We are grateful for funding support from the National Institutes of Health (T32AR007411-33) and the University of Colorado Skin Diseases Research Core Center (P30AR057212). We also thank the Epidermolysis Bullosa (EB) Research Partnership, EB Medical Research Foundation, Cure EB Charity, Dystrophic Epidermolysis Bullosa Research Association (DEBRA) International, King Baudouin Foundation&#39;s Vlinderkindje Fund, and Gates Frontiers Fund.

<ol><li>Takahashi, K., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Induction+of+Pluripotent+Stem+Cells+from+Mouse+Embryonic+and+Adult+Fibroblast+Cultures+by+Defined+Factors%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors.</a> Cell. 126 (4), 663-676 (2006).</li>
<li>Takahashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Induction+of+Pluripotent+Stem+Cells+from+Adult+Human+Fibroblasts+by+Defined+Factors%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Induction of Pluripotent Stem Cells from Adult Human Fibroblasts by Defined Factors.</a> Cell. 131 (5), 861-872 (2007).</li>
<li>Schlaeger, T. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+comparison+of+non-integrating+reprogramming+methods%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">A comparison of non-integrating reprogramming methods.</a> Nature Biotechnology. 33 (1), 58-63 (2015).</li>
<li>Hacein-Bey-Abina, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((LMO2-Associated+Clonal+T+Cell+Proliferation+in+Two+Patients+after+Gene+Therapy+for+SCID-X1%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">LMO2-Associated Clonal T Cell Proliferation in Two Patients after Gene Therapy for SCID-X1.</a> Science. 302 (5644), 415-419 (2003).</li>
<li>Warren, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Highly+efficient+reprogramming+to+pluripotency+and+directed+differentiation+of+human+cells+with+synthetic+modified+mRNA%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA.</a> Cell Stem Cell. 7 (5), 618-630 (2010).</li>
<li>Judson, R. L., Babiarz, J. E., Venere, M., Blelloch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Embryonic+stem+cell-specific+microRNAs+promote+induced+pluripotency%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Embryonic stem cell-specific microRNAs promote induced pluripotency.</a> Nature Biotechnology. 27 (5), 459-461 (2009).</li>
<li>Anokye-Danso, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Highly+efficient+miRNA-mediated+reprogramming+of+mouse+and+human+somatic+cells+to+pluripotency%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">Highly efficient miRNA-mediated reprogramming of mouse and human somatic cells to pluripotency.</a> Cell Stem Cell. 8 (4), 376-388 (2011).</li>
<li>Kogut, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-efficiency+RNA-based+reprogramming+of+human+primary+fibroblasts%5BTitle%5D)+AND+%22Nature+Communications%22%5BJournal%5D)">High-efficiency RNA-based reprogramming of human primary fibroblasts.</a> Nature Communications. 9 (1), (2018).</li>
<li>Hirai, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Radical+acceleration+of+nuclear+reprogramming+by+chromatin+remodeling+with+the+transactivation+domain+of+MyoD%5BTitle%5D)+AND+%22Stem+Cells%22%5BJournal%5D)">Radical acceleration of nuclear reprogramming by chromatin remodeling with the transactivation domain of MyoD.</a> Stem Cells. 29 (9), 1349-1361 (2011).</li>
<li>Mandal, P. K., Rossi, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Reprogramming+human+fibroblasts+to+pluripotency+using+modified+mRNA%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">Reprogramming human fibroblasts to pluripotency using modified mRNA.</a> Nature Protocols. 8 (3), 568-582 (2013).</li>
<li>Avci-Adali, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((In+vitro+synthesis+of+modified+mRNA+for+induction+of+protein+expression+in+human+cells%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">In vitro synthesis of modified mRNA for induction of protein expression in human cells.</a> Journal of Visualized Experiments. , e51943(2014).</li>
</ol>

I.K. and G.B. are co-inventors on a patent application entitled &#34;Methods and Compositions for Reprogramming Cells&#34;, PCT Application No. PCT/US2016/063258.

This protocol describes a clinically-relevant, non-integrating, RNA-based method that allows for the reprogramming of normal and disease-associated human fibroblast lines into iPSCs at an ultra-high efficiency. To date, every human fibroblast line we have attempted to reprogram with the described protocol has yielded a satisfactory number of high-quality iPSCs for downstream applications. Resulting iPSCs can immediately be transferred and expanded in feeder-free culture conditions.
Quality of fibroblasts for reprogramming:
Reprogramming success is heavily dependent on the quality of starting fibroblasts. Ideally, reprogramming should be initiated with the lowest passage fibroblasts available to achieve the highest efficiency. Reprogramming efficiency is best with fibroblasts of passage 2&#8211;4. Reprogramming can still work with high-passage (passage 5&#8211;8), even senescent fibroblasts, albeit with a reduced efficiency. Sometimes low-passage fibroblasts are unavailable or patient samples have a genetic mutation that prevents healthy growth. In this case, optimization of initial plating density may be required. The reprogramming of compromised fibroblast lines is usually associated with increased cell death during RNA transfections. As a result, the cells in the reprogramming well will appear to be sparse by days 10&#8211;14 of reprogramming. Large acellular areas will also be visible in the well. If this is the case, the reprogramming protocol will need to be re-initiated with a higher initial starting number of fibroblasts. Plating 3,000 input cells per well of a 6-well format dish works consistently for most adult fibroblast lines. However, increasing the plating number to 5,000&#8211;10,000 (50,000 for senescent lines) may help to improve reprogramming of disease-associated samples, as has been reported in our previous publication8. Conversely, cells reaching confluency too early can also be resistant to reprogramming. If cells undergoing transfections with reprogramming RNAs proliferate too rapidly (as is sometimes the case with primary neonatal fibroblasts), initiate reprogramming with 500 fibroblasts per well of a 6-well format dish8.
Handling of the transfection buffer:
The pH of the transfection buffer (reduced-serum medium adjusted to the pH of 8.2) is paramount to achieving the optimal transfection efficiencies required for this reprogramming protocol. For this reason, several precautions regarding the handling of the transfection buffer are recommended. We have found that even short exposure of the transfection buffer to atmospheric air affects the pH of the buffer. Therefore, the transfection buffer should be aliquoted into a screw cap container with minimal air space (we use either 5 or 15 mL screw cap conical tubes). To further minimize air exposure, use each transfection buffer aliquot for a maximum of two transfections. Lastly, since temperature impacts pH, it is critical that the transfection buffer is equilibrated to RT for assembly of the transfection complexes. It is advised to not warm the transfection buffer to 37 &#176;C.
Passaging of iPSCs:
While many previously published protocols recommend picking individual iPSC colonies at the end of reprogramming, this may be difficult to achieve when the efficiency of reprogramming is very high or if the colonies cluster together, as is often the case in our protocol. Therefore, if iPSC colonies are in close proximity to each other, we recommend first passaging the cells to spread out reprogrammed iPSCs before manually picking colonies. There are several advantages to performing this early passage step. Spreading out the colonies gives them more room to grow, yielding much larger colonies for picking than could otherwise be achieved in the original well. This greatly improves the success rate in establishing an iPSC line from a picked clone. We also find that the additional culture time with fibroblasts, albeit at a diluted ratio, appears to improve the average quality of picked iPSC colonies. The incompletely reprogrammed fibroblasts may provide supporting paracrine factors, which continue to help establish the iPSCs and ease the direct transition into feeder-free cell culture conditions. Fibroblasts fortuitously have a selective growth disadvantage compared to iPSCs when cultured in mTeSR1. Therefore, the contaminating fibroblast cell population is quickly diluted to negligible quantities within 3&#8211;4 passages.
ROCK inhibitors such as Y-27632 are frequently used for routine culture of human iPSCs. We have found that frequent and/or extended culture of some iPSC lines with Y-27632 can have deleterious effects on overall quality. When using a clump passaging method, such as with EDTA, Y-27632 is not necessary to maintain iPSC viability after splitting. We have completely eliminated supplementing media with Y-27632 for all iPSC isolation, expansion, or routine culture.
Protocol limitations:
One limitation to the described RNA-based reprogramming approach is the initial cost and complexity associated with the preparation of the reprogramming reagents. Although preparatory procedures to generate mRNA reagents are all routine and have been previously described (PCR, in vitro transcription, DNase treatment, capping, dephosphorylation, purification), cumulatively the production of mRNA reagents is a relatively lengthy and non-trivial process. The other major challenge to this protocol is the need to transfect cells every 48 h, increasing the labor intensity of the reprogramming protocol. These considerations may be prohibitive if reprogramming of only a few patient samples is desired. However, if the primary consideration is the generation of clinically relevant iPSCs or achieving very high reprogramming efficiency, the described RNA-based reprogramming approach is ideal.
In summary, the described high-efficiency RNA-based reprogramming method hinges on optimized transfection efficiency of the somatic cell type to be reprogrammed as described in our previous publication8. The RNA transfection protocol presented in this study is highly tuned for human primary fibroblasts but can potentially be tailored to other cell types to improve reprogramming efficiency of various somatic cells.

Reprogramming somatic cells into induced pluripotent stem cells (iPSCs) requires extended expression of a core set of transcription factors that are important in maintaining pluripotency1,2. When producing iPSCs for clinical applications, it is essential that the mutational burden in input cells is minimized during processing and the efficiency of iPSC generation is maintained at a relatively high level across patient samples. However, the majority of reprogramming methods, including integration-free protocols, suffers from very low reprogramming efficiencies, which limit clinical usefulness of these approaches3. The low reprogramming efficiency may also promote selective reprogramming of cells carrying preexisting mutations, increasing mutational burden in resulting iPSCs. In addition, all DNA-based reprogramming methods, such as lentivirus- and episomal-based approaches, suffer from the safety concern that DNA may randomly integrate into the genome and create the opportunity for harmful insertional mutagenesis and unwanted (potentially oncogenic) expression of pluripotency genes in downstream tissue derivatives4.
A promising approach to achieve efficient induction of pluripotency in somatic cells and reduce mutational burden in resulting iPSCs is to use synthetic capped messenger RNAs containing modified nucleobases (modified mRNAs) for reprogramming5. The efficiency of modified mRNA-based reprogramming approaches can be further enhanced by adding embryonic stem cell (ESC)-specific microRNAs (miRNAs)-367/302s3, which have been shown to reprogram somatic cells with increased efficiency6,7. However, even with the addition of miRNAs-367/302s, the modified mRNA-based reprogramming approach often fails during application to freshly isolated patient cells3. To address inconsistencies of this modified mRNA-based approach, we have recently reported an optimized, integration-free strategy that induces pluripotency in human primary fibroblasts with a high success rate and utilizes both modified mRNAs encoding reprogramming factors and mature miRNA-367/302 mimics8. In our method, the reprogramming modified mRNA cocktail includes a modified version of OCT4 fused with the MyoD transactivation domain (called M3O)9 and five other reprogramming factors (SOX2, KLF4, cMYC, LIN28A, and NANOG). Combining the modified mRNA encoding the pluripotency factors with the miRNA mimics appeared to have a synergistic effect on reprogramming efficiencies in this protocol. Additional optimizations of the RNA transfection regimen, cell seeding, and culturing conditions were also necessary to increase reprogramming efficiency of the approach to an ultra-high level8.
Unlike many other protocols, our reprogramming approach typically requires only a few thousand input fibroblasts. In addition, many common non-integrating strategies using episomal plasmids, Sendai virus, or self-replicating RNA involve extensive passaging to dilute the reprogramming vector in generated iPSCs. Conversely, modified mRNA and mature miRNA mimics have a short half-life and are rapidly eliminated from cells. Taken together, the amount of cumulative cell culture time between collecting patient samples and the generation of usable iPSCs is minimal in this approach, effectively limiting mutation accumulation in resulting iPSCs and improving cost-effectiveness.
Here, we present the detailed step-by-step protocol to achieve high-efficiency reprogramming of adult human fibroblasts into iPSCs using our combinatorial modified mRNA/miRNA-based approach8. This RNA-based reprogramming protocol provides a straightforward, cost-effective, and robust method for generating integration-free iPSCs for research and potential clinical applications. Furthermore, it is applicable to the reprogramming of a variety of fibroblast lines including difficult-to-reprogram, disease-associated, aged, and senescent fibroblasts. A schematic of the protocol for reprogramming human fibroblasts is shown in Figure 1. The protocol specifically describes a method for reprogramming three wells of human adult primary fibroblasts in a 6-well format plate. Two wells typically yield a sufficient number of high-quality iPSC colonies. In many cases, only one well is necessary, and the third well can be used for analysis of reprogramming efficiency. If required, the number of wells can be scaled up.

<table><tbody><tr><td>&lt;strong&gt;Plasmid templates for PCR&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pcDNA3.3_KLF4</td><td>Addgene</td><td>26815</td><td></td></tr><tr><td>pcDNA3.3_SOX2</td><td>Addgene</td><td>26817</td><td></td></tr><tr><td>pcDNA3.3_c-MYC</td><td>Addgene</td><td>26818</td><td></td></tr><tr><td>pcDNA3.3_LIN28A</td><td>Addgene</td><td>26819</td><td></td></tr><tr><td>pCR-Blunt_hM3O</td><td>Addgene</td><td>112638</td><td></td></tr><tr><td>pCR-Blunt_hNANOG</td><td>Addgene</td><td>112639</td><td></td></tr><tr><td>pCR-Blunt_mWasabi</td><td>Addgene</td><td>112640</td><td></td></tr><tr><td>&lt;strong&gt;Modified mRNA &lt;em&gt;in vitro&lt;/em&gt; transcription and miRNA mimics&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Forward Primer</td><td>Integrated DNA Technologies</td><td>TTGGACCCTCGTACAGAAGC&lt;br/&gt; TAATACG</td><td></td></tr><tr><td>Reverse Primer (Ordered as ultramer, 4nmol scale)</td><td>Integrated DNA Technologies</td><td>TTTTTTTTTTTTTTTTTTTTTTTT&lt;br/&gt; TTTTTTTTTTTTTTTTTTTTTTTT&lt;br/&gt; TTTTTTTTTTTTTTTTTTTTTTTT&lt;br/&gt; TTTTTTTTTTTTTTTTTTTTTTTT&lt;br/&gt; TTTTTTTTTTTTTTTTTTTTTTTT&lt;br/&gt; CTTCCTACTCAGGCTTTATTCA&lt;br/&gt; AAGACCA</td><td></td></tr><tr><td>(ARCA Cap) 3&amp;acute;-0-Me-m7G(5&#039;)ppp(5&#039;)G&amp;nbsp;</td><td>New England Biolabs</td><td>S1411S</td><td></td></tr><tr><td>Pfu Ultra II Hotstart 2x Master Mix</td><td>Agilent</td><td>600850-51</td><td></td></tr><tr><td>5-Methylcytidine-5&#039;-Triphosphate</td><td>Trilink Biotechnologies</td><td>N-1014</td><td></td></tr><tr><td>Antarctic Phosphatase</td><td>New England Biolabs</td><td>M0289L</td><td></td></tr><tr><td>DNase I</td><td>NEB</td><td>M0303S</td><td></td></tr><tr><td>MEGAscript T7 Transcription Kit</td><td>ThermoFisher Scientific</td><td>AM1334</td><td></td></tr><tr><td>Pseudouridine-5&#039;-Triphosphate</td><td>Trilink Biotechnologies</td><td>N-1019</td><td></td></tr><tr><td>Riboguard RNase Inhibitor</td><td>Lucigen</td><td>RG90910K</td><td></td></tr><tr><td>RNA Clean &amp;amp; Concentrator</td><td>ZymoResearch</td><td>R1019</td><td></td></tr><tr><td>Syn-hsa-miR-302a-3p miScript miRNA Mimic</td><td>Qiagen</td><td>MSY0000684</td><td></td></tr><tr><td>Syn-hsa-miR-302b-3p miScript miRNA Mimic</td><td>Qiagen</td><td>MSY0000715</td><td></td></tr><tr><td>Syn-hsa-miR-302c-3p miScript miRNA Mimic</td><td>Qiagen</td><td>MSY0000717</td><td></td></tr><tr><td>Syn-hsa-miR-302d-3p miScript miRNA Mimic</td><td>Qiagen</td><td>MSY0000718</td><td></td></tr><tr><td>Syn-hsa-miR-367-3p miScript miRNA Mimic</td><td>Qiagen</td><td>MSY0000719</td><td></td></tr><tr><td>Water (Nuclease free, Not DEPC-treated)</td><td>Fisher</td><td>AM9937</td><td>Use to dilute modified mRNAs and miRNA mimics</td></tr><tr><td>&lt;strong&gt;Fibroblast culture and reprogramming&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>0.1% Gelatin in H&lt;sub&gt;2&lt;/sub&gt;O</td><td>StemCell technologies</td><td>#07903</td><td></td></tr><tr><td>Stericup-GV Sterile Vacuum Filtration System</td><td>EMD Millipore</td><td>SCGVU05RE</td><td>Use to sterilize the transfection buffer and 0.5 mM EDTA in DPBS</td></tr><tr><td>2-Mercaptoethanol</td><td>ThermoFisher Scientific</td><td>21985023</td><td></td></tr><tr><td>6-well plates (tissue culture treated)</td><td>Corning</td><td>3516</td><td></td></tr><tr><td>DMEM/F12</td><td>ThermoFisher Scientific</td><td>11320033</td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>Fisher</td><td>26-140-079</td><td></td></tr><tr><td>FGF Basic</td><td>ThermoFisher Scientific</td><td>phg0263</td><td></td></tr><tr><td>GlutaMax Supplement</td><td>ThermoFisher Scientific</td><td>35050061</td><td>Glutamine supplement used for the prepration of media</td></tr><tr><td>Heat Inactivated FBS</td><td>Gibco Technologies</td><td>10438026</td><td></td></tr><tr><td>KnockOut Serum Replacement</td><td>ThermoFisher Scientific</td><td>10828010</td><td></td></tr><tr><td>Lipofectamine RNAiMAX Transfection Reagent</td><td>ThermoFisher Scientific</td><td>13778500</td><td>The protocol is optimized for the Lipofectamine RNAiMax transfection reagent</td></tr><tr><td>MEM</td><td>ThermoFisher Scientific</td><td>11095080</td><td></td></tr><tr><td>MEM Non-essential amino acids</td><td>ThermoFisher Scientific</td><td>11140050</td><td></td></tr><tr><td>Opti-MEM I Reduced Serum Medium</td><td>ThermoFisher Scientific</td><td>31985070</td><td>Reduced-serum medium, use to make the transfection buffer by adjusting the pH to 8.2, 500 mL</td></tr><tr><td>Opti-MEM I Reduced Serum Medium</td><td>ThermoFisher Scientific</td><td>31985062</td><td>Reduced-serum medium, use to make the transfection buffer by adjusting the pH to 8.2, 100 mL</td></tr><tr><td>10 M NaOH</td><td>Sigma-Aldrich</td><td>72068</td><td>Make a 1 M solution by diluting in nuclease free water and use for pH adjustment</td></tr><tr><td>Water (Nuclease free, Not DEPC-treated)</td><td>Fisher</td><td>AM9932&amp;nbsp;</td><td>Use to dilute NaOH and wash a pH meter</td></tr><tr><td>Pen/Strep/Fungizone</td><td>GE Healthcare</td><td>SV30079.01</td><td></td></tr><tr><td>rhLaminin-521</td><td>ThermoFisher Scientific</td><td>A29248</td><td>Supplied at a concentration of 100 &amp;micro;g/mL, use as a matrix for the reprogramming procedure</td></tr><tr><td>Dulbecco&#039;s phosphate-buffered saline (DPBS)</td><td>Life Technologies</td><td>14190144</td><td></td></tr><tr><td>Trypsin-EDTA 0.25% Phenol Red</td><td>Life Technologies</td><td>2520056</td><td></td></tr><tr><td>Vaccinia Virus B18R (CF)</td><td>ThermoFisher Scientific</td><td>34-8185-86</td><td></td></tr><tr><td>&lt;strong&gt;iPSC culture&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Corning Matrigel hESC-Qualified Matrix</td><td>Corning</td><td>354277</td><td>Extracellular matrix (ECM) for culturing iPSCs</td></tr><tr><td>EDTA, 0.5 M stock solution</td><td>K&amp;amp;D Medical&amp;nbsp;</td><td>RGF-3130</td><td>Dilute to 0.5 mM in DPBS, filter sterilize and use for iPSC passaging</td></tr><tr><td>mTeSR1</td><td>StemCell Technologies</td><td>85850</td><td>Pluripotent stem cell (PSC) medium, provides growth advantage to iPSCs over fibroblasts</td></tr><tr><td>&lt;strong&gt;Antibodies and Detection&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Rabbit anti Mouse (HRP conjugated)</td><td>Abcam</td><td>ab97046</td><td></td></tr><tr><td>Tra-1-60 (mouse anti human)</td><td>Stemgent</td><td>09-0010</td><td></td></tr><tr><td>Hydrogen Peroxide (30%)</td><td>LabChem</td><td>LC154301</td><td>Dilute to 3% with PBS</td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Fisher</td><td>BP9703100</td><td></td></tr><tr><td>Phosphate-buffered salin (PBS)&amp;nbsp;</td><td>Hyclone</td><td>SH30258.02</td><td>Supplied as 10x, dilute to 1x</td></tr><tr><td>VECTOR NovaRED Peroxidase Substrate Kit</td><td>Vector Laboratories</td><td>SK-4800</td><td></td></tr><tr><td>&lt;strong&gt;Special Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Description&lt;/strong&gt;</td><td></td><td></td><td>&lt;strong&gt;Notes&lt;/strong&gt;</td></tr><tr><td>Biological safety cabinet</td><td></td><td></td><td></td></tr><tr><td>Regular humidified tissue culture incubator</td><td></td><td></td><td>Calibrate CO&lt;sub&gt;2 &lt;/sub&gt;using digital meter, fyrite, or equivalent. Equilibrate incubator to 5% CO&lt;sub&gt;2&lt;/sub&gt;, 37 &amp;deg;C.</td></tr><tr><td>Tri-gas humidified tissue culture incubator</td><td></td><td></td><td>Calibrate CO&lt;sub&gt;2 &lt;/sub&gt;using digital meter, fyrite, or equivalent. Equilibrate incubator to 5% CO&lt;sub&gt;2&lt;/sub&gt;, 5% O&lt;sub&gt;2&lt;/sub&gt;, 37 &amp;deg;C. Use for the reprogramming procedure.</td></tr><tr><td>pH Meter</td><td></td><td></td><td>Must have resolution to two decimal places. Designate to RNA work if possible.</td></tr><tr><td>Inverted microscope</td><td></td><td></td><td>Microscope configured to visualize EGFP for monitoring transfection efficiency.</td></tr></tbody></table>

rna-based reprogramming of human primary fibroblasts into induced pluripotent stem cells

Induced pluripotent stem cells (iPSCs) have proven to be a valuable tool to study human development and disease. Further advancing iPSCs as a regenerative therapeutic requires a safe, robust, and expedient reprogramming protocol. Here, we present a clinically relevant, step-by-step protocol for the extremely high-efficiency reprogramming of human dermal fibroblasts into iPSCs using a non-integrating approach. The core of the protocol consists of expressing pluripotency factors (SOX2, KLF4, cMYC, LIN28A, NANOG, OCT4-MyoD fusion) from in vitro transcribed messenger RNAs synthesized with modified nucleotides (modified mRNAs). The reprogramming modified mRNAs are transfected into primary fibroblasts every 48 h together with mature embryonic stem cell-specific microRNA-367/302 mimics for two weeks. The resulting iPSC colonies can then be isolated and directly expanded in feeder-free conditions. To maximize efficiency and consistency of our reprogramming protocol across fibroblast samples, we have optimized various parameters including the RNA transfection regimen, timing of transfections, culture conditions, and seeding densities. Importantly, our method generates high-quality iPSCs from most fibroblast sources, including difficult-to-reprogram diseased, aged, and/or senescent samples.

It typically takes approximately 5&#8211;6 weeks from the initiation of fibroblast reprogramming to freezing of the first vials of iPSCs (Figure 1). The reprogramming protocol can be generally categorized into two phases. Phase 1 includes the fibroblast culture and seven transfections, with the reprogramming RNA cocktail performed every 48 h. Phase 2 includes isolation, expansion, and characterization of the iPSC colonies.
Before initiating the protocol, it should be ensured that the fibroblasts to be reprogrammed are of good quality. Healthy fibroblasts should appear spindle-shaped, bipolar, and refractile with a doubling time of approximately 24 h. By day 0, 250,000 cells plated into a 10 cm dish on day -2 should grow to 40&#8211;60% confluency (Figure 1, day 0) and yield approximately 6&#8211;10 x 105 cells. Cells proliferating at a slower rate can be compensated for by plating at a higher density on day -2 and on day 0 for reprogramming.
Fibroblasts should appear very sparse following plating into a well of a 6-well format dish for reprogramming (Figure 2, day 1). Twenty-four hours following the first transfection, fibroblasts will lose their spindle shape and adopt a more rounded morphology (Figure 2, day 2), which is maintained through the remainder of reprogramming. Green fluorescence from mWasabi mRNA should be minimally observable on day 2 and steadily increase in brightness to be clearly visible by day 4. The ability to detect mWasabi fluorescence can depend on scope sensitivity and setup. Cell density will gradually and consistently increase throughout the first three transfections (days 1-6), with an apparent burst in proliferation occurring between days 7 and 8. The cells should appear largely confluent by day 10 (Figure 2, day 10). The first iPSC colonies can appear as early as day 11 (Figure 2, day 11); however, colonies may not be observable until as late as day 18. Generally, by days 15&#8211;18, there will be large and obvious iPSC colonies that are clearly distinct from surrounding, incompletely reprogrammed fibroblasts (Figure 2, day 15 and Figure 3, day 17). Immunostaining for the pluripotency marker TRA-1-60 can be performed to assess reprogramming efficiency (Figure 3, day 17, TRA-1-60). In our experience, most fibroblast lines yield hundreds of colonies per reprogrammed well (Figure 3, inset B).
Suboptimal plating density is the most common reason for reduced efficiency of reprogramming in our protocol and is frequently associated with fibroblasts that are diseased, senescent, and/or high-passage. If plating density is too low, there will be large acellular barren patches at the end of reprogramming (Figure 4C), and iPSC colonies may not form (Figure 4D). Reprogrammed cells should be very confluent by day 14 (compare Figure&#160;4A and 4B to Figure 2, day 14). Similarly, if cells are plated too densely or proliferate too quickly, reprogramming efficiency is dramatically reduced.
To maintain homogeneity of patient-derived iPSCs, it is important to expand cell lines from a single colony. Since reprogramming efficiency is very high in our protocol, neighboring iPSC colonies may form in close proximity to and grow into each another (Figure 3, days 15&#8211;17). This sometimes makes it difficult to mechanically separate a single colony for clonal expansion. We have found that it is helpful to first passage a reprogrammed well and dilute it across a larger culture area. A good passage ratio consists of evenly splitting a reprogrammed 6-well-format plate well across an entire 6-well plate.
Following the dilution passage, iPSCs grow as colonies and are easily distinguishable from fibroblasts (Figure 5, day 18). Initially, iPSC colonies may be loosely packed, and individual cells have a relatively large cytoplasmic area. Over the course of 4&#8211;7 days, the iPSCs proliferate and form a characteristic tightly-packed colony with defined edges. Individual cells within the colony have a large nuclear fraction with prominent nucleoli (Figure 5, day 22). There should be many colonies that form in each well, and only those with classic iPSC morphology should be picked for expansion.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58687/58687fig1.jpg" /> 
Figure 1: Reprogramming of human fibroblasts into induced pluripotent stem cells (iPSCs). A schematic protocol for the reprogramming of human fibroblasts is presented. Fibroblasts are first passaged at a low density into a well of a 6-well format dish, followed by seven transfections performed at 48 h intervals. Medium is replaced 16&#8211;20 h after each transfection. Reprogrammed iPSCs are first passaged at approximately day 18, and clonal colonies are picked by day 26. Typically, fibroblast-derived iPSC lines can be frozen for long-term storage by day 38. <a href="https://www.jove.com/files/ftp_upload/58687/58687fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58687/58687fig2.jpg" /> 
Figure 2: Representative daily images during each day of reprogramming. Fibroblasts should be approximately&#160;40&#8211;60% confluent at the time of passage to initiate reprogramming (day 0, cells are plated in a 10 cm dish). The first transfection (T1) occurs on day 1, and the cells should appear very sparse at this point. The following day (day 2), a more rounded morphology should become apparent. Cells will continue to increase in density throughout the protocol with iPSC clusters beginning to appear as early as day 11 (circled in red). By day 15, iPSC colonies will be large with discreet boundaries. Scale bar = 200 &#181;m. <a href="https://www.jove.com/files/ftp_upload/58687/58687fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58687/58687fig3.jpg" /> 
Figure 3: Colony formation following transfections with reprogramming modified mRNAs and miRNA mimics. Low-magnification images were taken of a representative reprogramming on days 15&#8211;17. Following the final transfection, reprogrammed iPSCs will form clear colonies with defined boundaries that expand in size and condense to become clearly distinct from incompletely reprogrammed surrounding fibroblasts. Immunostaining for the pluripotency marker TRA-1-60 indicates the presence of iPSCs (inset A) and can be used for calculation of reprogramming efficiency by counting all colonies within a single well (inset B, examples of countable colonies circled in green). Scale bar = 1 mm. <a href="https://www.jove.com/files/ftp_upload/58687/58687fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/58687/58687fig4.jpg" /> 
Figure 4: Representative images of sub-optimal plating density for reprogramming. (A, B) Examples of fibroblasts that are too sparse by day 14 of reprogramming (compare to Figure 2, day 14). (C) Low magnification image on day 17 of reprogramming with a large, barren patch circled in red. (D) The same well was fixed and stained for TRA-1-60 to confirm overall poor reprogramming efficiency due to low cell density. Scale bars = 200 &#181;m (A, B),&#160;and 1 mm (C, D). <a href="https://www.jove.com/files/ftp_upload/58687/58687fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/58687/58687fig5.jpg" /> 
Figure 5: Representative images of iPSCs after initial passage. After completing transfections with reprogramming modified mRNAs and miRNA mimics, reprogrammed cells are passaged by days 17&#8211;20. iPSCs have a growth advantage in PSC medium and rapidly overtake any fibroblasts that were incompletely reprogrammed. Initially, iPSCs will form colonies that may appear loose with poorly defined borders. Within several days, the cells rapidly proliferate and take on the characteristic morphology of tightly packed cells with a high nucleus-to-cytoplasm ratio, tightly clustering into colonies with distinct borders. Scale bar = 200 &#181;m.&#160;<a href="https://www.jove.com/files/ftp_upload/58687/58687fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about RNA-based Reprogramming of Human Primary Fibroblasts into Induced Pluripotent Stem Cells at JoVE.com

RNA-based Reprogramming of Human Primary Fibroblasts into Induced Pluripotent Stem Cells

Here we describe a clinically relevant, high-efficiency, feeder-free method to reprogram human primary fibroblasts into induced pluripotent stem cells using modified mRNAs encoding reprogramming factors and mature microRNA-367/302 mimics. Also included are methods to assess reprogramming efficiency, expand clonal iPSC colonies, and confirm expression of the pluripotency marker TRA-1-60.

Induced pluripotent stem cells (iPSCs) have proven to be a valuable tool to study human development and disease. Further advancing iPSCs as a regenerative ...

rna-based-reprogramming-human-primary-fibroblasts-into-induced

Research

JoVE Journal

Developmental Biology

10.4K Views.  University of Colorado School of Medicine, Anschutz Medical Campus. Vanwege de hoge efficiëntie kan deze methode de geïnduceerde pluripotente stamcellen, of IPC's, verder bevorderen als hulpmiddel voor het bestuderen van menselijke ziekten en het ontwikkelen van nieuwe stamceltherapieën. Het belangrijkste voordeel van dit protocol is de mogelijkheid om hoogwaardige integratievrije IPC's te genereren van primaire menselijke fibroblasten, waaronder moeilijk te herprogrammeren, ziekte geassocieerd, verouderd en senescent fibroblasten. Het succes van deze meth...

Video: RNA-based Reprogramming of Human Primary Fibroblasts into Induced Pluripotent Stem Cells

Generation of Induced Pluripotent Stem Cells from Frozen Buffy Coats using Non-integrating Episomal Plasmids

Somatic cells can be reprogrammed into induced pluripotent stem cells (iPSCs) by forcing the expression of four transcription factors (Oct-4, Sox-2, Klf-4, and c-Myc), typically expressed by human embryonic stem cells (hESCs). Due to their similarity with hESCs, iPSCs have become an important tool for potential patient-specific regenerative medicine, avoiding ethical issues associated with hESCs. In order to obtain cells suitable for clinical application, transgene-free iPSCs need to be generated to avoid transgene reactivation, altered gene expression and misguided differentiation. Moreover, a highly efficient and inexpensive reprogramming method is necessary to derive sufficient iPSCs for therapeutic purposes. Given this need, an efficient non-integrating episomal plasmid approach is the preferable choice for iPSC derivation. Currently the most common cell type used for reprogramming purposes are fibroblasts, the isolation of which requires tissue biopsy, an invasive surgical procedure for the patient. Therefore, human peripheral blood represents the most accessible and least invasive tissue for iPSC generation.
In this study, a cost-effective and viral-free protocol using non-integrating episomal plasmids is reported for the generation of iPSCs from human peripheral blood mononuclear cells (PBMNCs) obtained from frozen buffy coats after whole blood centrifugation and without density gradient separation.

Induced pluripotent stem cells (iPSCs) represent a source of patient-specific tissues for clinical applications and basic research. Here, we present a detailed protocol to reprogram human peripheral blood mononuclear cells (PBMNCs) obtained from frozen buffy coats into viral-free iPSCs using non-integrating episomal plasmids.

Somatic cells can be reprogrammed into induced pluripotent stem cells (iPSCs) by forcing the expression of four transcription factors (Oct-4, Sox-2, ...

Generating iPS Cells from MEFS through Forced Expression of Sox-2, Oct-4, c-Myc, and Klf4

Pluripotency can be induced in differentiated murine by viral transduction of Oct4, Sox2, Klf4, and c-Myc (Takahashi and Yamanaka, 2006; Wernig, et al., 2007; Okita, et al., 2007; Maherali, et al., 2007). We have devised a reprogramming strategy in which these four transcription factors are expressed from doxycycline (dox)-inducible lentiviral vectors (Brambrink et al., 2008). Using these inducible constructs, we can derive induced pluripotent stem (iPS) cells from mouse embryonic fibroblasts (MEFs). In this video, we demonstrate the procedure for the generation of inducible lentiviruses that express the four transcription factors and show how to infect MEFs with these viruses in order to produce iPS cells. By using inducible lentiviruses, the expression of the four factors in controlled by the addition of doxycyline to the culture medium. The advantage of this system over the traditional retroviral infection is the ability to turn the genes on and off so that the kinetics of reprogramming and gene expression requirements can be analyzed in detail.

This video shows the procedure for generating induced pluripotent stem cells using inducible lentivirus that express Oct4, Sox2, c-Myc and Klf4.

Pluripotency can be induced in differentiated murine by viral transduction of Oct4, Sox2, Klf4, and c-Myc (Takahashi and Yamanaka, 2006;  Wernig, et al., ...

Biology

Integration Free Derivation of Human Induced Pluripotent Stem Cells Using Laminin 521 Matrix

Xeno-free and fully defined conditions are key parameters for robust and reproducible generation of homogenous human induced pluripotent stem (hiPS) cells. Maintenance of hiPS cells on feeder cells or undefined matrices are susceptible to batch variances, pathogenic contamination and risk of immunogenicity. Utilizing the defined recombinant human laminin 521 (LN-521) matrix in combination with xeno-free and defined media formulations reduces variability and allows for the consistent generation of hiPS cells. The Sendai virus (SeV) vector is a non-integrating RNA-based system, thus circumventing concerns associated with the potential disruptive effect on genome integrity integrating vectors can have. Furthermore, these vectors have demonstrated relatively high efficiency in the reprogramming of dermal fibroblasts. In addition, enzymatic single cell passaging of cells facilitates homogeneous maintenance of hiPS cells without substantial prior experience of stem cell culture. Here we describe a protocol that has been extensively tested and developed with a focus on reproducibility and ease of use, providing a robust and practical way to generate defined and xeno-free human hiPS cells from fibroblasts.

Robust derivation of human induced pluripotent stem (hiPS) cells was achieved by using non-integrating Sendai virus (SeV) vector mediated reprogramming of dermal fibroblasts. hiPS cell maintenance and clonal expansion was performed using xeno-free and chemically defined culture conditions with recombinant human laminin 521 (LN-521) matrix and Essential E8 (E8) Medium.

Xeno-free and fully defined conditions are key parameters for robust and reproducible generation of homogenous human induced pluripotent stem (hiPS) ...

Generation of Induced Pluripotent Stem Cells by Reprogramming Human Fibroblasts with the Stemgent Human TF Lentivirus Set

In 2006, Yamanaka and colleagues first demonstrated that retrovirus-mediated delivery and expression of Oct4, Sox2, c-Myc and Klf4 is capable of inducing the pluripotent state in mouse fibroblasts.1 The same group also reported the successful reprogramming of human somatic cells into induced pluripotent stem (iPS) cells using human versions of the same transcription factors delivered by retroviral vectors.2 Additionally, James Thomson et al. reported that the lentivirus-mediated co-expression of another set of factors (Oct4, Sox2, Nanog and Lin28) was capable of reprogramming human somatic cells into iPS cells.3
iPS cells are similar to ES cells in morphology, proliferation and the ability to differentiate into all tissue types of the body. Human iPS cells have a distinct advantage over ES cells as they exhibit key properties of ES cells without the ethical dilemma of embryo destruction. The generation of patient-specific iPS cells circumvents an important roadblock to personalized regenerative medicine therapies by eliminating the potential for immune rejection of non-autologous transplanted cells.
Here we demonstrate the protocol for reprogramming human fibroblast cells using the Stemgent Human TF Lentivirus Set. We also show that cells reprogrammed with this set begin to show iPS morphology four days post-transduction. Using the Stemolecule Y27632, we selected for iPS cells and observed correct morphology after three sequential rounds of colony picking and passaging. We also demonstrate that after reprogramming cells displayed the pluripotency marker AP, surface markers TRA-1-81, TRA-1-60, SSEA-4, and SSEA-3, and nuclear markers Oct4, Sox2 and Nanog.

We demonstrate the protocol for the generation of induced pluripotent stem cells from human somatic cells using lentivirus-mediated delivery of the human factors Oct4, Sox2, Nanog, and Lin28. Pluripotency was confirmed by morphology and the presence of embryonic stem (ES) cell-specific markers.

In 2006, Yamanaka and colleagues first demonstrated that retrovirus-mediated delivery and expression of Oct4, Sox2, c-Myc and Klf4 is capable of inducing ...

Derivation of Adult Human Fibroblasts and their Direct Conversion into Expandable Neural Progenitor Cells

Generation of&#160;induced pluripotent stem cell (iPSCs) from adult skin fibroblasts and subsequent differentiation into somatic cells provides fascinating prospects for the derivation of autologous transplants that circumvent histocompatibility barriers. However, progression through a pluripotent state and subsequent complete differentiation into desired lineages remains a roadblock for the clinical translation of iPSC technology because of the associated neoplastic potential and genomic instability. Recently, we and others showed that somatic cells cannot only be converted into iPSCs but also into different types of multipotent somatic stem cells by using defined factors, thereby circumventing progression through the pluripotent state. In particular, the direct conversion of human fibroblasts into induced neural progenitor cells (iNPCs) heralds the possibility of a novel autologous cell source for various applications such as cell replacement, disease modeling and drug screening. Here, we describe the isolation of adult human primary fibroblasts by skin biopsy and their efficient direct conversion into iNPCs by timely restricted expression of Oct4, Sox2, Klf4, as well as c-Myc. Sox2-positive neuroepithelial colonies appear after 17 days of induction and iNPC lines can be established efficiently by monoclonal isolation and expansion. Precise adjustment of viral multiplicity of infection and supplementation of leukemia inhibitory factor during the induction phase represent critical factors to achieve conversion efficiencies of up to 0.2%. Thus far, patient-specific iNPC lines could be expanded for more than 12 passages and uniformly display morphological and molecular features of neural stem/progenitor cells, such as the expression of Nestin and Sox2. The iNPC lines can be differentiated into neurons and astrocytes as judged by staining against TUJ1 and GFAP, respectively. In conclusion, we report a robust protocol for the derivation and direct conversion of human fibroblasts into stably expandable neural progenitor cells that might provide a cellular source for biomedical applications such as autologous neural cell replacement and disease modeling.

Generation of induced pluripotent stem cells provides fascinating prospects for the derivation of autologous transplants. However, progression through a pluripotent state and laborious re-differentiation still hinders clinical translation. Here we describe the derivation of adult human fibroblasts and their direct conversion into induced neural progenitor cells and the subsequent differentiation into neural lineages.

Generation of&#160;induced pluripotent stem cell (iPSCs) from adult skin fibroblasts and subsequent differentiation into somatic cells provides ...

Neuroscience

Selecting and Isolating Colonies of Human Induced Pluripotent Stem Cells Reprogrammed from Adult Fibroblasts

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) in the presence of sodium butyrate 1-3. We used this method to reprogram late passage (&gt;p10) human adult fibroblasts derived from Friedreich's ataxia patient (GM03665, Coriell Repository). The reprogramming approach includes highly efficient transduction protocol using repetitive centrifugation of fibroblasts in the presence of virus-containing media. The reprogrammed hiPSC colonies were identified using live immunostaining for Tra-1-81, a surface marker of pluripotent cells, separated from non-reprogrammed fibroblasts and manually passaged 4,5. These hiPSC were then transferred to Matrigel plates and grown in feeder-free conditions, directly from the reprogramming plate. Starting from the first passage, hiPSC colonies demonstrate characteristic hES-like morphology. Using this protocol more than 70% of selected colonies can be successfully expanded and established into cell lines. The established hiPSC lines displayed characteristic pluripotency markers including surface markers TRA-1-60 and SSEA-4, as well as nuclear markers Oct3/4, Sox2 and Nanog. 
The protocol presented here has been established and tested using adult fibroblasts obtained from Friedreich's ataxia patients and control individuals 6, human newborn fibroblasts, as well as human keratinocytes.

We present a protocol for efficient reprogramming of human somatic cells into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding Oct3/4, Sox2, Klf4 and c-myc (OSKM) and identification of correctly reprogrammed hiPSC by live staining with Tra-1-81 antibody.

Herein we present a protocol of reprogramming human adult fibroblasts into human induced pluripotent stem cells (hiPSC) using retroviral vectors encoding ...

Isolation of Adult Human Dermal Fibroblasts from Abdominal Skin and Generation of Induced Pluripotent Stem Cells Using a Non-Integrating Method

Induced pluripotent stem cells (iPSCs) could be considered, to date, a promising source of pluripotent cells for the management of currently untreatable diseases, for the reconstitution and regeneration of injured tissues and for the development of new drugs. Despite all the advantages related to the use of iPSCs, such as the low risk of rejection, the lessened ethical issues, and the possibility to obtain them from both young and old patients without any difference in their reprogramming potential, problems to overcome are still numerous. In fact, cell reprogramming conducted with viral and integrating viruses can cause infections and the introduction of required genes can induce a genomic instability of the recipient cell, impairing their use in clinic. In particular, there are many concerns about the use of c-Myc gene, well-known from several studies for its mutation-inducing activity. Fibroblasts have emerged as the suitable cell population for cellular reprogramming as they are easy to isolate and culture and are harvested by a minimally invasive skin punch biopsy. The protocol described here provides a detailed step-by-step description of the whole procedure, from sample processing to obtain cell cultures, choice of reagents and supplies, cleaning and preparation, to cell reprogramming by the means of a commercial non-modified RNAs (NM-RNAs)-based reprogramming kit. The chosen reprogramming kit allows an effective reprogramming of human dermal fibroblast to iPSCs and small colonies can be seen as early as 24 h after the first transfection, even with modifications with the respect to the standard datasheet. The reprogramming procedure used in this protocol offers the advantage of a safe reprogramming, without the risk of infections caused by viral vector-based methods, reduces the cellular defense mechanisms, and allows the generation of xeno-free iPSCs, all critical features that are mandatory for further clinical applications.

Cell reprogramming requires the introduction of key genes, which regulate and maintain the pluripotent cell state. The protocol described enables the formation of induced pluripotent stem cells (iPSCs) colonies from human dermal fibroblasts without viral/integrating methods but using non-modified RNAs (NM-RNAs) combined with immune evasion factors reducing cellular defense mechanisms.

Induced pluripotent stem cells (iPSCs) could be considered, to date, a promising source of pluripotent cells for the management of currently untreatable ...

Bioengineering

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...

Simple Generation of a High Yield Culture of Induced Neurons from Human Adult Skin Fibroblasts

Induced neurons (iNs), the product of somatic cells directly converted to neurons, are a way to obtain patient-derived neurons from tissue that is easily accessible. Through this route, mature neurons can be obtained in a matter of a few weeks. Here, we describe a straightforward and rapid one-step protocol to obtain iNs from dermal fibroblasts obtained through biopsy samples from adult human donors. We explain each step of the process, including the maintenance of the dermal fibroblasts, the freezing procedure to build a stock of the cell line, seeding of the cells for reprogramming, as well as the culture conditions during the conversion process. In addition, we describe the preparation of glass coverslips for electrophysiological recordings, long-term coating conditions, and fluorescence activated cell sorting (FACS). We also illustrate examples of the results to be expected. The protocol described here is easy to perform and can be applied to human fibroblasts derived from human skin biopsies from patients with various different diagnoses and ages. This protocol generates a sufficient amount of iNs which can be used for a wide array of biomedical applications, including disease modeling, drug screening, and target validation.

Direct neuronal reprogramming generates neurons that maintain the age of the starting somatic cell. Here, we describe a single vector-based method to generate induced neurons from dermal fibroblasts obtained from adult human donors.

Induced neurons (iNs), the product of somatic cells directly converted to neurons, are a way to obtain patient-derived neurons from tissue that is easily ...

Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of the body and consequently have vast potential for regenerative medicine applications. Traditionally iPS cells are generated by viral introduction of transcription factors Oct-4, Klf-4, Sox-2, and c-Myc (OKSM) into fibroblasts. However, reprogramming is an inefficient process with only 0.1-1% of cells reverting towards a pluripotent state, making it difficult to study the reprogramming mechanism. A proven methodology that has allowed the study of the reprogramming process is to separate the rare intermediates of the reaction from the refractory bulk population. In the case of mouse embryonic fibroblasts (MEFs), we and others have previously shown that reprogramming cells undergo a distinct series of changes in the expression profile of cell surface markers which can be used for the separation of these cells. During the early stages of OKSM expression successfully reprogramming cells lose fibroblast identity marker Thy-1.2 and up-regulate pluripotency associated marker Ssea-1. The final transition of a subset of Ssea-1 positive cells towards the pluripotent state is marked by the expression of Epcam during the late stages of reprogramming. Here we provide a detailed description of the methodology used to isolate reprogramming intermediates from cultures of reprogramming MEFs. In order to increase experimental reproducibility we use a reprogrammable mouse strain that has been engineered to express a transcriptional transactivator (m2rtTA) under control of the Rosa26 locus and OKSM under control of a doxycycline responsive promoter. Cells isolated from these mice are isogenic and express OKSM homogenously upon addition of doxycycline. We describe in detail the establishment of the reprogrammable mice, the derivation of MEFs, and the subsequent isolation of intermediates during reprogramming into iPS cells via fluorescent activated cells sorting (FACS).

Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam.

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of ...

RNA-based Reprogramming of Human Primary Fibroblasts into Induced Pluripotent Stem Cells

Samenvatting

Meer video's verkennen