저자는 중요 한 의견에 대 한 박사 IC 브루스를 감사 하 고 원고를 읽고. 이 작품은 국립 자연 과학 재단의 중국 (31430059, 31701272, 31730061, 81470399, 및 31521062), 아 스 트 라 아시아 및 신흥 시장 혁신적인 의학 및 초기 발달에서 교부 금에 의해 지원 되었다.

모든 동물 절차는 기관 동물 관리 및 사용 위원회 평가 및 실험 동물 관리 인증 협회 인증는 북경 대학에서 승인한 zebrafish 프로토콜 사용.
1입니다. Tricaine 솔루션의 준비
<ol><li>Tricaine 재고 솔루션을 준비 하려면 97.9 mL 증 류 물, 400mg 에틸 3 aminobenzoate methanesulfonate 분말을 추가 하 고 2.1 mL 1 M 트리 스 (pH 9.5) ~ 7 pH 조정의 추가. 4 ° c.에 재고 솔루션 저장</li>
	<li>Tricaine 작업 솔루션을 준비, 100 mL 수족관 시스템 물 4.2 mL tricaine 재고 솔루션을 추가 합니다.</li>
</ol>2. 성인 Zebrafish 심 실 절제술
<ol><li>악기와 스폰지, tricaine 솔루션, 플라스틱 피 펫는 stereomicroscope, 2 개의 날카로운 집게, iridectomy가 위 작업으로 가득 페 트리 접시의 조각을 포함 하는 수술에 대 한 자료를 준비 하 고 팔꿈치 핀셋 (그림 1).</li>
	<li>심 실 절제술 수술 동안에 제 브라를 스펀지에 깊이 0.5 c m 4 c m x 0.5 c m 크기의 작은 홈 준비.</li>
	<li>채우기 3 L zebrafish 탱크 60 mg/L 바다를 사용 하 여 만든 zebrafish 시스템 물의 절반 탱크와 dH2O 부상된 물고기의 복구에 대 한 소금.</li>
	<li>길 움직임 초당 한 감소 시키고 적어도 30 물고기까지 10 cm 배양 접시 tricaine 솔루션 물고기 anesthetize 그것 완전히 마 취 되도록 s.</li>
	<li>최대 팔꿈치 핀셋으로 촉촉한 스폰지 복 부 측에 홈 마 취 생선을 전송. 시각적으로 뛰는 심장의 여백을 찾아서 다음는 stereomicroscope 아래 마음을 찾습니다.</li>
	<li>Iridectomy가 위를 사용 하 여 피부와 근육, 침투 약 1 mm의 작은 절 개를 하 게 그리고 조심 스럽게 마음을 액세스할 수 겸 팁 pericardial sac의은 빛 상피 층을 찢 어. 너무 깊이 마음 부상을 피하기 위해 캐비티에는 집게를 삽입 하지 마십시오. 참고:이 시점에서 광범위 한 출혈 방지를 염두에 두십시오. 발생 하면 광범위 한 출혈, 과도 한 출혈은 주로 마음에 실수로 부상으로 발생 하 고 그래서 잘못 된 결과 발생 합니다 이후 실험에서 물고기를 제외 합니다.</li>
	<li>날카로운 집게를 사용 하 여 비 지배적인 손을 가진 그것의 꼭대기를 부드럽게 눌러 또는 부드러운 복 부 압력을 적용 하 여는 심 실 노출. 그런 다음, 다른 손으로 iridectomy가 위를 사용 하 여 정점에 심 실 ~ 20%를 제거 합니다. 참고:이 시점에서 발생 한다 광범위 한 출혈 없음.</li>
	<li>젖은 냅킨을 사용 하 여 서 라도 응고, 전에 15-45 s에 대 한 상처 출혈으로 절 개를 커버 하 고 다시 시스템 물 탱크에 생선을 넣어. 참고: 그것은 절 개를 봉합 하는 데 필요한 아니다.</li>
	<li>물고기 1 분 이내 길 움직임을 차릴 다음 수영을 다시 시작 되었는지 확인 합니다. 물고기 50 후 길 움직임을 보여주지 않는 경우 물에 s 물고기 다시 활성 환기 때까지 플라스틱 피 펫을 사용 하 여 아가미로 물 분출에 의해 촉진.</li>
	<li>심 실 절제술 후 재활용 시스템에서 물고기를 유지 합니다. 참고: 특별 한 관심이 없는 일반 생선에 비해 필요 하다. 성인 제 브라 심 실 절제술의 사망률은 약 5-10%. 거의 모든 죽음은 수술 후 24 시간 이내에 발생합니다.</li>
</ol>3입니다. siRNA 캡슐화 된 나노 입자의 준비
<ol><li>F-팸4합성-말뚝-R9 dendrimer. 참고: f-팸4의 합성-말뚝-R9 dendrimer 자료37 일부 수정 이전에 설명 된 대로 수행 했다. Α, ω-dipyridyl disulfido 폴 리 에틸렌 글리콜 (Py-말뚝-Py)의 길이 siRNAs (그림 2B)의 보호를 극대화 하기 위해 1, 000의 분자량을 감소 되었다.</li>
	<li>G4.0 polyamidoamine (불리 PAMAM) 진공 건조 기를 사용 하 여 1 h를 45 ° C에서의 cystamine 코어의 10 mg을 건조 하 고 2 mL Dulbecco의 인산 염 버퍼 식 염 수 (DPBS, 셀 문화 응용 프로그램의 다양 한 사용 균형된 소금 솔루션)에 PAMAM 해산.</li>
	<li>1.7 mg tris(2-carboxyethyl) phosphine (TCEP) 1 ml DPBS 녹, 3.2에서 준비 PAMAM 솔루션 혼합이 고 8 h에 대 한 부드러운 교 반으로 실 온에서 두고. 참고: TCEP는 어 금 니 비율 초과 PAMAM의 이황화 결합 ten-fold.</li>
	<li>적용 하 여 과도 한 TCEP를 제거 합니다. DPBS 10 mL의 볼륨에 도달 위의 PAMAM TCEP 혼합물에 추가 하 고 솔루션 3 kDa MWCO (분자 무게 차단) 한 관으로 전송 됩니다. 15 분 동안 3000 g에서 원심 분리 후 컬렉션 튜브에서 솔루션을 삭제 합니다. 추가 DPBS 필터 장치에 10 mL와 부드럽게 피 펫 샘플을 여러 번 하 고 다시 원심. 4 번에 대해이 단계를 반복 합니다. 마지막 여과 후 필터 장치에서 샘플을 발음. 참고:이 단계의 제품 감소 PAMAM (f PAM4 불리).</li>
	<li>F-PAM4 솔루션 1 ml DPBS, 혼합 14 mg 평-말뚝-Py를 녹이 고 3 시간 실 온에서 부드러운 교 반으로 그것을 두고. 3.4에 설명 된 대로 적용 단계에 의해 제거 하 고 과도 한 평-말뚝-평. 마지막 여과 후 필터 장치에서 샘플을 발음. 참고: 제품 f-PAM4-말뚝-Py로 지명 된다. Py-말뚝-평의 금액은 10 f PAM4에서 thiol 그룹에 어 금 니 비율에서.</li>
	<li>디졸브의 시스테인 6.4 mg 1 ml DPBS R9 펩 티 드 (Ac-CRRRRRRRRR-NH2)를 종료, f-PAM4-말뚝-Py로 혼합 하 고 실 온에서 8 h 동안 부드럽게 저 어. 한 단계 제외 하 고는 DPBS 이온된 수로 변경 3.4에 설명 된 대로 f-PAM4-말뚝-R9, 호출한 최종 제품을 정화. 동결 진공 건조 기를 사용 하 여 제품을 lyophilize. 참고: 3.5와 3.6 동결은 전에 제품 적어도 1 개월-20 ℃에 저장 됩니다. F-PAM4-말뚝-R9 동결은 후 샘플 2 개월 이상-20 ℃에 저장 됩니다.</li>
	<li>수정이 고 펩 티 드의 정도 확인 하는 f-PAM4-말뚝-Py D2O (산화 중수소)의 5 밀리 그램을 녹이 고 NMR (핵자기공명) 샘플 튜브로 전송. 400 MHz에서 1 H NMR 스펙트럼 분석을 수행 하 고 NMR 데이터 분석 소프트웨어37을 사용 하 여 데이터를 분석. 참고: 특히, 대표 PAMAM 봉우리 (-NCH2CH2CO-), 페그 봉우리 (-OCH2CH2-), 그리고는 펩 티 드에 아르기닌 잔류물 봉우리 (-HCCH2CH2CH2NH-) 2.4-2.6, 3.7-3.8, 범위 및 1.6-1.8 ppm에 각각 있을 것으로 예상 된다. PAMAM 봉우리 고 R9 봉우리의 적분을 계산 하 여 말뚝과 R9는 PAMAM 기준의 변경의 정도 결정 합니다. 못의 수정 정도 100% 이며 R9 수정 적어도 50%. 1H NMR 스펙트럼 분석 기관의 핵심 시설에서 수행 됩니다.</li>
	<li>F-팸4분해-말뚝-R9 dendrimer 4 mg/mL PBS에 분말을 1 회 사용에 대 한 솔루션의 aliquots. 참고: dendrimer 솔루션 저장할 수 있습니다-20 ° C에서 한 달 이상에 대 한 중지 및 재개를 반복 하지 않고.</li>
	<li>Cyanine 염료 표시 siRNAs (Cy5-siRNA 불리), Aldh1a2 siRNA 또는 스크램블된 부정적인 제어 siRNA 10 µ M 증류수에 용 해. 참고: 나노 캡슐화 siRNA 물고기 마음 (그림 2A-B)를 입력할 수 있는지 여부를 평가 하 cyanine 염료 표시 siRNAs를 사용 합니다. 이 프로토콜 f-PAM4-말뚝-R9 dendrimer 캡슐화 siRNA 전달의 효율성을 결정 하는 예 진으로 aldh1a2 를 사용 합니다. siRNAs의 순서는: Cy5-siRNA 센스 가닥: 5 '-ACGUGACACGUUCGGAGAAdTdT-3, siAldh1a2 센스 가닥: 5'-UUCAGGACAACCGUGUUCCdTdT-3'와 뒤섞여 부정적인 제어 siRNA 센스 가닥: 5'-ACGUGACACGUUCGGAGAAdTdT-3'.</li>
	<li>20 분에 대 한 실 온에서 샘플은 갓 siRNA 캡슐화 나노 솔루션을 준비, siRNA dendrimer 솔루션의 동등한 양으로 혼합 품 어을 사용 하기 전에 siRNA 나노 솔루션 준비 하 고. 참고: siRNA 캡슐화 나노 솔루션의 볼륨을 주입 하려고 하는 물고기의 수에 따라 달라 집니다. 예를 들어 10 생선 생선 당 (~ 10 µ L)의 주입을 위해 적어도 120 µ L dendrimer 솔루션 (믹스 60 µ L siRNA 솔루션 및 60 µ L dendrimer 솔루션)를 준비 솔루션의 손실에서.</li>
</ol>4. 성인 Zebrafish 마음에 siRNA 캡슐화 된 나노 입자의 주입
<ol><li>위에서 설명한 대로 홈, tricaine 솔루션, 플라스틱 피 펫는 stereomicroscope, 팔꿈치 핀셋, 그리고 인슐린 주사기 (그림 1) 가득 10 cm 배양 접시와 스폰지의 조각 시스템과 물고기 탱크 뿐만 아니라 물을 준비 주택에 주입 후 물고기.</li>
	<li>심 실 절제술 후 1 일에 대 한 복구 단계 2.1-2.10에에서 준비가 부상된 zebrafish를 허용 하 고 tricaine 솔루션 2.4에 설명 된 대로 1 dpa (일 후 절단) 물고기를 anesthetize.</li>
	<li>마 취 물고기, 복 부 쪽, 팔꿈치 핀셋을 사용 하 여 촉촉한 스폰지에 홈에 전송 합니다. stereomicroscope에서 뛰는 심장을 찾습니다.</li>
	<li>인슐린 주사기를 siRNA로 캡슐화 된 나노 솔루션의 10 µ L를 로드 합니다. 가능한 한 많은 거품을 하지 마십시오.</li>
	<li>부드럽게 비 지배적인 손 가진 흉부 영역을 팔꿈치 핀셋을 사용 하 여 물고기를 무력화. 생선을 너무 단단히 클램프 하지 마십시오. 참고: 주사 동안 발생 한다 아무 광범위 한 출혈 하는 명심 하십시오.</li>
	<li>~ 30 °에서 채워진된 인슐린 주사기를 누른 다른 손 (보충 그림 1)를 사용 하 여 흉 강에 솔루션의 ~ 10 µ L를 주입 합니다. 참고: 솔루션 때때로 주입, 동안 밖으로 흐르는 하지만이 siRNA 효과 영향을 주지 않습니다. SiRNA 나노 솔루션 특정 실험 계획에 따라 한 달에 몇 일 동안 하루에 한 번 주입 수 있습니다. 때마다 siRNA의 한 유형으로는 생선을 주사. SiRNA의 두 개 이상의 종류 한 물고기 투입 될 필요가 있는 경우 주사 한 가지 유형의 siRNA 때마다, 그리고 주사 siRNA 1 h 나중의 다른 종류. 이 프로토콜에서 물고기 당 siRNA의 한 유형을 주입 했다.</li>
	<li>시스템 물 탱크에 있는 물고기를 전송 합니다. 참고: 물고기는 1 분 안에 환기를 다시 시작 하 고 수영을 다시 시작 것으로 예상. SiRNA 캡슐화 된 나노 입자 또는 siRNA의 주사는 일반적으로 성인 zebrafish에 죽음을 발생 하지 않습니다.</li>
</ol>5. 심장 컬렉션, 고정, 및 siRNA 전달의 효율성 평가
<ol><li>각 그룹에 대 한 microcentrifuge 관에 4 %paraformaldehyde 솔루션의 1 mL를 준비 합니다.</li>
	<li>주사 후 선택한 일에 tricaine 솔루션에서 물고기를 anesthetize. 촉촉한 스폰지에 홈에 supinely 물고기를 놓습니다. 흉부에 큰 절 개를 하 게 하 고 널리는 핀셋으로 엽니다. 유출 관을 핀셋으로 신중 하 게 온 마음을 꺼내.</li>
	<li>PBS 가진 마음을 헹 구 고 빠르게 냅킨으로 여분 액체를 제거. 1.5 mL 튜브 microcentrifuge 1 mL paraformaldehyde로 10 마음을 넣어. 부드럽게 튜브를 여러 번, 반전 하 고 하룻밤 4 ° c.에 유지</li>
	<li>Cy5 siRNAs 주입 하트는 vivo에서 이미징 시스템 (보충 그림 2)를 사용 하 여 형광 강도 측정 합니다. 이 연구에서는 각 그룹에 대 한 3-4 zebrafish 마음을 사용 합니다.</li>
	<li>파라핀 또는 10 월 복합 (동결 조직 표본을 최적의 절삭 온도 대 한 매체 포함) 고정된 마음을 탑재 합니다.</li>
</ol>6. 나노 중재 siRNA 유전자 침묵의 평가
<ol><li>절연된 컨테이너와 긴 핀셋을 준비 합니다. 컨테이너의 볼륨의 세 번째를 액체 질소에 붓는 다.</li>
	<li>물고기 2 dpa에 tricaine 솔루션 anesthetize 5.2에 설명 된 대로 마음을 해 부하 고 유출 관 및 아 트리 움 제거. 참고: 물고기 하루에 수술에서 복구할 수 있습니다 그리고 중 스크램블된 siRNA 캡슐화 된 나노 입자 (싱크)와 1 dpa에는 부정적인 제어 또는 aldh1a2 siRNA 캡슐화 된 나노 입자 (siAldh1a2)로 주입.</li>
	<li>심 핀셋을 사용 하 여 1.5 mL microcentrifuge 튜브로 전송, 튜브 뚜껑을 커버 하 고 즉시 액체 질소로 절연된 용기에 튜브를 배치. 긴 핀셋을 사용 하 여 컨테이너에서 튜브를 제거 하는 몇 분에 대 한 액체 질소에 튜브 플 로트 보자.</li>
	<li>6.2, 6.3 단계를 반복 하 여 모든 심 수집 됩니다. 6-10 마음을 사용 하 여 각 그룹에 대 한.</li>
	<li>RNA 분리 시 약으로 마음의 총 RNA를 추출 합니다. 양적 RT-PCR에 의해 각각 유전자의 식 수준을 평가 뇌관 Gapdh f: GATACACGGAGCACCAGGTT;를 사용 하 여 Gapdh r: GCCATCAGGTCACATACACG; Aldh1a2 f: TGAGCGAGGAGCAGCAGAGA; Aldh1a2 r: TCCACGAAGAAGCCTTTAGTAGCA입니다.</li>
</ol>

저자는 공개 없다.

Zebrafish는 완전히 성인 심장5를 포함 하는 기관의 다양 한 재생 가능 하다. 유전자 변형 및 유전자 메서드는 zebrafish의 배아에서 유전자 기능을 연구 개발, 조사 zebrafish45,46에서 생성 하는 조건부 돌연변이 체 대립 유전자의 발굴 작업으로 아직도 직면 된다. 따라서, 유전자 변형 지배적인 부정적인 돌연변이 또는 작은 분자 억제제 자주 ?...

심근 경색은 세계1주위 엄청난 경제적 부담으로 이어지는 주요 건강 위협이 되었다. 성인 포유류 심장 재생성 하 고 거시적인 규모 손실된 cardiomyocytes 흉터 조직 및 후속 심장 마비의 형성으로 이어지는 부상 후 보충 되지 않습니다. 포유류, 달리는 제 브라는 주로 심장 상해, 조사 심장 재생 의 분자 메커니즘에 대 한 이상적인 모델 유기 체 그것을 만들기의 다른 유형 후에 강력한 심근 확산을 통해 심장 재생 2,3,,45,6,,78. 해독 생 메커니즘 기본 zebrafish 심장 재생 인간의 심장 재생9를 개선 하기 위해 새로운 치료 전략에 대 한 검색에 있는 연구의 흥미로운 지역입니다.
유전자 조작 방법 zebrafish에 사용할 수 있습니다. 개구리, 병아리, 그리고 zebrafish10,11,,1213포유류 외에 널리 사용 되는 morpholinos (MO) 이들에 의하여 이루어져 있다. 모 성인 zebrafish 지 느 러 미, 뇌, 그리고 망막14,15,16,17,,1819에 대상 유전자 발현의 효율적인 최저가 있다. 잠겨-핵 산 (LNA)는 내 생 유전자 표현의 zebrafish 태아 뿐만 아니라 성인 동물 장기20,,2122, 에 노크를 사용 하는 다른 인공 oligonucleotide 23 , 그러나 24. 성인 마음에 대 한 효과적인 손실의 기능 방법의 부족 장기 중생의 분자 메커니즘을 공부에 장애를 유지 하는. 현재, 작은 분자 억제제 또는 지배적인 부정적인 돌연변이의 유전자 변형 식에서 주로 사용 특정 유전자 또는 성인 zebrafish 심장 재생25,26에에서 그것의 기능을 공부 하는 통로의 기능을 차단 하 ,27. 그러나, 모든 유전자 또는 신호 통로 이러한 방법에 대 한 적용.
작은 방해 RNAs (siRNAs)는 널리 사용 포유류 세포에 모형 유기 체 뿐만 아니라 성인 장기의 배아 손실의 기능 분석에 대 한 동물에서 전 임상 연구 모델28,,2930 , 31 , 32. siRNAs 종양33,,3435 그리고 cardiomyocytes36,,3738,39 유전자 침묵을 효과적으로 사용 되었습니다 ,40 다른 배달 시스템을 통해. 최근, 우리 개발 효율적인 siRNA로 캡슐화 된 나노 유전자-침묵 여러 다른 나노 입자41,,4243를 사용 하 여 재생 성인 심장에 대 한 새로운 도구를 제공 하 성인 zebrafish 장기에서 유전자의 기능 연구입니다. 우리의 이전 연구41,,4243을 바탕으로, 여기에 우리가 현재 siRNA 유전자 f PAMAM 페그-r 9을 사용 하 여 재생 성인 zebrafish 마음에 입을 위한 단순, 실용적인, 하지만 강력한 프로토콜 dendrimers입니다. Aldh1a2 (알데하이드 효소 1, 가족 A2) 유전자 upregulated zebrafish 정점 절제 후 되었고 Aldh1a2 의 제거 차단 심장 재생44. 여기 우리가 나노 캡슐화 siRNA 주입 하 여 중재 유전자 때 려 눕 힘 효율성을 테스트 하는 예제로 aldh1a2 유전자를 가져가 라. 이 프로토콜은 성인 zebrafish 마음에 zebrafish 심장 절제, 나노 입자의 화학 합성 siRNA 캡슐화 된 나노 입자에 전달 방법에 대 한 절차를 포함합니다.

<table border="0" cellpadding="0" cellspacing="0" style="width:765px;" width="765">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:225px;">tricaine</td>
			<td style="width:180px;">Sigma</td>
			<td style="width:193px;">E10521</td>
			<td style="width:167px;">Store at 4&#176;C</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:225px;">stereomicroscope</td>
			<td style="width:180px;">Leica&#160;</td>
			<td style="width:193px;">S8AP0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:225px;">sharp forcep</td>
			<td style="width:180px;">WPI</td>
			<td style="width:193px;">14098</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:225px;">iridectomy scissors</td>
			<td style="width:180px;">WPI</td>
			<td style="width:193px;">501778</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:225px;">elbow tweezers</td>
			<td style="width:180px;">Suzhou Liuliu</td>
			<td style="width:193px;">SE05Cr</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:225px;">&#945;,&#969;-dipyridyl disulfido polyethylene glycol(Py-PEG-Py)</td>
			<td style="width:180px;">Biomatrik (Jiaxing) Inc.</td>
			<td style="width:193px;">5239</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:225px;">core of G4.0 polyamidoamine (PAMAM)</td>
			<td style="width:180px;">Andrews ChemServices</td>
			<td style="width:193px;">AuCS-297</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:225px;">vacuum drying equipment</td>
			<td style="width:180px;">Yiheng</td>
			<td style="width:193px;">DZF-6020</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:225px;">Dulbecco&#39;s phosphate-buffered saline (DPBS)</td>
			<td style="width:180px;">Gibco</td>
			<td style="width:193px;">14190144</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:225px;">tris(2-carboxyethyl)phosphine(TCEP)</td>
			<td style="width:180px;">Alfar Aesar</td>
			<td style="width:193px;">51805-45-9</td>
			<td>Causes severe skin burns and eye damage. Causes serious eye damage.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:225px;">ultrafiltration tube</td>
			<td style="width:180px;">Millipore</td>
			<td style="width:193px;">UFC900308</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:225px;">freeze dryer</td>
			<td style="width:180px;">Martin Christ</td>
			<td style="width:193px;">Alpha 2-4 Ldplus</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:225px;">NMR spectrometer</td>
			<td style="width:180px;">Bruker</td>
			<td style="width:193px;">AV400</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:225px;">Deuterium oxide(D2O)</td>
			<td>J&#38;K</td>
			<td style="width:193px;">174611</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:225px;">NMR sample tube</td>
			<td>J&#38;K</td>
			<td>WG-1000-7-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3 kDa MWCO ultrafiltration tube</td>
			<td style="width:180px;">Merck</td>
			<td style="width:193px;">UFC900308</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:225px;">sea salts</td>
			<td style="width:180px;">Instant Ocean&#174;</td>
			<td style="width:193px;">SS15-10</td>
			<td></td>
		</tr>
	</tbody>
</table>

nanoparticle-mediated sirna gene-silencing in adult zebrafish heart

포유류 심근 경색 후 심 혼을 회생 하는 매우 제한 된 용량을가지고. 다른 한편으로, 성인 zebrafish 정점 절제 또는 cryoinjury, 그것에 게 심장 재생 연구에 대 한 중요 한 모형 유기 체를 만드는 후 그것의 심 혼을 재생성 합니다. 그러나, 성인 기관에 대 한 손실의 기능 방법의 부족은 심장 재생을 기본 메커니즘에 대 한 통찰력을 제한 했다. 다른 배달 시스템을 통해 RNA 간섭 포유류 세포 및 모형 유기 체에서 유전자 침묵 시키기를 위한 강력한 도구입니다. 우리 이전 siRNA 캡슐화 된 나노 성공적으로 셀 입력 및 재생 성인 zebrafish 마음에 놀라운 유전자 특정 최저에서 결과 보고 있다. 여기, 우리는 재생 성인 zebrafish 마음에 dendrimer 중재 siRNA 전달 및 유전자 침묵에 대 한 간단한 빠르고 효율적인 프로토콜을 제시. 이 메서드 zebrafish 성인 기관에서 유전자 기능을 결정 하기 위한 다른 접근을 제공 하 고 뿐만 아니라 다른 모델 유기 체에 확장 될 수 있습니다.

Dendrimer 중재 siRNA 전달의 효율성을 확인 하려면 우리 zebrafish 심장의 심 실의 꼭대기를 절제 후 약 10 µ L dendrimer만의 (모의 그룹), Cy5 siRNA만 (벌 거 벗은 그룹), 또는 f-PAMAM-말뚝-R9 dendrimer 캡슐을 주입 Cy5-siRNA (Cy5-siRNA 그룹) intrapleurally, 각각 (그림 2A-B). 형광 신호는 dendrimer 캡슐화 Cy5-siRNA 3, 24, 48 hpi (시간 후 주입)에 주사 하는 마음에서 감지 4...

Watch this Scientific Journal Video about Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart at JoVE.com

Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart

나노-중재 siRNA 유전자 입을 성인 Zebrafish 마음에

조건부 유전자 녹아웃 또는 효과적인 유전자-최저 성인 zebrafish 장기를 개발 하는 주요 도전 남아 있다. 여기 우리 보고 수행 나노 중재 siRNA 유전자-성인 zebrafish 마음에 입을, 성인 기관 zebrafish 및 다른 모형 유기 체 공부에 대 한 새로운 기능 손실 방법 제공에 대 한 프로토콜.

Mammals have a very limited capacity to regenerate the heart after myocardial infarction. On the other hand, the adult zebrafish regenerates its heart ...

nanoparticle-mediated-sirna-gene-silencing-in-adult-zebrafish-heart

Research

JoVE Journal

Developmental Biology

8.1K 조회수.  Peking University. 조건부 유전자 녹아웃 또는 효과적인 유전자-최저 성인 zebrafish 장기를 개발 하는 주요 도전 남아 있다. 여기 우리 보고 수행 나노 중재 siRNA 유전자-성인 zebrafish 마음에 입을, 성인 기관 zebrafish 및 다른 모형 유기 체 공부에 대 한 새로운 기능 손실 방법 제공에 대 한 프로토콜.

비디오: Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart

Kidney Regeneration in Adult Zebrafish by Gentamicin Induced Injury

The kidney is essential for fluid homeostasis, blood pressure regulation and filtration of waste from the body. The fundamental unit of kidney function is the nephron. Mammals are able to repair existing nephrons after injury, but lose the ability to form new nephrons soon after birth. In contrast to mammals, adult fish produce new nephrons (neonephrogenesis) throughout their lives in response to growth requirements or injury. Recently, lhx1a has been shown to mark nephron progenitor cells in the adult zebrafish kidney, however mechanisms controlling the formation of new nephrons after injury remain unknown. Here we show our method for robust and reproducible injury in the adult zebrafish kidney by intraperitoneal (i.p.) injection of gentamicin, which uses a noninvasive visual screening process to select for fish with strong but nonlethal injury. Using this method, we can determine optimal gentamicin dosages for injury and go on to demonstrate the effect of higher temperatures on kidney regeneration in zebrafish.

Here we present a reliable method to study adult kidney regeneration by inducing acute kidney injury by gentamicin injection. We show that injury is dependent on gentamicin dosage and environmental temperature using in situ hybridization to label lhx1a+ developing new nephrons.

겐타 마이신 유도 부상으로 성인 Zebrafish의에서 신장 재생

The kidney is essential for fluid homeostasis, blood pressure regulation and filtration of waste from the body. The fundamental unit of kidney function is ...

연구

발생학

Large-scale Zebrafish Embryonic Heart Dissection for Transcriptional Analysis

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the cardiac transcriptome from being masked by the global embryonic transcriptome, it is necessary to collect sufficient numbers of hearts for further analyses. Furthermore, as zebrafish cardiac development proceeds rapidly, heart collection and RNA extraction methods need to be quick in order to ensure homogeneity of the samples. Here, we present a rapid manual dissection protocol for collecting functional/beating hearts from zebrafish embryos. This is an essential prerequisite for subsequent cardiac-specific RNA extraction to determine cardiac-specific gene expression levels by transcriptome analyses, such as quantitative real-time polymerase chain reaction (RT-qPCR). The method is based on differential adhesive properties of the zebrafish embryonic heart compared with other tissues; this allows for the rapid physical separation of cardiac from extracardiac tissue by a combination of fluidic shear force disruption, stepwise filtration and manual collection of transgenic fluorescently labeled hearts.

To analyse cardiac gene expression profiles during zebrafish heart development, total RNA has to be extracted from isolated hearts. Here, we present a protocol for collecting functional/beating hearts by rapid manual dissection from zebrafish embryos to obtain cardiac-specific mRNA.

전사 분석을위한 대규모 Zebrafish의 배아 심장의 해부

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the ...

Analysis of Zebrafish Larvae Skeletal Muscle Integrity with Evans Blue Dye

The zebrafish model is an emerging system for the study of neuromuscular disorders. In the study of neuromuscular diseases, the integrity of the muscle membrane is a critical disease determinant. To date, numerous neuromuscular conditions display degenerating muscle fibers with abnormal membrane integrity; this is most commonly observed in muscular dystrophies. Evans Blue Dye (EBD) is a vital, cell permeable dye that is rapidly taken into degenerating, damaged, or apoptotic cells; in contrast, it is not taken up by cells with an intact membrane. EBD injection is commonly employed to ascertain muscle integrity in mouse models of neuromuscular diseases. However, such EBD experiments require muscle dissection and/or sectioning prior to analysis. In contrast, EBD uptake in zebrafish is visualized in live, intact preparations. Here, we demonstrate a simple and straightforward methodology for performing EBD injections and analysis in live zebrafish. In addition, we demonstrate a co-injection strategy to increase efficacy of EBD analysis. Overall, this video article provides an outline to perform EBD injection and characterization in zebrafish models of neuromuscular disease.

In this study, we describe a straightforward method to perform Evans Blue Dye (EBD) analysis on zebrafish larvae. This technique is a powerful tool for the characterization of skeletal muscle integrity and delineation of zebrafish models of muscular dystrophy, and is a valuable method for the development of novel therapeutics.

에반스 블루 염료와 Zebrafish의 애벌레 골격 근육 무결성 분석

The zebrafish model is an emerging system for the study of neuromuscular disorders.  In the study of neuromuscular diseases, the integrity of the muscle ...

Isolation and Culture of Adult Zebrafish Brain-derived Neurospheres

The zebrafish is a highly relevant model organism for understanding the cellular and molecular mechanisms involved in neurogenesis and brain regeneration in vertebrates. However, an in-depth analysis of the molecular mechanisms underlying zebrafish adult neurogenesis has been limited due to the lack of a reliable protocol for isolating and culturing neural adult stem/progenitor cells. Here we provide a reproducible method to examine adult neurogenesis using a neurosphere assay derived from zebrafish whole brain or from the telencephalon, tectum and cerebellum regions of the adult zebrafish brain. The protocol involves, first the microdissection of zebrafish adult brain, then single cell dissociation and isolation of self-renewing multipotent neural stem/progenitor cells. The entire procedure takes eight days. Additionally, we describe how to manipulate gene expression in zebrafish neurospheres, which will be particularly useful to test the role of specific signaling pathways during adult neural stem/progenitor cell proliferation and differentiation in zebrafish.

Here we provide a reproducible method to examine adult neurogenesis using a neurosphere assay derived from the whole brain or from either the telencephalic, tectal or cerebellar regions of the adult zebrafish brain. Additionally, we describe the procedure to manipulate gene expression in zebrafish neurospheres.

성인 Zebrafish의 뇌 유래 neurosphere를의 분리 및 문화

The zebrafish is a highly relevant model organism for understanding the cellular and molecular mechanisms involved in neurogenesis and brain regeneration ...

Isolation and Characterization of Single Cells from Zebrafish Embryos

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been described at the morphological level, little is known about the molecular basis of cellular changes that occur as the organism develops. With recent advancements in microfluidics and multiplexing technologies, it is now possible to characterize gene expression in single cells. This allows for investigation of heterogeneity between individual cells of specific cell populations to identify and classify cell subtypes, characterize intermediate states that occur during cell differentiation, and explore differential cellular responses to stimuli. This study describes a protocol to isolate viable, single cells from zebrafish embryos for high throughput multiplexing assays. This method may be rapidly applied to any zebrafish embryonic cell type with fluorescent markers. An extension of this method may also be used in combination with high throughput sequencing technologies to fully characterize the transcriptome of single cells. As proof of principle, the relative abundance of cardiac differentiation markers was assessed in isolated, single cells derived from nkx2.5 positive cardiac progenitors. By evaluation of gene expression at the single cell level and at a single time point, the data support a model in which cardiac progenitors coexist with differentiating progeny. The method and work flow described here is broadly applicable to the zebrafish research community, requiring only a labeled transgenic fish line and access to microfluidics technologies.

This protocol describes a method for isolating single cells from zebrafish embryos, enriching for cells of interest, capturing zebrafish cells in microfluidic based single cell multiplex systems, and assessing gene expression from single cells.

분리 및 Zebrafish의 배아에서 단일 세포의 특성

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been ...

Culture of Adult Transgenic Zebrafish Retinal Explants for Live-cell Imaging by Multiphoton Microscopy

An endogenous regeneration program is initiated by M&#252;ller glia in the adult zebrafish (Danio rerio) retina following neuronal damage and death. The M&#252;ller glia re-enter the cell cycle and produce neuronal progenitor cells that undergo subsequent rounds of cell divisions and differentiate into the lost neuronal cell types. Both M&#252;ller glia and neuronal progenitor cell nuclei replicate their DNA and undergo mitosis in distinct locations of the retina, i.e. they migrate between the basal Inner Nuclear Layer (INL) and the Outer Nuclear Layer (ONL), respectively, in a process described as Interkinetic Nuclear Migration (INM). INM has predominantly been studied in the developing retina. To examine the dynamics of INM in the adult regenerating zebrafish retina in detail, live-cell imaging of fluorescently-labeled M&#252;ller glia/neuronal progenitor cells is required. Here, we provide the conditions to isolate and culture dorsal retinas from Tg[gfap:nGFP]mi2004 zebrafish that were exposed to constant intense light for 35 h. We also show that these retinal cultures are viable to perform live-cell imaging experiments, continuously acquiring z-stack images throughout the thickness of the retinal explant for up to 8 h using multiphoton microscopy to monitor the migratory behavior of gfap:nGFP-positive cells. In addition, we describe the details to perform post-imaging analysis to determine the velocity of apical and basal INM. To summarize, we established conditions to study the dynamics of INM in an adult model of neuronal regeneration. This will advance our understanding of this crucial cellular process and allow us to determine the mechanisms that control INM.

Zebrafish retinal regeneration has mostly been studied using fixed retinas. However, dynamic processes such as interkinetic nuclear migration occur during the regenerative response and require live-cell imaging to investigate the underlying mechanisms. Here, we describe culture and imaging conditions to monitor Interkinetic Nuclear Migration (INM) in real-time using multiphoton microscopy.

다중 광자 현미경으로 라이브 셀 이미징을위한 성인 형질 전환 Zebrafish의 망막의 Explants의 문화

An endogenous regeneration program is initiated by M&#252;ller glia in the adult zebrafish (Danio rerio) retina following neuronal damage and death. The ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

해 부 및 Immunofluorescent 얼룩의 버섯 몸과 성인 초파리 melanogaster 두뇌 신경 세포 포토 리셉터

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

The Isolation and Culture of Primary Epicardial Cells Derived from Human Adult and Fetal Heart Specimens

The epicardium, an epithelial cell layer covering the myocardium, has an essential role during cardiac development, as well as in the repair response of the heart after ischemic injury. When activated, epicardial cells undergo a process known as epithelial to mesenchymal transition (EMT) to provide cells to the regenerating myocardium. Furthermore, the epicardium contributes via secretion of essential paracrine factors. To fully appreciate the regenerative potential of the epicardium, a human cell model is required. Here we outline a novel cell culture model to derive primary epicardial derived cells (EPDCs) from human adult and fetal cardiac tissue. To isolate EPDCs, the epicardium is dissected from the outside of the heart specimen and processed into a single cell suspension. Next, EPDCs are plated and cultured in EPDC medium containing the ALK 5-kinase inhibitor SB431542 to maintain their epithelial phenotype. EMT is induced by stimulation with TGF&#946;. This method enables, for the first time, the study of the process of human epicardial EMT in a controlled setting, and facilitates gaining more insight in the secretome of EPDCs that may aid heart regeneration. Furthermore, this uniform approach allows for direct comparison of human adult and fetal epicardial behavior.

The epicardium plays a crucial role in the development and repair of the heart by providing cells and growth factors to the myocardial wall. Here, we describe a method to culture human primary epicardial cells that enables the study and comparison of their developmental and adult characteristics.

분리와 인간 성인 그리고 태아 심장 표본에서 파생 하는 기본 Epicardial 세포의 문화

The epicardium, an epithelial cell layer covering the myocardium, has an essential role during cardiac development, as well as in the repair response of ...

Whole-mount Confocal Microscopy for Adult Ear Skin: A Model System to Study Neuro-vascular Branching Morphogenesis and Immune Cell Distribution

Here, we present a protocol of a whole-mount adult ear skin imaging technique to study comprehensive three-dimensional neuro-vascular branching morphogenesis and patterning, as well as immune cell distribution at a cellular level. The analysis of peripheral nerve and blood vessel anatomical structures in adult tissues provides some insights into the understanding of functional neuro-vascular wiring and neuro-vascular degeneration in pathological conditions such as wound healing. As a highly informative model system, we have focused our studies on adult ear skin, which is readily accessible for dissection. Our simple and reproducible protocol provides an accurate depiction of the cellular components in the entire skin, such as peripheral nerves (sensory axons, sympathetic axons, and Schwann cells), blood vessels (endothelial cells and vascular smooth muscle cells), and inflammatory cells. We believe this protocol will pave the way to investigate morphological abnormalities in peripheral nerves and blood vessels as well as the inflammation in the adult ear skin under different pathological conditions.

Here, we describe a high resolution whole-mount imaging method in the entire adult mouse ear skin, which enables us to visualize branching morphogenesis and patterning of peripheral nerves and blood vessels, as well as immune cell distribution.

성인 귀 피부에 대 한 전체 실장 Confocal 현미경 검사 법: 신경-혈관 분기 Morphogenesis 및 면역 세포 분포를 연구 하는 모델 시스템

Here, we present a protocol of a whole-mount adult ear skin imaging technique to study comprehensive three-dimensional neuro-vascular branching ...

Adult Zebrafish Injury Models to Study the Effects of Prednisolone in Regenerating Bone Tissue

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows within roughly two weeks after injury. Furthermore, zebrafish are able to heal bone rapidly after trepanation of the skull, and repair fractures that can be easily introduced into zebrafish bony fin rays. These injury assays represent feasible experimental paradigms to test the effect of administered drugs on rapidly forming bone. Here, we describe the use of these 3 injury models and their combined use with systemic glucocorticoid treatment, which exerts bone inhibitory and immunosuppressive effects. We provide a workflow on how to prepare for immunosuppressive treatment in adult zebrafish, illustrate how to perform fin amputation, trepanation of calvarial bones, and fin fractures, and describe how the use of glucocorticoids affects both bone forming osteoblasts and cells of the monocyte/macrophage lineage as part of innate immunity in bone tissue.

Here, we describe 3 adult zebrafish injury models and their combined use with immunosuppressive drug treatment. We provide guidance on imaging of regenerating tissues and on detecting bone mineralization therein.

성인 Zebrafish 부상 모델 뼈 조직 재생에 Prednisolone의 효과 연구

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows ...