저자는 중요 한 의견에 대 한 박사 IC 브루스를 감사 하 고 원고를 읽고. 이 작품은 국립 자연 과학 재단의 중국 (31430059, 31701272, 31730061, 81470399, 및 31521062), 아 스 트 라 아시아 및 신흥 시장 혁신적인 의학 및 초기 발달에서 교부 금에 의해 지원 되었다.

모든 동물 절차는 기관 동물 관리 및 사용 위원회 평가 및 실험 동물 관리 인증 협회 인증는 북경 대학에서 승인한 zebrafish 프로토콜 사용.
1입니다. Tricaine 솔루션의 준비
<ol><li>Tricaine 재고 솔루션을 준비 하려면 97.9 mL 증 류 물, 400mg 에틸 3 aminobenzoate methanesulfonate 분말을 추가 하 고 2.1 mL 1 M 트리 스 (pH 9.5) ~ 7 pH 조정의 추가. 4 ° c.에 재고 솔루션 저장</li>
	<li>Tricaine 작업 솔루션을 준비, 100 mL 수족관 시스템 물 4.2 mL tricaine 재고 솔루션을 추가 합니다.</li>
</ol>2. 성인 Zebrafish 심 실 절제술
<ol><li>악기와 스폰지, tricaine 솔루션, 플라스틱 피 펫는 stereomicroscope, 2 개의 날카로운 집게, iridectomy가 위 작업으로 가득 페 트리 접시의 조각을 포함 하는 수술에 대 한 자료를 준비 하 고 팔꿈치 핀셋 (그림 1).</li>
	<li>심 실 절제술 수술 동안에 제 브라를 스펀지에 깊이 0.5 c m 4 c m x 0.5 c m 크기의 작은 홈 준비.</li>
	<li>채우기 3 L zebrafish 탱크 60 mg/L 바다를 사용 하 여 만든 zebrafish 시스템 물의 절반 탱크와 dH2O 부상된 물고기의 복구에 대 한 소금.</li>
	<li>길 움직임 초당 한 감소 시키고 적어도 30 물고기까지 10 cm 배양 접시 tricaine 솔루션 물고기 anesthetize 그것 완전히 마 취 되도록 s.</li>
	<li>최대 팔꿈치 핀셋으로 촉촉한 스폰지 복 부 측에 홈 마 취 생선을 전송. 시각적으로 뛰는 심장의 여백을 찾아서 다음는 stereomicroscope 아래 마음을 찾습니다.</li>
	<li>Iridectomy가 위를 사용 하 여 피부와 근육, 침투 약 1 mm의 작은 절 개를 하 게 그리고 조심 스럽게 마음을 액세스할 수 겸 팁 pericardial sac의은 빛 상피 층을 찢 어. 너무 깊이 마음 부상을 피하기 위해 캐비티에는 집게를 삽입 하지 마십시오. 참고:이 시점에서 광범위 한 출혈 방지를 염두에 두십시오. 발생 하면 광범위 한 출혈, 과도 한 출혈은 주로 마음에 실수로 부상으로 발생 하 고 그래서 잘못 된 결과 발생 합니다 이후 실험에서 물고기를 제외 합니다.</li>
	<li>날카로운 집게를 사용 하 여 비 지배적인 손을 가진 그것의 꼭대기를 부드럽게 눌러 또는 부드러운 복 부 압력을 적용 하 여는 심 실 노출. 그런 다음, 다른 손으로 iridectomy가 위를 사용 하 여 정점에 심 실 ~ 20%를 제거 합니다. 참고:이 시점에서 발생 한다 광범위 한 출혈 없음.</li>
	<li>젖은 냅킨을 사용 하 여 서 라도 응고, 전에 15-45 s에 대 한 상처 출혈으로 절 개를 커버 하 고 다시 시스템 물 탱크에 생선을 넣어. 참고: 그것은 절 개를 봉합 하는 데 필요한 아니다.</li>
	<li>물고기 1 분 이내 길 움직임을 차릴 다음 수영을 다시 시작 되었는지 확인 합니다. 물고기 50 후 길 움직임을 보여주지 않는 경우 물에 s 물고기 다시 활성 환기 때까지 플라스틱 피 펫을 사용 하 여 아가미로 물 분출에 의해 촉진.</li>
	<li>심 실 절제술 후 재활용 시스템에서 물고기를 유지 합니다. 참고: 특별 한 관심이 없는 일반 생선에 비해 필요 하다. 성인 제 브라 심 실 절제술의 사망률은 약 5-10%. 거의 모든 죽음은 수술 후 24 시간 이내에 발생합니다.</li>
</ol>3입니다. siRNA 캡슐화 된 나노 입자의 준비
<ol><li>F-팸4합성-말뚝-R9 dendrimer. 참고: f-팸4의 합성-말뚝-R9 dendrimer 자료37 일부 수정 이전에 설명 된 대로 수행 했다. Α, ω-dipyridyl disulfido 폴 리 에틸렌 글리콜 (Py-말뚝-Py)의 길이 siRNAs (그림 2B)의 보호를 극대화 하기 위해 1, 000의 분자량을 감소 되었다.</li>
	<li>G4.0 polyamidoamine (불리 PAMAM) 진공 건조 기를 사용 하 여 1 h를 45 ° C에서의 cystamine 코어의 10 mg을 건조 하 고 2 mL Dulbecco의 인산 염 버퍼 식 염 수 (DPBS, 셀 문화 응용 프로그램의 다양 한 사용 균형된 소금 솔루션)에 PAMAM 해산.</li>
	<li>1.7 mg tris(2-carboxyethyl) phosphine (TCEP) 1 ml DPBS 녹, 3.2에서 준비 PAMAM 솔루션 혼합이 고 8 h에 대 한 부드러운 교 반으로 실 온에서 두고. 참고: TCEP는 어 금 니 비율 초과 PAMAM의 이황화 결합 ten-fold.</li>
	<li>적용 하 여 과도 한 TCEP를 제거 합니다. DPBS 10 mL의 볼륨에 도달 위의 PAMAM TCEP 혼합물에 추가 하 고 솔루션 3 kDa MWCO (분자 무게 차단) 한 관으로 전송 됩니다. 15 분 동안 3000 g에서 원심 분리 후 컬렉션 튜브에서 솔루션을 삭제 합니다. 추가 DPBS 필터 장치에 10 mL와 부드럽게 피 펫 샘플을 여러 번 하 고 다시 원심. 4 번에 대해이 단계를 반복 합니다. 마지막 여과 후 필터 장치에서 샘플을 발음. 참고:이 단계의 제품 감소 PAMAM (f PAM4 불리).</li>
	<li>F-PAM4 솔루션 1 ml DPBS, 혼합 14 mg 평-말뚝-Py를 녹이 고 3 시간 실 온에서 부드러운 교 반으로 그것을 두고. 3.4에 설명 된 대로 적용 단계에 의해 제거 하 고 과도 한 평-말뚝-평. 마지막 여과 후 필터 장치에서 샘플을 발음. 참고: 제품 f-PAM4-말뚝-Py로 지명 된다. Py-말뚝-평의 금액은 10 f PAM4에서 thiol 그룹에 어 금 니 비율에서.</li>
	<li>디졸브의 시스테인 6.4 mg 1 ml DPBS R9 펩 티 드 (Ac-CRRRRRRRRR-NH2)를 종료, f-PAM4-말뚝-Py로 혼합 하 고 실 온에서 8 h 동안 부드럽게 저 어. 한 단계 제외 하 고는 DPBS 이온된 수로 변경 3.4에 설명 된 대로 f-PAM4-말뚝-R9, 호출한 최종 제품을 정화. 동결 진공 건조 기를 사용 하 여 제품을 lyophilize. 참고: 3.5와 3.6 동결은 전에 제품 적어도 1 개월-20 ℃에 저장 됩니다. F-PAM4-말뚝-R9 동결은 후 샘플 2 개월 이상-20 ℃에 저장 됩니다.</li>
	<li>수정이 고 펩 티 드의 정도 확인 하는 f-PAM4-말뚝-Py D2O (산화 중수소)의 5 밀리 그램을 녹이 고 NMR (핵자기공명) 샘플 튜브로 전송. 400 MHz에서 1 H NMR 스펙트럼 분석을 수행 하 고 NMR 데이터 분석 소프트웨어37을 사용 하 여 데이터를 분석. 참고: 특히, 대표 PAMAM 봉우리 (-NCH2CH2CO-), 페그 봉우리 (-OCH2CH2-), 그리고는 펩 티 드에 아르기닌 잔류물 봉우리 (-HCCH2CH2CH2NH-) 2.4-2.6, 3.7-3.8, 범위 및 1.6-1.8 ppm에 각각 있을 것으로 예상 된다. PAMAM 봉우리 고 R9 봉우리의 적분을 계산 하 여 말뚝과 R9는 PAMAM 기준의 변경의 정도 결정 합니다. 못의 수정 정도 100% 이며 R9 수정 적어도 50%. 1H NMR 스펙트럼 분석 기관의 핵심 시설에서 수행 됩니다.</li>
	<li>F-팸4분해-말뚝-R9 dendrimer 4 mg/mL PBS에 분말을 1 회 사용에 대 한 솔루션의 aliquots. 참고: dendrimer 솔루션 저장할 수 있습니다-20 ° C에서 한 달 이상에 대 한 중지 및 재개를 반복 하지 않고.</li>
	<li>Cyanine 염료 표시 siRNAs (Cy5-siRNA 불리), Aldh1a2 siRNA 또는 스크램블된 부정적인 제어 siRNA 10 µ M 증류수에 용 해. 참고: 나노 캡슐화 siRNA 물고기 마음 (그림 2A-B)를 입력할 수 있는지 여부를 평가 하 cyanine 염료 표시 siRNAs를 사용 합니다. 이 프로토콜 f-PAM4-말뚝-R9 dendrimer 캡슐화 siRNA 전달의 효율성을 결정 하는 예 진으로 aldh1a2 를 사용 합니다. siRNAs의 순서는: Cy5-siRNA 센스 가닥: 5 '-ACGUGACACGUUCGGAGAAdTdT-3, siAldh1a2 센스 가닥: 5'-UUCAGGACAACCGUGUUCCdTdT-3'와 뒤섞여 부정적인 제어 siRNA 센스 가닥: 5'-ACGUGACACGUUCGGAGAAdTdT-3'.</li>
	<li>20 분에 대 한 실 온에서 샘플은 갓 siRNA 캡슐화 나노 솔루션을 준비, siRNA dendrimer 솔루션의 동등한 양으로 혼합 품 어을 사용 하기 전에 siRNA 나노 솔루션 준비 하 고. 참고: siRNA 캡슐화 나노 솔루션의 볼륨을 주입 하려고 하는 물고기의 수에 따라 달라 집니다. 예를 들어 10 생선 생선 당 (~ 10 µ L)의 주입을 위해 적어도 120 µ L dendrimer 솔루션 (믹스 60 µ L siRNA 솔루션 및 60 µ L dendrimer 솔루션)를 준비 솔루션의 손실에서.</li>
</ol>4. 성인 Zebrafish 마음에 siRNA 캡슐화 된 나노 입자의 주입
<ol><li>위에서 설명한 대로 홈, tricaine 솔루션, 플라스틱 피 펫는 stereomicroscope, 팔꿈치 핀셋, 그리고 인슐린 주사기 (그림 1) 가득 10 cm 배양 접시와 스폰지의 조각 시스템과 물고기 탱크 뿐만 아니라 물을 준비 주택에 주입 후 물고기.</li>
	<li>심 실 절제술 후 1 일에 대 한 복구 단계 2.1-2.10에에서 준비가 부상된 zebrafish를 허용 하 고 tricaine 솔루션 2.4에 설명 된 대로 1 dpa (일 후 절단) 물고기를 anesthetize.</li>
	<li>마 취 물고기, 복 부 쪽, 팔꿈치 핀셋을 사용 하 여 촉촉한 스폰지에 홈에 전송 합니다. stereomicroscope에서 뛰는 심장을 찾습니다.</li>
	<li>인슐린 주사기를 siRNA로 캡슐화 된 나노 솔루션의 10 µ L를 로드 합니다. 가능한 한 많은 거품을 하지 마십시오.</li>
	<li>부드럽게 비 지배적인 손 가진 흉부 영역을 팔꿈치 핀셋을 사용 하 여 물고기를 무력화. 생선을 너무 단단히 클램프 하지 마십시오. 참고: 주사 동안 발생 한다 아무 광범위 한 출혈 하는 명심 하십시오.</li>
	<li>~ 30 °에서 채워진된 인슐린 주사기를 누른 다른 손 (보충 그림 1)를 사용 하 여 흉 강에 솔루션의 ~ 10 µ L를 주입 합니다. 참고: 솔루션 때때로 주입, 동안 밖으로 흐르는 하지만이 siRNA 효과 영향을 주지 않습니다. SiRNA 나노 솔루션 특정 실험 계획에 따라 한 달에 몇 일 동안 하루에 한 번 주입 수 있습니다. 때마다 siRNA의 한 유형으로는 생선을 주사. SiRNA의 두 개 이상의 종류 한 물고기 투입 될 필요가 있는 경우 주사 한 가지 유형의 siRNA 때마다, 그리고 주사 siRNA 1 h 나중의 다른 종류. 이 프로토콜에서 물고기 당 siRNA의 한 유형을 주입 했다.</li>
	<li>시스템 물 탱크에 있는 물고기를 전송 합니다. 참고: 물고기는 1 분 안에 환기를 다시 시작 하 고 수영을 다시 시작 것으로 예상. SiRNA 캡슐화 된 나노 입자 또는 siRNA의 주사는 일반적으로 성인 zebrafish에 죽음을 발생 하지 않습니다.</li>
</ol>5. 심장 컬렉션, 고정, 및 siRNA 전달의 효율성 평가
<ol><li>각 그룹에 대 한 microcentrifuge 관에 4 %paraformaldehyde 솔루션의 1 mL를 준비 합니다.</li>
	<li>주사 후 선택한 일에 tricaine 솔루션에서 물고기를 anesthetize. 촉촉한 스폰지에 홈에 supinely 물고기를 놓습니다. 흉부에 큰 절 개를 하 게 하 고 널리는 핀셋으로 엽니다. 유출 관을 핀셋으로 신중 하 게 온 마음을 꺼내.</li>
	<li>PBS 가진 마음을 헹 구 고 빠르게 냅킨으로 여분 액체를 제거. 1.5 mL 튜브 microcentrifuge 1 mL paraformaldehyde로 10 마음을 넣어. 부드럽게 튜브를 여러 번, 반전 하 고 하룻밤 4 ° c.에 유지</li>
	<li>Cy5 siRNAs 주입 하트는 vivo에서 이미징 시스템 (보충 그림 2)를 사용 하 여 형광 강도 측정 합니다. 이 연구에서는 각 그룹에 대 한 3-4 zebrafish 마음을 사용 합니다.</li>
	<li>파라핀 또는 10 월 복합 (동결 조직 표본을 최적의 절삭 온도 대 한 매체 포함) 고정된 마음을 탑재 합니다.</li>
</ol>6. 나노 중재 siRNA 유전자 침묵의 평가
<ol><li>절연된 컨테이너와 긴 핀셋을 준비 합니다. 컨테이너의 볼륨의 세 번째를 액체 질소에 붓는 다.</li>
	<li>물고기 2 dpa에 tricaine 솔루션 anesthetize 5.2에 설명 된 대로 마음을 해 부하 고 유출 관 및 아 트리 움 제거. 참고: 물고기 하루에 수술에서 복구할 수 있습니다 그리고 중 스크램블된 siRNA 캡슐화 된 나노 입자 (싱크)와 1 dpa에는 부정적인 제어 또는 aldh1a2 siRNA 캡슐화 된 나노 입자 (siAldh1a2)로 주입.</li>
	<li>심 핀셋을 사용 하 여 1.5 mL microcentrifuge 튜브로 전송, 튜브 뚜껑을 커버 하 고 즉시 액체 질소로 절연된 용기에 튜브를 배치. 긴 핀셋을 사용 하 여 컨테이너에서 튜브를 제거 하는 몇 분에 대 한 액체 질소에 튜브 플 로트 보자.</li>
	<li>6.2, 6.3 단계를 반복 하 여 모든 심 수집 됩니다. 6-10 마음을 사용 하 여 각 그룹에 대 한.</li>
	<li>RNA 분리 시 약으로 마음의 총 RNA를 추출 합니다. 양적 RT-PCR에 의해 각각 유전자의 식 수준을 평가 뇌관 Gapdh f: GATACACGGAGCACCAGGTT;를 사용 하 여 Gapdh r: GCCATCAGGTCACATACACG; Aldh1a2 f: TGAGCGAGGAGCAGCAGAGA; Aldh1a2 r: TCCACGAAGAAGCCTTTAGTAGCA입니다.</li>
</ol>

저자는 공개 없다.

Zebrafish는 완전히 성인 심장5를 포함 하는 기관의 다양 한 재생 가능 하다. 유전자 변형 및 유전자 메서드는 zebrafish의 배아에서 유전자 기능을 연구 개발, 조사 zebrafish45,46에서 생성 하는 조건부 돌연변이 체 대립 유전자의 발굴 작업으로 아직도 직면 된다. 따라서, 유전자 변형 지배적인 부정적인 돌연변이 또는 작은 분자 억제제 자주 ?...

심근 경색은 세계1주위 엄청난 경제적 부담으로 이어지는 주요 건강 위협이 되었다. 성인 포유류 심장 재생성 하 고 거시적인 규모 손실된 cardiomyocytes 흉터 조직 및 후속 심장 마비의 형성으로 이어지는 부상 후 보충 되지 않습니다. 포유류, 달리는 제 브라는 주로 심장 상해, 조사 심장 재생 의 분자 메커니즘에 대 한 이상적인 모델 유기 체 그것을 만들기의 다른 유형 후에 강력한 심근 확산을 통해 심장 재생 2,3,,45,6,,78. 해독 생 메커니즘 기본 zebrafish 심장 재생 인간의 심장 재생9를 개선 하기 위해 새로운 치료 전략에 대 한 검색에 있는 연구의 흥미로운 지역입니다.
유전자 조작 방법 zebrafish에 사용할 수 있습니다. 개구리, 병아리, 그리고 zebrafish10,11,,1213포유류 외에 널리 사용 되는 morpholinos (MO) 이들에 의하여 이루어져 있다. 모 성인 zebrafish 지 느 러 미, 뇌, 그리고 망막14,15,16,17,,1819에 대상 유전자 발현의 효율적인 최저가 있다. 잠겨-핵 산 (LNA)는 내 생 유전자 표현의 zebrafish 태아 뿐만 아니라 성인 동물 장기20,,2122, 에 노크를 사용 하는 다른 인공 oligonucleotide 23 , 그러나 24. 성인 마음에 대 한 효과적인 손실의 기능 방법의 부족 장기 중생의 분자 메커니즘을 공부에 장애를 유지 하는. 현재, 작은 분자 억제제 또는 지배적인 부정적인 돌연변이의 유전자 변형 식에서 주로 사용 특정 유전자 또는 성인 zebrafish 심장 재생25,26에에서 그것의 기능을 공부 하는 통로의 기능을 차단 하 ,27. 그러나, 모든 유전자 또는 신호 통로 이러한 방법에 대 한 적용.
작은 방해 RNAs (siRNAs)는 널리 사용 포유류 세포에 모형 유기 체 뿐만 아니라 성인 장기의 배아 손실의 기능 분석에 대 한 동물에서 전 임상 연구 모델28,,2930 , 31 , 32. siRNAs 종양33,,3435 그리고 cardiomyocytes36,,3738,39 유전자 침묵을 효과적으로 사용 되었습니다 ,40 다른 배달 시스템을 통해. 최근, 우리 개발 효율적인 siRNA로 캡슐화 된 나노 유전자-침묵 여러 다른 나노 입자41,,4243를 사용 하 여 재생 성인 심장에 대 한 새로운 도구를 제공 하 성인 zebrafish 장기에서 유전자의 기능 연구입니다. 우리의 이전 연구41,,4243을 바탕으로, 여기에 우리가 현재 siRNA 유전자 f PAMAM 페그-r 9을 사용 하 여 재생 성인 zebrafish 마음에 입을 위한 단순, 실용적인, 하지만 강력한 프로토콜 dendrimers입니다. Aldh1a2 (알데하이드 효소 1, 가족 A2) 유전자 upregulated zebrafish 정점 절제 후 되었고 Aldh1a2 의 제거 차단 심장 재생44. 여기 우리가 나노 캡슐화 siRNA 주입 하 여 중재 유전자 때 려 눕 힘 효율성을 테스트 하는 예제로 aldh1a2 유전자를 가져가 라. 이 프로토콜은 성인 zebrafish 마음에 zebrafish 심장 절제, 나노 입자의 화학 합성 siRNA 캡슐화 된 나노 입자에 전달 방법에 대 한 절차를 포함합니다.

<table><tbody><tr><td>tricaine</td><td>Sigma</td><td>E10521</td><td>Store at 4 &amp;deg;C</td></tr><tr><td>stereomicroscope</td><td>Leica&amp;nbsp;</td><td>S8AP0</td><td></td></tr><tr><td>sharp forcep</td><td>WPI</td><td>14098</td><td></td></tr><tr><td>iridectomy scissors</td><td>WPI</td><td>501778</td><td></td></tr><tr><td>elbow tweezers</td><td>Suzhou Liuliu</td><td>SE05Cr</td><td></td></tr><tr><td>&amp;alpha;,&amp;omega;-dipyridyl disulfido polyethylene glycol(Py-PEG-Py)</td><td>Biomatrik (Jiaxing) Inc.</td><td>5239</td><td></td></tr><tr><td>core of G4.0 polyamidoamine (PAMAM)</td><td>Andrews ChemServices</td><td>AuCS-297</td><td></td></tr><tr><td>vacuum drying equipment</td><td>Yiheng</td><td>DZF-6020</td><td></td></tr><tr><td>Dulbecco&#039;s phosphate-buffered saline (DPBS)</td><td>Gibco</td><td>14190144</td><td></td></tr><tr><td>tris(2-carboxyethyl)phosphine(TCEP)</td><td>Alfar Aesar</td><td>51805-45-9</td><td>Causes severe skin burns and eye damage. Causes serious eye damage.</td></tr><tr><td>ultrafiltration tube</td><td>Millipore</td><td>UFC900308</td><td></td></tr><tr><td>freeze dryer</td><td>Martin Christ</td><td>Alpha 2-4 Ldplus</td><td></td></tr><tr><td>NMR spectrometer</td><td>Bruker</td><td>AV400</td><td></td></tr><tr><td>Deuterium oxide(D&lt;sub&gt;2&lt;/sub&gt;O)</td><td>J&amp;amp;K</td><td>174611</td><td></td></tr><tr><td>NMR sample tube</td><td>J&amp;amp;K</td><td>WG-1000-7-50</td><td></td></tr><tr><td>3 kDa MWCO ultrafiltration tube</td><td>Merck</td><td>UFC900308</td><td></td></tr><tr><td>sea salts</td><td>Instant Ocean&amp;reg;</td><td>SS15-10</td><td></td></tr></tbody></table>

nanoparticle-mediated sirna gene-silencing in adult zebrafish heart

포유류 심근 경색 후 심 혼을 회생 하는 매우 제한 된 용량을가지고. 다른 한편으로, 성인 zebrafish 정점 절제 또는 cryoinjury, 그것에 게 심장 재생 연구에 대 한 중요 한 모형 유기 체를 만드는 후 그것의 심 혼을 재생성 합니다. 그러나, 성인 기관에 대 한 손실의 기능 방법의 부족은 심장 재생을 기본 메커니즘에 대 한 통찰력을 제한 했다. 다른 배달 시스템을 통해 RNA 간섭 포유류 세포 및 모형 유기 체에서 유전자 침묵 시키기를 위한 강력한 도구입니다. 우리 이전 siRNA 캡슐화 된 나노 성공적으로 셀 입력 및 재생 성인 zebrafish 마음에 놀라운 유전자 특정 최저에서 결과 보고 있다. 여기, 우리는 재생 성인 zebrafish 마음에 dendrimer 중재 siRNA 전달 및 유전자 침묵에 대 한 간단한 빠르고 효율적인 프로토콜을 제시. 이 메서드 zebrafish 성인 기관에서 유전자 기능을 결정 하기 위한 다른 접근을 제공 하 고 뿐만 아니라 다른 모델 유기 체에 확장 될 수 있습니다.

Dendrimer 중재 siRNA 전달의 효율성을 확인 하려면 우리 zebrafish 심장의 심 실의 꼭대기를 절제 후 약 10 µ L dendrimer만의 (모의 그룹), Cy5 siRNA만 (벌 거 벗은 그룹), 또는 f-PAMAM-말뚝-R9 dendrimer 캡슐을 주입 Cy5-siRNA (Cy5-siRNA 그룹) intrapleurally, 각각 (그림 2A-B). 형광 신호는 dendrimer 캡슐화 Cy5-siRNA 3, 24, 48 hpi (시간 후 주입)에 주사 하는 마음에서 감지 4...

Watch this Scientific Journal Video about Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart at JoVE.com

Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart

나노-중재 siRNA 유전자 입을 성인 Zebrafish 마음에

조건부 유전자 녹아웃 또는 효과적인 유전자-최저 성인 zebrafish 장기를 개발 하는 주요 도전 남아 있다. 여기 우리 보고 수행 나노 중재 siRNA 유전자-성인 zebrafish 마음에 입을, 성인 기관 zebrafish 및 다른 모형 유기 체 공부에 대 한 새로운 기능 손실 방법 제공에 대 한 프로토콜.

Mammals have a very limited capacity to regenerate the heart after myocardial infarction. On the other hand, the adult zebrafish regenerates its heart ...

nanoparticle-mediated-sirna-gene-silencing-in-adult-zebrafish-heart

Research

JoVE Journal

Developmental Biology

8.1K 조회수.  Peking University. 조건부 유전자 녹아웃 또는 효과적인 유전자-최저 성인 zebrafish 장기를 개발 하는 주요 도전 남아 있다. 여기 우리 보고 수행 나노 중재 siRNA 유전자-성인 zebrafish 마음에 입을, 성인 기관 zebrafish 및 다른 모형 유기 체 공부에 대 한 새로운 기능 손실 방법 제공에 대 한 프로토콜.

비디오: Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart

Large-scale Zebrafish Embryonic Heart Dissection for Transcriptional Analysis

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the cardiac transcriptome from being masked by the global embryonic transcriptome, it is necessary to collect sufficient numbers of hearts for further analyses. Furthermore, as zebrafish cardiac development proceeds rapidly, heart collection and RNA extraction methods need to be quick in order to ensure homogeneity of the samples. Here, we present a rapid manual dissection protocol for collecting functional/beating hearts from zebrafish embryos. This is an essential prerequisite for subsequent cardiac-specific RNA extraction to determine cardiac-specific gene expression levels by transcriptome analyses, such as quantitative real-time polymerase chain reaction (RT-qPCR). The method is based on differential adhesive properties of the zebrafish embryonic heart compared with other tissues; this allows for the rapid physical separation of cardiac from extracardiac tissue by a combination of fluidic shear force disruption, stepwise filtration and manual collection of transgenic fluorescently labeled hearts.

To analyse cardiac gene expression profiles during zebrafish heart development, total RNA has to be extracted from isolated hearts. Here, we present a protocol for collecting functional/beating hearts by rapid manual dissection from zebrafish embryos to obtain cardiac-specific mRNA.

전사 분석을위한 대규모 Zebrafish의 배아 심장의 해부

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the ...

연구

발생학

Induction of Myocardial Infarction in Adult Zebrafish Using Cryoinjury

The mammalian heart is incapable of significant regeneration following an acute injury such as myocardial infarction1. By contrast, urodele amphibians and teleost fish retain a remarkable capacity for cardiac regeneration with little or no scarring throughout life2,3. It is not known why only some non-mammalian vertebrates can recreate a complete organ from remnant tissues4,5. To understand the molecular and cellular differences between regenerative responses in different species, we need to use similar approaches for inducing acute injuries.
In mammals, the most frequently used model to study cardiac repair has been acute ischemia after a ligation of the coronary artery or tissue destruction after cryoinjury6,7. The cardiac regeneration in newts and zebrafish has been predominantly studied after a partial resection of the ventricular apex2,3. Recently, several groups have established the cryoinjury technique in adult zebrafish8-10. This method has a great potential because it allows a comparative discussion of the results obtained from the mammalian and non-mammalian species.
Here, we present a method to induce a reproducible disc-shaped infarct of the zebrafish ventricle by cryoinjury. This injury model is based on rapid freezing-thawing tissue, which results in massive cell death of about 20% of cardiomyocytes of the ventricular wall. First, a small incision was made through the chest with iridectomy scissors to access the heart. The ventricular wall was directly frozen by applying for 23-25 seconds a stainless steel cryoprobe precooled in liquid nitrogen. To stop the freezing of the heart, fish water at room temperature was dropped on the tip of the cryoprobe. The procedure is well tolerated by animals, with a survival rate of 95%.
To characterize the regenerative process, the hearts were collected and fixed at different days after cryoinjury. Subsequently, the specimen were embedded for cryosectioning. The slides with sections were processed for histological analysis, in situ hybridization and immunofluorescence. This undertaking enhances our understanding of the factors that are required for the regenerative plasticity in the zebrafish, and provide new insights into the machinery of cardiac regeneration. A conceptual and molecular understanding of heart regeneration in zebrafish will impact both developmental biology and regenerative medicine.

Zebrafish represents a valuable model to study the mechanisms of heart regeneration in vertebrates. Here, we present a protocol for induction of a heart infarct in adult zebrafish using cryoinjury. This method results in massive cell death within 20% of the ventricular wall, similar to that observed in mammalian infarcts.

성인 Zebrafish에서 심근 경색의 유도는 Cryoinjury 사용

The mammalian heart is incapable of significant regeneration following an acute injury such as myocardial infarction1. By contrast, urodele amphibians and ...

의학

Micromanipulation of Gene Expression in the Adult Zebrafish Brain Using Cerebroventricular Microinjection of Morpholino Oligonucleotides

Manipulation of gene expression in tissues is required to perform functional studies. In this paper, we demonstrate the cerebroventricular microinjection (CVMI) technique as a means to modulate gene expression in the adult zebrafish brain. By using CVMI, substances can be administered into the cerebroventricular fluid and be thoroughly distributed along the rostrocaudal axis of the brain. We particularly focus on the use of antisense morpholino oligonucleotides, which are potent tools for knocking down gene expression in vivo. In our method, when applied, morpholino molecules are taken up by the cells lining the ventricular surface. These cells include the radial glial cells, which act as neurogenic progenitors. Therefore, knocking down gene expression in the radial glial cells is of utmost importance to analyze the widespread neurogenesis response in zebrafish, and also would provide insight into how vertebrates could sustain adult neurogenesis response. Such an understanding would also help the efforts for clinical applications in human neurodegenerative disorders and central nervous system regeneration. Thus, we present the cerebroventricular microinjection method as a quick and efficient way to alter gene expression and neurogenesis response in the adult zebrafish forebrain. We also provide troubleshooting tips and other useful information on how to carry out the CVMI procedure.

In this article, we demonstrate a method for manipulation of gene expression in the ventricular cells of the adult zebrafish telencephalon using antisense morpholino oligonucleotides. We present this method as an efficient and quick protocol that can be used for functional studies in the adult vertebrate brain.

모르 올리고 뉴클레오티드의 Cerebroventricular 미세 주입을 사용하여 성인 Zebrafish의 두뇌에서 유전자 발현의 미세 조작

Manipulation of gene expression in tissues is  required to perform functional studies. In this paper, we demonstrate the  cerebroventricular ...

신경과학

High-Frequency Ultrasound Echocardiography to Assess Zebrafish Cardiac Function

The zebrafish (Danio rerio) has become a very popular model organism in cardiovascular research, including human cardiac diseases, largely due to its embryonic transparency, genetic tractability, and amenity to rapid, high-throughput studies. However, the loss of transparency limits heart function analysis at the adult stage, which complicates modeling of age-related heart conditions. To overcome such limitations, high-frequency ultrasound echocardiography in zebrafish is emerging as a viable option. Here, we present a detailed protocol to assess cardiac function in adult zebrafish by non-invasive echocardiography using high-frequency ultrasound. The method allows visualization and analysis of zebrafish heart dimension and quantification of important functional parameters, including heart rate, stroke volume, cardiac output, and ejection fraction. In this method, the fish are anesthetized and kept underwater and can be recovered after the procedure. Although high-frequency ultrasound is an expensive technology, the same imaging platform can be used for different species (e.g., murine and zebrafish) by adapting different transducers. Zebrafish echocardiography is a robust method for cardiac phenotyping, useful in the validation and characterization of disease models, particularly late-onset diseases; drug screens; and studies of heart injury, recovery, and regenerative capacity.

We describe a protocol to assess heart morphology and function in adult zebrafish using high-frequency echocardiography. The method allows visualization of the heart and subsequent quantification of functional parameters, such as heart rate (HR), cardiac output (CO), fractional area change (FAC), ejection fraction (EF), and blood inflow and outflow velocities.

제브라피시 심장 기능을 평가하는 고주파 초음파 심초음파

The zebrafish (Danio rerio) has become a very popular model organism in cardiovascular research, including human cardiac diseases, largely due to its ...

Design and Microinjection of Morpholino Antisense Oligonucleotides and mRNA into Zebrafish Embryos to Elucidate Specific Gene Function in Heart Development

The morpholino oligomer-based knockdown system has been used to identify the function of various gene products through loss or reduced expression. Morpholinos (MOs) have the advantage in biological stability over DNA oligos because they are not susceptible to enzymatic degradation. For optimal effectiveness, MOs are injected into 1-4 cell stage embryos. The temporal efficacy of knockdown is variable, but MOs are believed to lose their effects due to dilution eventually. Morpholino dilution and injection amount should be closely controlled to minimize the occurrence of off-target effects while maintaining on-target efficacy. Additional complementary tools, such as CRISPR/Cas9 should be performed against the target gene of interest to generate mutant lines and to confirm the morphant phenotype with these lines. This article will demonstrate how to design, prepare, and microinject a translation-blocking morpholino against hand2 into the yolk of 1-4 cell stage zebrafish embryos to knockdown hand2 function and rescue these "morphants" by co-injection of mRNA encoding the corresponding cDNA. Subsequently, the efficacy of the morpholino microinjections is assessed by first verifying the presence of morpholino in the yolk (co-injected with phenol red) and then by phenotypic analysis. Moreover, cardiac functional analysis to test for knockdown efficacy will be discussed. Finally, assessing the effect of morpholino-induced blockage of gene translation via western blotting will be explained.

<meta charset="utf8"></head><body>심장 발달의 특정 유전자 기능을 규명하기 위해 제브라피시 배아에 Morpholino Antisense 올리고뉴클레오티드 및 mRNA의 설계 및 미세주입

The present protocol describes designing, preparing, and microinjecting a translational-blocking morpholino against a representative cardiac gene; Heart And Neural Crest Derivatives Expressed2 (hand2) into the yolk of newly fertilized zebrafish embryos to knock down gene function. It also shows a transient rescue of these "morphants" by co-injection of mRNA encoding this gene product.

심장 발달의 특정 유전자 기능을 규명하기 위해 제브라피시 배아에 Morpholino Antisense 올리고뉴클레오티드 및 mRNA의 설계 및 미세주입

The morpholino oligomer-based knockdown system has been used to identify the function of various gene products through loss or reduced expression.  ...

In vivo Electroporation of Morpholinos into the Regenerating Adult Zebrafish Tail Fin

Certain species of urodeles and teleost fish can regenerate their tissues. Zebrafish have become a widely used model to study the spontaneous regeneration of adult tissues, such as the heart1, retina2, spinal cord3, optic nerve4, sensory hair cells5, and fins6.
The zebrafish fin is a relatively simple appendage that is easily manipulated to study multiple stages in epimorphic regeneration. Classically, fin regeneration was characterized by three distinct stages: wound healing, blastema formation, and fin outgrowth. After amputating part of the fin, the surrounding epithelium proliferates and migrates over the wound. At 33 &deg;C, this process occurs within six hours post-amputation (hpa, Figure 1B)6,7. Next, underlying cells from different lineages (ex. bone, blood, glia, fibroblast) re-enter the cell cycle to form a proliferative blastema, while the overlying epidermis continues to proliferate (Figure 1D)8. Outgrowth occurs as cells proximal to the blastema re-differentiate into their respective lineages to form new tissue (Figure 1E)8. Depending on the level of the amputation, full regeneration is completed in a week to a month.
The expression of a large number of gene families, including wnt, hox, fgf, msx, retinoic acid, shh, notch, bmp, and activin-betaA genes, is up-regulated during specific stages of fin regeneration9-16. However, the roles of these genes and their encoded proteins during regeneration have been difficult to assess, unless a specific inhibitor for the protein exists13, a temperature-sensitive mutant exists or a transgenic animal (either overexpressing the wild-type protein or a dominant-negative protein) was generated7,12. We developed a reverse genetic technique to quickly and easily test the function of any gene during fin regeneration.
Morpholino oligonucleotides are widely used to study loss of specific proteins during zebrafish, Xenopus, chick, and mouse development17-19. Morpholinos basepair with a complementary RNA sequence to either block pre-mRNA splicing or mRNA translation. We describe a method to efficiently introduce fluorescein-tagged antisense morpholinos into regenerating zebrafish fins to knockdown expression of the target protein. The morpholino is micro-injected into each blastema of the regenerating zebrafish tail fin and electroporated into the surrounding cells. Fluorescein provides the charge to electroporate the morpholino and to visualize the morpholino in the fin tissue.
This protocol permits conditional protein knockdown to examine the role of specific proteins during regenerative fin outgrowth. In the Discussion, we describe how this approach can be adapted to study the role of specific proteins during wound healing or blastema formation, as well as a potential marker of cell migration during blastema formation.

In vivo Electroporation of Morpholinos into the Regenerating Adult Zebrafish Tail Fin

We describe a method to conditionally knockdown the expression of a target protein during adult zebrafish fin regeneration. This technique involves micro-injecting and electroporating antisense oligonucleotide morpholinos into fin tissue, which allows testing the protein&#x2019;s role in various stages of fin regeneration, including wound healing, blastema formation, and regenerative outgrowth.

생성중 성인 Zebrafish 테일 핀으로 Morpholinos의 생체내 Electroporation에

Certain species of urodeles and teleost fish can regenerate their tissues. Zebrafish have become a widely used model to study the spontaneous regeneration ...

생물학

A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish

The genetically accessible adult zebrafish (Danio rerio) has been increasingly used as a vertebrate model for understanding human diseases such as cardiomyopathy. Because of its convenience and amenability to high throughput genetic manipulations, the generation of acquired cardiomyopathy models, such as the doxorubicin-induced cardiomyopathy (DIC) model in adult zebrafish, is opening the doors to new research avenues, including discovering cardiomyopathy modifiers via forward genetic screening. Different from the embryonic zebrafish DIC model, both initial acute and later chronic phases of cardiomyopathy can be determined in the adult zebrafish DIC model, enabling the study of stage-dependent signaling mechanisms and therapeutic strategies. However, variable results can be obtained with the current model, even in the hands of experienced investigators. To facilitate future implementation of the DIC model, we present a detailed protocol on how to generate this DIC model in adult zebrafish and describe two alternative ways of intraperitoneal (IP) injection. We further discuss options on how to reduce variations to obtain reliable results and provide suggestions on how to appropriately interpret the results.

A method to generate a doxorubicin-induced cardiomyopathy model in adult zebrafish (Danio rerio) is described here. Two alternative ways of intraperitoneal injection are presented and conditions to reduce variations among different experimental groups are discussed.

성인 제 브라에서 독 소 루비 유발 심근 모델

The genetically accessible adult zebrafish (Danio rerio) has been increasingly used as a vertebrate model for understanding human diseases such as ...

Recovery of Adult Zebrafish Hearts for High-throughput Applications

Use of the zebrafish model system for studying development, regeneration, and disease is expanding toward use of adult hearts for cell dissociation and purification of RNA, DNA, and proteins. All of these applications demand the rapid recovery of significant numbers of zebrafish hearts to avoid gene regulatory, metabolic, and other changes that begin after death. Adult zebrafish hearts are also required for studying heart structure for a variety of mutants and for studying heart regeneration. However, the traditional zebrafish heart dissection is slow and difficult and requires specialized tools, making large-scale dissection of adult zebrafish hearts tedious. Traditional methods also harbor the risk of damaging the heart during the dissection. Here, we describe a method for dissection of adult zebrafish hearts that is fast, reproducible, and preserves heart architecture. Furthermore, this method does not require specialized tools, is painless for the zebrafish, can be performed on fresh or fixed specimens, and can be performed on zebrafish as young as one month old. The approach described expands the use of adult zebrafish for cardiovascular research.

Use of zebrafish for cardiovascular research is expanding towards research on adult hearts. For these applications, quick and simple isolation of cardiac tissues is key to avoid post-mortem changes and to obtain an adequate number of samples. Here, we describe a fast and reproducible method for dissecting adult zebrafish hearts.

높은 처리량 응용 프로그램에 대한 성인 Zebrafish의 마음의 복구

Use of the zebrafish model system for studying development, regeneration, and disease is expanding toward use of adult hearts for cell dissociation and ...

Intrathoracic Injection for the Study of Adult Zebrafish Heart

The adult zebrafish heart provides a powerful model in cardiac regeneration research. Although the strength of this system is based on transgenic approaches, a rapid delivery of exogenous factors provides a complementary technique in functional studies. Here, we present a method that relies on administration of a few microliters of solution into the pericardial cavity without causing myocardial damage. Intrathoracic (IT) injections can efficiently deliver proteins and chemical compounds directly onto the heart surface. The injected substances diffuse through the epicardium into the underlying cardiac tissues. Compared to intraperitoneal (IP) injections, the main advantage of intrathoracic injections is the focal administration of the tested factors on the target organ. The delivery of molecules directly into the pericardium is a suitable strategy for studies of cardiac preconditioning and regeneration in adult zebrafish.

This method relies on the injection of 0.5&#8722;3 &#956;L of solution into the thorax of adult zebrafish. The procedure efficiently delivers proteins and chemical compounds into the proximity of the zebrafish heart without damaging the organ. The approach is suitable for testing effects of exogenous factors on various tissues of the heart.

나노-중재 siRNA 유전자 입을 성인 Zebrafish 마음에

요약

더 많은 비디오 탐색

전사 분석을위한 대규모 Zebrafish의 배아 심장의 해부

성인 Zebrafish에서 심근 경색의 유도는 Cryoinjury 사용

모르 올리고 뉴클레오티드의 Cerebroventricular 미세 주입을 사용하여 성인 Zebrafish의 두뇌에서 유전자 발현의 미세 조작

제브라피시 심장 기능을 평가하는 고주파 초음파 심초음파

심장 발달의 특정 유전자 기능을 규명하기 위해 제브라피시 배아에 Morpholino Antisense 올리고뉴클레오티드 및 mRNA의 설계 및 미세주입

심장 발달의 특정 유전자 기능을 규명하기 위해 제브라피시 배아에 Morpholino Antisense 올리고뉴클레오티드 및 mRNA의 설계 및 미세주입

생성중 성인 Zebrafish 테일 핀으로 Morpholinos의 생체내 Electroporation에

성인 제 브라에서 독 소 루비 유발 심근 모델

높은 처리량 응용 프로그램에 대한 성인 Zebrafish의 마음의 복구

성인 제 브라 피시 하트 연구를 위한 흉부 내 주사