracardiac tissue by a combination of fluidic shear force disruption, stepwise filtration and manual collection of transgenic fluorescently labeled hearts.

To analyse cardiac gene expression profiles during zebrafish heart development, total RNA has to be extracted from isolated hearts. Here, we present a protocol for collecting functional/beating hearts by rapid manual dissection from zebrafish embryos to obtain cardiac-specific mRNA.

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the ...

Induction of Myocardial Infarction in Adult Zebrafish Using Cryoinjury

The mammalian heart is incapable of significant regeneration following an acute injury such as myocardial infarction1. By contrast, urodele amphibians and teleost fish retain a remarkable capacity for cardiac regeneration with little or no scarring throughout life2,3. It is not known why only some non-mammalian vertebrates can recreate a complete organ from remnant tissues4,5. To understand the molecular and cellular differences between regenerative responses in different species, we need to use similar approaches for inducing acute injuries.
In mammals, the most frequently used model to study cardiac repair has been acute ischemia after a ligation of the coronary artery or tissue destruction after cryoinjury6,7. The cardiac regeneration in newts and zebrafish has been predominantly studied after a partial resection of the ventricular apex2,3. Recently, several groups have established the cryoinjury technique in adult zebrafish8-10. This method has a great potential because it allows a comparative discussion of the results obtained from the mammalian and non-mammalian species.
Here, we present a method to induce a reproducible disc-shaped infarct of the zebrafish ventricle by cryoinjury. This injury model is based on rapid freezing-thawing tissue, which results in massive cell death of about 20% of cardiomyocytes of the ventricular wall. First, a small incision was made through the chest with iridectomy scissors to access the heart. The ventricular wall was directly frozen by applying for 23-25 seconds a stainless steel cryoprobe precooled in liquid nitrogen. To stop the freezing of the heart, fish water at room temperature was dropped on the tip of the cryoprobe. The procedure is well tolerated by animals, with a survival rate of 95%.
To characterize the regenerative process, the hearts were collected and fixed at different days after cryoinjury. Subsequently, the specimen were embedded for cryosectioning. The slides with sections were processed for histological analysis, in situ hybridization and immunofluorescence. This undertaking enhances our understanding of the factors that are required for the regenerative plasticity in the zebrafish, and provide new insights into the machinery of cardiac regeneration. A conceptual and molecular understanding of heart regeneration in zebrafish will impact both developmental biology and regenerative medicine.

Zebrafish represents a valuable model to study the mechanisms of heart regeneration in vertebrates. Here, we present a protocol for induction of a heart infarct in adult zebrafish using cryoinjury. This method results in massive cell death within 20% of the ventricular wall, similar to that observed in mammalian infarcts.

The mammalian heart is incapable of significant regeneration following an acute injury such as myocardial infarction1. By contrast, urodele amphibians and ...

Medicine

Micromanipulation of Gene Expression in the Adult Zebrafish Brain Using Cerebroventricular Microinjection of Morpholino Oligonucleotides

Manipulation of gene expression in tissues is required to perform functional studies. In this paper, we demonstrate the cerebroventricular microinjection (CVMI) technique as a means to modulate gene expression in the adult zebrafish brain. By using CVMI, substances can be administered into the cerebroventricular fluid and be thoroughly distributed along the rostrocaudal axis of the brain. We particularly focus on the use of antisense morpholino oligonucleotides, which are potent tools for knocking down gene expression in vivo. In our method, when applied, morpholino molecules are taken up by the cells lining the ventricular surface. These cells include the radial glial cells, which act as neurogenic progenitors. Therefore, knocking down gene expression in the radial glial cells is of utmost importance to analyze the widespread neurogenesis response in zebrafish, and also would provide insight into how vertebrates could sustain adult neurogenesis response. Such an understanding would also help the efforts for clinical applications in human neurodegenerative disorders and central nervous system regeneration. Thus, we present the cerebroventricular microinjection method as a quick and efficient way to alter gene expression and neurogenesis response in the adult zebrafish forebrain. We also provide troubleshooting tips and other useful information on how to carry out the CVMI procedure.

In this article, we demonstrate a method for manipulation of gene expression in the ventricular cells of the adult zebrafish telencephalon using antisense morpholino oligonucleotides. We present this method as an efficient and quick protocol that can be used for functional studies in the adult vertebrate brain.

Manipulation of gene expression in tissues is  required to perform functional studies. In this paper, we demonstrate the  cerebroventricular ...

Neuroscience

High-Frequency Ultrasound Echocardiography to Assess Zebrafish Cardiac Function

The zebrafish (Danio rerio) has become a very popular model organism in cardiovascular research, including human cardiac diseases, largely due to its embryonic transparency, genetic tractability, and amenity to rapid, high-throughput studies. However, the loss of transparency limits heart function analysis at the adult stage, which complicates modeling of age-related heart conditions. To overcome such limitations, high-frequency ultrasound echocardiography in zebrafish is emerging as a viable option. Here, we present a detailed protocol to assess cardiac function in adult zebrafish by non-invasive echocardiography using high-frequency ultrasound. The method allows visualization and analysis of zebrafish heart dimension and quantification of important functional parameters, including heart rate, stroke volume, cardiac output, and ejection fraction. In this method, the fish are anesthetized and kept underwater and can be recovered after the procedure. Although high-frequency ultrasound is an expensive technology, the same imaging platform can be used for different species (e.g., murine and zebrafish) by adapting different transducers. Zebrafish echocardiography is a robust method for cardiac phenotyping, useful in the validation and characterization of disease models, particularly late-onset diseases; drug screens; and studies of heart injury, recovery, and regenerative capacity.

We describe a protocol to assess heart morphology and function in adult zebrafish using high-frequency echocardiography. The method allows visualization of the heart and subsequent quantification of functional parameters, such as heart rate (HR), cardiac output (CO), fractional area change (FAC), ejection fraction (EF), and blood inflow and outflow velocities.

The zebrafish (Danio rerio) has become a very popular model organism in cardiovascular research, including human cardiac diseases, largely due to its ...

Design and Microinjection of Morpholino Antisense Oligonucleotides and mRNA into Zebrafish Embryos to Elucidate Specific Gene Function in Heart Development

The morpholino oligomer-based knockdown system has been used to identify the function of various gene products through loss or reduced expression. Morpholinos (MOs) have the advantage in biological stability over DNA oligos because they are not susceptible to enzymatic degradation. For optimal effectiveness, MOs are injected into 1-4 cell stage embryos. The temporal efficacy of knockdown is variable, but MOs are believed to lose their effects due to dilution eventually. Morpholino dilution and injection amount should be closely controlled to minimize the occurrence of off-target effects while maintaining on-target efficacy. Additional complementary tools, such as CRISPR/Cas9 should be performed against the target gene of interest to generate mutant lines and to confirm the morphant phenotype with these lines. This article will demonstrate how to design, prepare, and microinject a translation-blocking morpholino against hand2 into the yolk of 1-4 cell stage zebrafish embryos to knockdown hand2 function and rescue these "morphants" by co-injection of mRNA encoding the corresponding cDNA. Subsequently, the efficacy of the morpholino microinjections is assessed by first verifying the presence of morpholino in the yolk (co-injected with phenol red) and then by phenotypic analysis. Moreover, cardiac functional analysis to test for knockdown efficacy will be discussed. Finally, assessing the effect of morpholino-induced blockage of gene translation via western blotting will be explained.

The present protocol describes designing, preparing, and microinjecting a translational-blocking morpholino against a representative cardiac gene; Heart And Neural Crest Derivatives Expressed2 (hand2) into the yolk of newly fertilized zebrafish embryos to knock down gene function. It also shows a transient rescue of these "morphants" by co-injection of mRNA encoding this gene product.

The morpholino oligomer-based knockdown system has been used to identify the function of various gene products through loss or reduced expression.  ...

In vivo Electroporation of Morpholinos into the Regenerating Adult Zebrafish Tail Fin

Certain species of urodeles and teleost fish can regenerate their tissues. Zebrafish have become a widely used model to study the spontaneous regeneration of adult tissues, such as the heart1, retina2, spinal cord3, optic nerve4, sensory hair cells5, and fins6.
The zebrafish fin is a relatively simple appendage that is easily manipulated to study multiple stages in epimorphic regeneration. Classically, fin regeneration was characterized by three distinct stages: wound healing, blastema formation, and fin outgrowth. After amputating part of the fin, the surrounding epithelium proliferates and migrates over the wound. At 33 &deg;C, this process occurs within six hours post-amputation (hpa, Figure 1B)6,7. Next, underlying cells from different lineages (ex. bone, blood, glia, fibroblast) re-enter the cell cycle to form a proliferative blastema, while the overlying epidermis continues to proliferate (Figure 1D)8. Outgrowth occurs as cells proximal to the blastema re-differentiate into their respective lineages to form new tissue (Figure 1E)8. Depending on the level of the amputation, full regeneration is completed in a week to a month.
The expression of a large number of gene families, including wnt, hox, fgf, msx, retinoic acid, shh, notch, bmp, and activin-betaA genes, is up-regulated during specific stages of fin regeneration9-16. However, the roles of these genes and their encoded proteins during regeneration have been difficult to assess, unless a specific inhibitor for the protein exists13, a temperature-sensitive mutant exists or a transgenic animal (either overexpressing the wild-type protein or a dominant-negative protein) was generated7,12. We developed a reverse genetic technique to quickly and easily test the function of any gene during fin regeneration.
Morpholino oligonucleotides are widely used to study loss of specific proteins during zebrafish, Xenopus, chick, and mouse development17-19. Morpholinos basepair with a complementary RNA sequence to either block pre-mRNA splicing or mRNA translation. We describe a method to efficiently introduce fluorescein-tagged antisense morpholinos into regenerating zebrafish fins to knockdown expression of the target protein. The morpholino is micro-injected into each blastema of the regenerating zebrafish tail fin and electroporated into the surrounding cells. Fluorescein provides the charge to electroporate the morpholino and to visualize the morpholino in the fin tissue.
This protocol permits conditional protein knockdown to examine the role of specific proteins during regenerative fin outgrowth. In the Discussion, we describe how this approach can be adapted to study the role of specific proteins during wound healing or blastema formation, as well as a potential marker of cell migration during blastema formation.

In vivo Electroporation of Morpholinos into the Regenerating Adult Zebrafish Tail Fin

We describe a method to conditionally knockdown the expression of a target protein during adult zebrafish fin regeneration. This technique involves micro-injecting and electroporating antisense oligonucleotide morpholinos into fin tissue, which allows testing the protein&#x2019;s role in various stages of fin regeneration, including wound healing, blastema formation, and regenerative outgrowth.

Certain species of urodeles and teleost fish can regenerate their tissues. Zebrafish have become a widely used model to study the spontaneous regeneration ...

Biology

A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish

The genetically accessible adult zebrafish (Danio rerio) has been increasingly used as a vertebrate model for understanding human diseases such as cardiomyopathy. Because of its convenience and amenability to high throughput genetic manipulations, the generation of acquired cardiomyopathy models, such as the doxorubicin-induced cardiomyopathy (DIC) model in adult zebrafish, is opening the doors to new research avenues, including discovering cardiomyopathy modifiers via forward genetic screening. Different from the embryonic zebrafish DIC model, both initial acute and later chronic phases of cardiomyopathy can be determined in the adult zebrafish DIC model, enabling the study of stage-dependent signaling mechanisms and therapeutic strategies. However, variable results can be obtained with the current model, even in the hands of experienced investigators. To facilitate future implementation of the DIC model, we present a detailed protocol on how to generate this DIC model in adult zebrafish and describe two alternative ways of intraperitoneal (IP) injection. We further discuss options on how to reduce variations to obtain reliable results and provide suggestions on how to appropriately interpret the results.

A method to generate a doxorubicin-induced cardiomyopathy model in adult zebrafish (Danio rerio) is described here. Two alternative ways of intraperitoneal injection are presented and conditions to reduce variations among different experimental groups are discussed.

The genetically accessible adult zebrafish (Danio rerio) has been increasingly used as a vertebrate model for understanding human diseases such as ...

Recovery of Adult Zebrafish Hearts for High-throughput Applications

Use of the zebrafish model system for studying development, regeneration, and disease is expanding toward use of adult hearts for cell dissociation and purification of RNA, DNA, and proteins. All of these applications demand the rapid recovery of significant numbers of zebrafish hearts to avoid gene regulatory, metabolic, and other changes that begin after death. Adult zebrafish hearts are also required for studying heart structure for a variety of mutants and for studying heart regeneration. However, the traditional zebrafish heart dissection is slow and difficult and requires specialized tools, making large-scale dissection of adult zebrafish hearts tedious. Traditional methods also harbor the risk of damaging the heart during the dissection. Here, we describe a method for dissection of adult zebrafish hearts that is fast, reproducible, and preserves heart architecture. Furthermore, this method does not require specialized tools, is painless for the zebrafish, can be performed on fresh or fixed specimens, and can be performed on zebrafish as young as one month old. The approach described expands the use of adult zebrafish for cardiovascular research.

Use of zebrafish for cardiovascular research is expanding towards research on adult hearts. For these applications, quick and simple isolation of cardiac tissues is key to avoid post-mortem changes and to obtain an adequate number of samples. Here, we describe a fast and reproducible method for dissecting adult zebrafish hearts.

Use of the zebrafish model system for studying development, regeneration, and disease is expanding toward use of adult hearts for cell dissociation and ...

Intrathoracic Injection for the Study of Adult Zebrafish Heart

The adult zebrafish heart provides a powerful model in cardiac regeneration research. Although the strength of this system is based on transgenic approaches, a rapid delivery of exogenous factors provides a complementary technique in functional studies. Here, we present a method that relies on administration of a few microliters of solution into the pericardial cavity without causing myocardial damage. Intrathoracic (IT) injections can efficiently deliver proteins and chemical compounds directly onto the heart surface. The injected substances diffuse through the epicardium into the underlying cardiac tissues. Compared to intraperitoneal (IP) injections, the main advantage of intrathoracic injections is the focal administration of the tested factors on the target organ. The delivery of molecules directly into the pericardium is a suitable strategy for studies of cardiac preconditioning and regeneration in adult zebrafish.

This method relies on the injection of 0.5&#8722;3 &#956;L of solution into the thorax of adult zebrafish. The procedure efficiently delivers proteins and chemical compounds into the proximity of the zebrafish heart without damaging the organ. The approach is suitable for testing effects of exogenous factors on various tissues of the heart.

The adult zebrafish heart provides a powerful model in cardiac regeneration research. Although the strength of this system is based on transgenic ...

Isolation of Cardiac and Vascular Smooth Muscle Cells from Adult, Juvenile, Larval and Embryonic Zebrafish for Electrophysiological Studies

Zebrafish have long been used as a model vertebrate organism in cardiovascular research. The technical difficulties of isolating individual cells from the zebrafish cardiovascular tissues have been limiting in studying their electrophysiological properties. Previous methods have been described for dissection of zebrafish hearts and isolation of ventricular cardiac myocytes. However, the isolation of zebrafish atrial and vascular myocytes for electrophysiological characterization was not detailed. This work describes new and modified enzymatic protocols that routinely provide isolated juvenile and adult zebrafish ventricular and atrial cardiomyocytes, as well as vascular smooth muscle (VSM) cells from the bulbous arteriosus, suitable for patch-clamp experiments. There has been no literary evidence of electrophysiological studies on zebrafish cardiovascular tissues isolated at embryonic and larval stages of development. Partial dissociation techniques that allow patch-clamp experiments on individual cells from larval and embryonic hearts are demonstrated.

The present protocol describes the acute isolation of viable cardiac and vascular smooth muscle cells from adult, juvenile, larval, and embryonic zebrafish (Danio rerio), suitable for electrophysiological studies.

Zebrafish have long been used as a model vertebrate organism in cardiovascular research. The technical difficulties of isolating individual cells from the ...

Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart

Samenvatting

Meer video's verkennen