D.G. greatly appreciates support by the German Research Foundation (DFG) through the DFG Collaborative Research Centers SFB1129 (Projektnummer 240245660) and TRR179 (Projektnummer 272983813), as well as by the German Center for Infection Research (DZIF, BMBF; TTU-HIV 04.819).

<ol>
	<li>Wang, D., Tai, P. W. L., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+vector+as+a+platform+for+gene+therapy+delivery.">Adeno-associated virus vector as a platform for gene therapy delivery.</a> Nature Reviews Drug Discovery. 18 (5), 358-378 (2019).</li><li>Muhuri, M., Levy, D. I., Schulz, M., McCarty, D., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Durability+of+transgene+expression+after+rAAV+gene+therapy.">Durability of transgene expression after rAAV gene therapy.</a> Molecular Therapy. 30 (4), 1364-1380 (2022).</li><li>Li, C., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+adeno-associated+virus+vectors+for+gene+therapy.">Engineering adeno-associated virus vectors for gene therapy.</a> Nature Reviews Genetics. 21 (4), 255-272 (2020).</li><li>Kuzmin, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+clinical+landscape+for+AAV+gene+therapies.">The clinical landscape for AAV gene therapies.</a> Nature Reviews Drug Discovery. 20 (3), 173-174 (2021).</li><li>Mullard, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+therapy+community+grapples+with+toxicity+issues,+as+pipeline+matures.">Gene therapy community grapples with toxicity issues, as pipeline matures.</a> Nature Reviews Drug Discovery. 20 (11), 804-805 (2021).</li><li>Nature Biotechnology. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+therapy+at+the+crossroads.">Gene therapy at the crossroads.</a> Nature Biotechnology. 40 (5), 621 (2022).</li><li>Becker, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fantastic+AAV+Gene+Therapy+Vectors+and+How+to+Find+Them-Random+Diversification,+Rational+Design+and+Machine+Learning.">Fantastic AAV Gene Therapy Vectors and How to Find Them-Random Diversification, Rational Design and Machine Learning.</a> Pathogens. 11 (7), 756 (2022).</li><li>Perabo, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+viral+vectors+with+modified+tropism:+the+adeno-associated+virus+display.">In vitro selection of viral vectors with modified tropism: the adeno-associated virus display.</a> Molecular Therapy. 8 (1), 151-157 (2003).</li><li>Muller, O. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+peptide+libraries+displayed+on+adeno-associated+virus+to+select+for+targeted+gene+therapy+vectors.">Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors.</a> Nature Biotechnology. 21 (9), 1040-1046 (2003).</li><li>Dalkara, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo-directed+evolution+of+a+new+adeno-associated+virus+for+therapeutic+outer+retinal+gene+delivery+from+the+vitreous.">In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous.</a> Science Translational Medicine. 5 (189), (2013).</li><li>Sahel, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Partial+recovery+of+visual+function+in+a+blind+patient+after+optogenetic+therapy.">Partial recovery of visual function in a blind patient after optogenetic therapy.</a> Nature Medicine. 27 (7), 1223-1229 (2021).</li><li>Adachi, K., Enoki, T., Kawano, Y., Veraz, M., Nakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drawing+a+high-resolution+functional+map+of+adeno-associated+virus+capsid+by+massively+parallel+sequencing.">Drawing a high-resolution functional map of adeno-associated virus capsid by massively parallel sequencing.</a> Nature Communications. 5, 3075 (2014).</li><li>Marsic, D., Mendez-Gomez, H. R., Zolotukhin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-accuracy+biodistribution+analysis+of+adeno-associated+virus+variants+by+double+barcode+sequencing.">High-accuracy biodistribution analysis of adeno-associated virus variants by double barcode sequencing.</a> Molecular Therapy-Methods &amp; Clinical Development. 2, 15041 (2015).</li><li>Korbelin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pulmonary+targeting+of+adeno-associated+viral+vectors+by+next-generation+sequencing-guided+screening+of+random+capsid+displayed+peptide+libraries.">Pulmonary targeting of adeno-associated viral vectors by next-generation sequencing-guided screening of random capsid displayed peptide libraries.</a> Molecular Therapy. 24 (6), 1050-1061 (2016).</li><li>Deverman, B. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cre-dependent+selection+yields+AAV+variants+for+widespread+gene+transfer+to+the+adult+brain.">Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain.</a> Nature Biotechnology. 34 (2), 204-209 (2016).</li><li>Ravindra Kumar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+Cre-dependent+selection+yields+systemic+AAVs+for+targeting+distinct+brain+cell+types.">Multiplexed Cre-dependent selection yields systemic AAVs for targeting distinct brain cell types.</a> Nature Methods. 17 (5), 541-550 (2020).</li><li>Hanlon, K. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+an+efficient+AAV+vector+for+robust+CNS+transgene+expression.">Selection of an efficient AAV vector for robust CNS transgene expression.</a> Molecular Therapy-Methods &amp; Clinical Development. 15, 320-332 (2019).</li><li>Nonnenmacher, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+evolution+of+blood-brain-barrier-penetrating+AAV+capsids+by+RNA-driven+biopanning.">Rapid evolution of blood-brain-barrier-penetrating AAV capsids by RNA-driven biopanning.</a> Molecular Therapy-Methods &amp; Clinical Development. 20, 366-378 (2021).</li><li>Tabebordbar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+a+family+of+AAV+capsid+variants+enabling+potent+muscle-directed+gene+delivery+across+species.">Directed evolution of a family of AAV capsid variants enabling potent muscle-directed gene delivery across species.</a> Cell. 184 (19), 4919-4938 (2021).</li><li>Davidsson, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+capsid+evolution+approach+performed+in+vivo+for+the+design+of+AAV+vectors+with+tailored+properties+and+tropism.">A systematic capsid evolution approach performed in vivo for the design of AAV vectors with tailored properties and tropism.</a> Proceedings of the National Academy of Sciences. 116 (52), 27053-27062 (2019).</li><li>Pekrun, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+a+barcoded+AAV+capsid+library+to+select+for+clinically+relevant+gene+therapy+vectors.">Using a barcoded AAV capsid library to select for clinically relevant gene therapy vectors.</a> Journal of Clinical Investigation Insight. 4 (22), (2019).</li><li>Ogden, P. J., Kelsic, E. D., Sinai, S., Church, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+AAV+capsid+fitness+landscape+reveals+a+viral+gene+and+enables+machine-guided+design.">Comprehensive AAV capsid fitness landscape reveals a viral gene and enables machine-guided design.</a> Science. 366 (6469), 1139-1143 (2019).</li><li>Kondratov, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+study+of+a+29-capsid+AAV+library+in+a+non-human+primate+central+nervous+system.">A comprehensive study of a 29-capsid AAV library in a non-human primate central nervous system.</a> Molecular Therapy. 29 (9), 2806-2820 (2021).</li><li>Weinmann, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+myotropic+AAV+by+massively+parallel+in+vivo+evaluation+of+barcoded+capsid+variants.">Identification of a myotropic AAV by massively parallel in vivo evaluation of barcoded capsid variants.</a> Nature Communications. 11 (1), 5432 (2020).</li><li>Kremer, L. P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+screening+of+novel+AAV+capsids+identifies+variants+for+transduction+of+adult+NSCs+within+the+subventricular+zone.">High throughput screening of novel AAV capsids identifies variants for transduction of adult NSCs within the subventricular zone.</a> Molecular Therapy-Methods &amp; Clinical Development. 23, 33-50 (2021).</li><li>Borner, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pre-arrayed+pan-AAV+peptide+display+libraries+for+rapid+single-round+screening.">Pre-arrayed pan-AAV peptide display libraries for rapid single-round screening.</a> Molecular Therapy. 28 (4), 1016-1032 (2020).</li><li>Kienle, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+and+evolution+of+synthetic+adeno-associated+virus+(AAV)+gene+therapy+vectors+via+DNA+family+shuffling.">Engineering and evolution of synthetic adeno-associated virus (AAV) gene therapy vectors via DNA family shuffling.</a> Journal of Visualized Experiments. (62), e3819 (2012).</li><li>Furuta-Hanawa, B., Yamaguchi, T., Uchida, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two-dimensional+droplet+digital+PCR+as+a+tool+for+titration+and+integrity+evaluation+of+recombinant+adeno-associated+viral+vectors.">Two-dimensional droplet digital PCR as a tool for titration and integrity evaluation of recombinant adeno-associated viral vectors.</a> Human Gene Therapy Methods. 30 (4), 127-136 (2019).</li><li>Lyons, E., Sheridan, P., Tremmel, G., Miyano, S., Sugano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+DNA+barcode+library+generation+for+biomolecule+identification+in+high-throughput+screens.">Large-scale DNA barcode library generation for biomolecule identification in high-throughput screens.</a> Scientific Reports. 7 (1), 13899 (2017).</li><li>Korbelin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+design+and+production+strategies+for+novel+adeno-associated+viral+display+peptide+libraries.">Optimization of design and production strategies for novel adeno-associated viral display peptide libraries.</a> Gene Therapy. 24 (8), 470-481 (2017).</li><li>Korbelin, J., Trepel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+successfully+screen+random+adeno-associated+virus+display+peptide+libraries+in+vivo.">How to successfully screen random adeno-associated virus display peptide libraries in vivo.</a> Human Gene Therapy Methods. 28 (3), 109-123 (2017).</li><li>Herrmann, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+and+all-inclusive+pipeline+for+shuffling+of+adeno-associated+viruses.">A robust and all-inclusive pipeline for shuffling of adeno-associated viruses.</a> American Chemical Society Synthetic Biology. 8 (1), 194-206 (2019).</li><li>Choudhury, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+selection+yields+AAV-B1+Capsid+for+central+nervous+system+and+muscle+gene+therapy.">In vivo selection yields AAV-B1 Capsid for central nervous system and muscle gene therapy.</a> Molecular Therapy. 24 (7), 1247-1257 (2016).</li><li>Buschmann, T., Bystrykh, L. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Levenshtein+error-correcting+barcodes+for+multiplexed+DNA+sequencing.">Levenshtein error-correcting barcodes for multiplexed DNA sequencing.</a> BMC Bioinformatics. 14, 272 (2013).</li><li>Buschmann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNABarcodes:+an+R+package+for+the+systematic+construction+of+DNA+sample+tags.">DNABarcodes: an R package for the systematic construction of DNA sample tags.</a> Bioinformatics. 33 (6), 920-922 (2017).</li><li>Li, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+mouse+transcriptomic+BodyMap+across+17+tissues+by+RNA-seq.">A comprehensive mouse transcriptomic BodyMap across 17 tissues by RNA-seq.</a> Scientific Reports. 7 (1), 4200 (2017).</li><li>Clarner, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+one-step+RT-ddPCR+method+to+determine+the+expression+and+potency+of+AAV+vectors.">Development of a one-step RT-ddPCR method to determine the expression and potency of AAV vectors.</a> Molecular Therapy-Methods &amp; Clinical Development. 23, 68-77 (2021).</li><li>Zolotukhin, S., Vandenberghe, L. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AAV+capsid+design:+A+Goldilocks+challenge.">AAV capsid design: A Goldilocks challenge.</a> Trends in Molecular Medicine. 28 (3), 183-193 (2022).</li><li>Brown, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=deep+parallel+characterization+of+AAV+tropism+and+AAV-mediated+transcriptional+changes+via+single-cell+RNA+sequencing.">deep parallel characterization of AAV tropism and AAV-mediated transcriptional changes via single-cell RNA sequencing.</a> Frontiers in Immunology. 12, 730825 (2021).</li></ol>

D.G. is a co-founder of AaviGen GmbH. D.G. and K.R. are inventors on a pending patent application related to the generation of immune-evading AAV capsid variants. The rest of the authors have nothing to disclose.

In this protocol, the steps needed for peptide display AAV capsid engineering and for barcoded AAV library screening, as well as for bioinformatic analysis of library composition and capsid performance, are outlined. This protocol focuses on the steps that facilitate the bioinformatic analysis of these types of libraries, because most virology laboratories lag in programming skills to match their proficiency in molecular biology techniques. Both types of libraries have been extensively described in the literature, as out...

Gene transfer therapy is the introduction of genetic material in cells to repair, replace, or alter the cellular genetic material to prevent, treat, cure, or ameliorate disease. Gene transfer, both in vivo and ex vivo, relies on different delivery systems, non-viral and viral. Viruses have evolved naturally to efficiently transduce their target cells and can be used as delivery vectors. Amongst the different types of viral vectors employed in gene therapy, adeno-associated viruses have been increasingly used, owing to their lack of pathogenicity, safety, low immunogenicity, and most importantly their ability to sustain long-term, non-integrating expression1,2,3. AAV gene therapy has yielded considerable achievements over the past decade; three therapies have been approved by the European Medicines Agency and the US Food and Drug Administration for use in humans3,4. Several clinical trials are also underway to treat a variety of diseases, such as hemophilia, muscular, cardiac, and neurological diseases, as reviewed elsewhere3. Despite decades of advancement, the field of gene therapy has experienced a series of setbacks in recent years4, most importantly deaths in clinical trials5 that have been put on hold due to dose-limiting toxicities, particularly for tissues that are massive, such as muscle, or difficult to reach, such as brain6.
The AAV vectors currently being used in clinical trials belong to the natural serotypes with a few exceptions1. AAV engineering offers the opportunity to develop vectors with superior organ- or cell-specificity and efficiency. In the past two decades, several approaches have been successfully applied, such as peptide display, loop-swap, capsid DNA shuffling, error-prone PCR, and targeted design, to generate individual AAV variants or libraries thereof&#160;with diverse properties7. These are then subjected to multiple rounds of directed evolution to select the variants within them with the desired properties, as reviewed elsewhere1,3. Of all the capsid evolution strategies, peptide display AAV libraries have been the most widely used, due to some unique properties: they are relatively easy to generate, and they can achieve high diversity and high-throughput sequencing, which allows trailing their evolution.
The first successful peptide insertion AAV libraries were described almost 20 years ago. In one of the first, Perabo et al.8 constructed a library of modified AAV2 capsids, in which a pool of randomly generated oligonucleotides was inserted in a plasmid at a position that corresponds to amino-acid 587 of the VP1 capsid protein, in the three-fold axis protruding from the capsid. Using adenovirus co-infection, the AAV library was evolved through multiple rounds of selection, and the final re-targeted variants were shown to be capable of transducing cell lines refractory to the parental AAV28. Shortly thereafter, M&#252;ller et al.9 introduced the two-step system for library production, a significant improvement to the protocol. Initially, the plasmid library, together with an adenoviral helper plasmid, are used to produce an AAV library that contains chimeric capsids. This AAV shuttle library is used to infect cells at low multiplicity of infection (MOI), with the aim to introduce one viral genome per cell. Co-infection with adenovirus ensures the production of AAVs with a matching genome and capsid9. About a decade later, Dalkara10 used in vivo directed evolution to create the 7m8 variant. This variant has a 10 amino-acid insertion (LALGETTRPA), three of which act as linkers, and efficiently targets the outer retina after intravitreal injection10. This engineered capsid is an exceptional success story, as it is one of the few engineered capsids to make it to the clinic thus far11.
The field experienced a second boost with the introduction of next-generation sequencing (NGS) techniques. Two publications from Adachi et al.12&#160;in 2014 and from Marsic et al.13&#160;in&#160;2015, showcased the power of NGS to track the distribution of barcoded AAV capsid libraries with high accuracy. A few years later, the NGS of barcoded regions was adapted to the peptide insertion region to follow the capsid evolution. K&#246;rbelin et al.14 performed an NGS-guided screening to identify a pulmonary-targeted AAV2-based capsid. The NGS analysis helped calculate three rating scores: the enrichment score between selection rounds, the general specificity score to determine tissue specificity, and finally the combined score14. The Gradinaru lab15 published the Cre-recombination-based AAV targeted evolution (CREATE) system in the same year, which facilitates a cell-type-specific selection. In this system, the capsid library carries a Cre-invertible switch, as the polyA signal is flanked by two loxP sites. The AAV library is then injected in Cre mice, where the polyA signal is inverted only in Cre+ cells, providing the template for binding of a reverse PCR primer with the forward primer within the capsid gene. This highly specific PCR rescue enabled the identification of the AAV-PHP.B variant that can cross the blood-brain barrier15. This system was further evolved into M-CREATE (Multiplexed-CREATE), in which NGS and synthetic library generation were integrated in the pipeline16.
An improved RNA-based&#160;version of this system from the Maguire lab17, iTransduce, allows selection on the DNA level of capsids that functionally transduce cells and express their genomes. The viral genome of the peptide display library comprises a Cre gene under the control of a ubiquitous promoter and the capsid gene under the control of the p41 promoter. The library is injected in mice that have a loxP-STOP-loxP cassette upstream of tdTomato. Cells transduced with AAV variants that express the viral genome and therefore Cre express tdTomato and, in combination with cell markers, can be sorted and selected17. Similarly, Nonnenmacher et al.18 and Tabebordbar et al.19 placed the capsid gene library under the control of tissue-specific promoters. After injection in different animal models, viral RNA was used to isolate the capsid variants.
An alternative approach is to use barcoding to tag capsid libraries. The Bj&#246;rklund lab20 used this approach to barcode peptide insertion capsid libraries and developed the barcoded rational AAV vector evolution (BRAVE). In one plasmid, the Rep2Cap cassette is cloned next to an inverted terminal repeats (ITR)-flanked, yellow fluorescent protein (YFP)-expressing, barcode-tagged transgene. Using loxP sites between the end of cap and the beginning of the barcode, an in vitro Cre recombination generates a fragment small enough for NGS, thereby allowing the association of peptide insertion with the unique barcode (look-up table, LUT). AAV production is performed using the plasmid library and the barcodes expressed in the mRNA are screened after in vivo application, again with NGS20. When the capsid libraries comprise variants of the whole capsid gene (i.e., shuffled libraries), long-read sequencing needs to be used. Several groups have used barcodes to tag these diverse libraries, which enables NGS with higher read depth. The Kay lab21 tagged highly diverse capsid shuffled libraries with barcodes downstream of the cap polyA signal. In a first step, a barcoded plasmid library was generated, and the shuffled capsid gene library was cloned into it. Then a combination of MiSeq (short read, higher read depth) and PacBio (long read, lower read depth) NGS as well as Sanger sequencing was used to generate their LUT21. In 2019, Ogden and colleagues from the Church lab22 delineated the AAV2 capsid fitness for multiple functions using libraries that had single point mutations, insertions, and deletions in every position, which ultimately enabled machine-guided design. For the generation of the library, smaller fragments of the capsid gene were synthesized, tagged with a barcode, next-generation sequenced, and then cloned into the full capsid gene. The NGS data were used to generate a LUT. The library was then screened using just the barcodes and short read sequencing, which in turn allows higher read depth22.
Barcoded libraries have been predominantly&#160;used to screen a pool of known, natural, and engineered variants following several rounds of selection of capsid libraries or independent of a capsid evolution study. The advantage of such libraries is the opportunity to screen multiple capsids, whilst reducing animal numbers and minimizing variation between animals. The first studies that introduced this technology to the AAV field were published almost a decade ago. The Nakai lab12 tagged 191 double alanine mutants covering amino acids 356 to 736 on the VP1 from AAV9 with a pair of 12-nucleotide barcodes. Using NGS, the library was screened in vivo for galactose binding and other properties12. Marsic and colleagues delineated the biodistribution of AAV variants using also a double-barcorded analysis 1 year later13. A more recent study in non-human primates compared the biodistribution in the central nervous system of 29 capsids using different routes of delivery23. Our lab has recently published barcoded AAV library screens of 183 variants that included natural and engineered AAVs. These screens on the DNA and RNA level led to the identification of a highly myotropic AAV variant24&#160;in mice as well as others displaying a high cell-type specificity in the mouse brain25.
Here, we describe the methodology used in this work and expand on it to include screening of AAV peptide display libraries. This comprises the generation of AAV2 peptide display libraries, a digital droplet PCR (dd-PCR) method for quantification, and finally an NGS pipeline to analyze the AAV variants, based in part on the work by Weinmann and colleagues24. Finally, a description of the generation of barcoded AAV libraries and the NGS pipeline used in the same publication is provided.

<table><tbody><tr><td>Amplification primer</td><td>ELLA Biotech (Munich, Germany)</td><td>-</td><td>Second-strand synthesis of oligonucleotide insert</td></tr><tr><td>Agilent DNA 1000 Reagents</td><td>Agilent Technologies (Santa Clara, CA, USA)</td><td>5067-1504</td><td>DNA fragment validation</td></tr><tr><td>Agilent 2100 Bioanalyzer System</td><td>Agilent Technologies (Santa Clara, CA, USA)</td><td>G2938C</td><td>DNA fragment validation</td></tr><tr><td>AllPrep DNA/RNA Mini Kit&amp;nbsp;</td><td>Qiagen (Venlo, Netherlands)</td><td>80204</td><td>DNA/RNA extraction</td></tr><tr><td>Agilent DNA 1000 Reagents</td><td>Agilent Technologies (Santa Clara, CA, USA)</td><td>5067-1504</td><td>NGS Library preparation</td></tr><tr><td>Agilent 2100 Bioanalyzer System</td><td>Agilent Technologies (Santa Clara, CA, USA)</td><td>G2938C</td><td>NGS Library preparation</td></tr><tr><td>BC-seq fw:&amp;nbsp;</td><td>IDT (San Joce, CA, CA, USA)</td><td>ATCACTCTCGGCATGGACGAGC&amp;nbsp;</td><td>NGS Library preparation</td></tr><tr><td>BC-seq rv:&amp;nbsp;&amp;nbsp;</td><td>IDT (San Joce, CA, CA, USA)</td><td>GGCTGGCAACTAGAAGGCACA&amp;nbsp;</td><td>NGS Library preparation</td></tr><tr><td>&amp;beta;-Mercaptoethanol</td><td>Millipore Sigma (Burlington, MA, USA)</td><td>44-420-3250ML</td><td>DNA/RNA extraction</td></tr><tr><td>BglI</td><td>New England Biolabs (Ipswich, MA, USA)</td><td>R0143</td><td>Digestion of double-stranded insert</td></tr><tr><td>C1000 Touch Thermal Cycler</td><td>Bio-Rad (Hercules, CA, USA)</td><td>1851196</td><td>dd-PCR cycler</td></tr><tr><td>dNTPS&amp;nbsp;</td><td>New England Biolabs (Ipswich, MA, USA)</td><td>N0447S</td><td>NGS Library preparation</td></tr><tr><td>ddPCR Supermix for probes (no dUTP)</td><td>Bio-Rad (Hercules, CA, USA)</td><td>1863024</td><td>dd-PCR supermix</td></tr><tr><td>Droplet Generation Oil for Probes</td><td>Bio-Rad (Hercules, CA, USA)</td><td>1863005</td><td>dd-PCR droplet generation oil</td></tr><tr><td>DG8 Cartridges for QX100 / QX200 Droplet Generator</td><td>Bio-Rad (Hercules, CA, USA)</td><td>1864008</td><td>dd-PCR droplet generation cartridge</td></tr><tr><td>DG8 Cartridge Holder</td><td>Bio-Rad (Hercules, CA, USA)</td><td>1863051</td><td>dd-PCR cartridge holder</td></tr><tr><td>Droplet Generator DG8 Gasket</td><td>Bio-Rad (Hercules, CA, USA)</td><td>1863009</td><td>dd-PCR cover for cartridge</td></tr><tr><td>ddPCR Plates 96-Well, Semi-Skirted</td><td>Bio-Rad (Hercules, CA, USA)</td><td>12001925</td><td>dd-PCR 96-well plate</td></tr><tr><td>E.cloni 10G SUPREME Electrocompetent Cells</td><td>Lucigen (Middleton, WI, USA)</td><td>60081-1</td><td>Electrocompetent cells</td></tr><tr><td>Electroporation cuvettes, 1mm</td><td>Biozym Scientific (Oldendorf, Germany)</td><td>748050</td><td>Electroporation</td></tr><tr><td>GAPDH primer/probe mix</td><td>Thermo Fischer Scientific (Waltham, MA, USA)</td><td>Mm00186825_cn</td><td>Taqman qPCR primer</td></tr><tr><td>Genepulser Xcell</td><td>Bio-Rad (Hercules, CA, USA)</td><td>1652660</td><td>Electroporation</td></tr><tr><td>High-Capacity cDNA Reverse Transcription Kit</td><td>Applied Biosystems (Waltham, MA, USA)</td><td>4368814</td><td>cDNA reverse transcription</td></tr><tr><td>ITR_fw</td><td>IDT (San Joce, CA, USA)</td><td>GGAACCCCTAGTGATGGAGTT (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)</td><td>dd-PCR primer</td></tr><tr><td>ITR_rv</td><td>IDT (San Joce, CA, USA)</td><td>CGGCCTCAGTGAGCGA (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)</td><td>dd-PCR primer</td></tr><tr><td>ITR_probe</td><td>IDT (San Joce, CA, USA)</td><td>HEX-CACTCCCTCTCTGCGCGCTCG-BHQ1 (https://signagen.com/blog/2019/10/25/qpcr-primer-and-probe-sequences-for-raav-titration/)</td><td>dd-PCR probe</td></tr><tr><td>Illumina NextSeq 500 system</td><td>Illumina Inc (San Diego, CA, USA)</td><td>SY-415-1001</td><td>NGS Library sequencing</td></tr><tr><td>KAPA HiFi HotStart ReadyMix (2X)*</td><td>Roche AG (Basel, Switzerland)</td><td>KK2600 07958919001</td><td>NGS sample prepration</td></tr><tr><td>MagnaBot 96 Magnetic Separation Device</td><td>Promega GmbH (Madison, WI, USA)</td><td>V8151</td><td>Sample prepration for NGS library</td></tr><tr><td>NanoDrop 2000 spectrophotometer</td><td>Thermo Fischer Scientific (Waltham, MA, USA)</td><td>ND-2000</td><td>Digestion of double-stranded insert</td></tr><tr><td>NGS_frw</td><td>Sigma-Aldrich (Burlinght, MA, USA)</td><td>GTT CTG TAT CTA CCA ACC TC</td><td>NGS primer</td></tr><tr><td>NGS_rev</td><td>Sigma-Aldrich (Burlinght, MA, USA)</td><td>CGC CTT GTG TGT TGA CAT C</td><td>NGS primer</td></tr><tr><td>NextSeq 500/550 High Output Kit (75 cycles)</td><td>Illumina Inc (San Diego, CA, USA)</td><td>FC-404-2005</td><td>NGS Library sequencing</td></tr><tr><td>Ovation Library System for Low Complexity Samples Kit&amp;nbsp;</td><td>NuGEN Technologies, Inc. (San Carlos, CA, USA)</td><td>9092-256</td><td>NGS Library preparation</td></tr><tr><td>PX1 Plate Sealer&amp;nbsp;</td><td>Bio-Rad (Hercules, CA, USA)</td><td>1814000</td><td>dd-PCR plate sealer</td></tr><tr><td>Pierceable Foil Heat Seal</td><td>Bio-Rad (Hercules, CA, USA)</td><td>1814040</td><td>dd-PCR sealing foil</td></tr><tr><td>Phusion High-Fidelity DNA-Polymerase</td><td>Thermo Fischer Scientific (Waltham, MA, USA)</td><td>F530S</td><td>Second-strand synthesis of oligonucleotide insert</td></tr><tr><td>PEI MAX - Transfection Grade Linear Polyethylenimine Hydrochloride (MW 40,000)</td><td>Polysciences, Inc. (Warrington, PA, USA)</td><td>24765-1G</td><td>AAV library preparation</td></tr><tr><td>ProNex Size-Selective Purification System</td><td>Promega GmbH (Madison, WI, USA)</td><td>NG2002</td><td>Sample prepration for NGS library</td></tr><tr><td>Phusion Hot Start II Polymerase&amp;nbsp;</td><td>Thermo Fischer Scientific (Waltham, MA, USA)</td><td>F549L</td><td>NGS Library preparation</td></tr><tr><td>Proteinase K</td><td>Roche AG (Basel, Switzerland)</td><td>5963117103</td><td>DNA/RNA extraction</td></tr><tr><td>pRep2Cap2_PIS</td><td></td><td></td><td>ITR-Rep2Cap2-ITR vector. Peptide insertion site within the Cap2 ORF, manufactured/prepared in the lab&amp;nbsp;</td></tr><tr><td>QX200 Droplet Generator</td><td>Bio-Rad (Hercules, CA, USA)</td><td>1864002</td><td>dd-PCR droplet generator</td></tr><tr><td>QX200 Droplet Reader</td><td>Bio-Rad (Hercules, CA, USA)</td><td>1864003</td><td>dd-PCR droplet analysis</td></tr><tr><td>QIAquick Nucleotide Removal Kit</td><td>Qiagen (Venlo, Netherlands)</td><td>28306</td><td>Second-strand synthesis of oligonucleotide insert purification</td></tr><tr><td>QIAquick Gel Extraction Kit</td><td>Qiagen (Venlo, Netherlands)</td><td>28704</td><td>Plasmid vector purification</td></tr><tr><td>QIAGEN Plasmid Maxi Kit</td><td>Qiagen (Venlo, Netherlands)</td><td>12162</td><td>Plasmid library DNA preparation</td></tr><tr><td>Qiaquick PCR Purification kit</td><td>Qiagen (Venlo, Netherlands)</td><td>28104</td><td>Sample prepration for NGS library</td></tr><tr><td>Qubit fluorometer</td><td>Invitrogen (Waltham, MA, USA)</td><td>Q32857</td><td>NGS Library preparation</td></tr><tr><td>Qubit dsDNA HS</td><td>Thermo Fischer Scientific (Waltham, MA, USA)</td><td>Q32851</td><td>NGS Library preparation</td></tr><tr><td>QuantiFast PCR Master Mix</td><td>Qiagen (Venlo, Netherlands)</td><td>1044234</td><td>Taqman qPCR</td></tr><tr><td>rep_fw</td><td>IDT (San Joce, CA, USA)</td><td>AAGTCCTCGGCCCAGATAGAC</td><td>dd-PCR primer</td></tr><tr><td>rep_rv</td><td>IDT (San Joce, CA, USA)</td><td>CAATCACGGCGCACATGT</td><td>dd-PCR primer</td></tr><tr><td>rep_probe</td><td>IDT (San Joce, CA, USA)</td><td>FAM-TGATCGTCACCTCCAACA-BHQ1</td><td>dd-PCR probe</td></tr><tr><td>RNase-free DNase</td><td>Qiagen (Venlo, Netherlands)</td><td>79254</td><td>DNA/RNA extraction</td></tr><tr><td>SfiI</td><td>New England Biolabs (Ipswich, MA, USA)</td><td>R0123</td><td>Digestion of vector</td></tr><tr><td>5 mm, steel Beads</td><td>Qiagen (Venlo, Netherlands)</td><td>69989</td><td>DNA/RNA extraction</td></tr><tr><td>TRIMER-oligonucleotides</td><td>ELLA Biotech (Munich, Germany)</td><td>-</td><td>Degenerate oligonucleotide</td></tr><tr><td>T4 Ligase</td><td>New England Biolabs (Ipswich, MA, USA)</td><td>M0202L</td><td>Plasmid library ligation</td></tr><tr><td>TissueLyserLT</td><td>Qiagen (Venlo, Netherlands)</td><td>85600</td><td>DNA/RNA extraction</td></tr><tr><td>YFP_fw</td><td>IDT (San Joce, CA, USA)</td><td>GAGCGCACCATCTTCTTCAAG</td><td>dd-PCR primer</td></tr><tr><td>YFP_rv</td><td>IDT (San Joce, CA, USA)</td><td>TGTCGCCCTCGAACTTCAC</td><td>dd-PCR primer</td></tr><tr><td>YFP_probe</td><td>IDT (San Joce, CA, USA)</td><td>FAM-ACGACGGCAACTACA-BHQ1</td><td>dd-PCR probe</td></tr><tr><td>Zymo DNA Clean &amp;amp; Concentrator-5 (Capped)</td><td>Zymo research (Irvine, CA, USA)</td><td>D4013</td><td>Vector and Ligation purification</td></tr></tbody></table>

isolation of next-generation gene therapy vectors through engineering, barcoding, and screening of adeno-associated virus (aav) capsid variants

Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by encouraging clinical data and the approval of several AAV gene therapies. Two major reasons for the success of AAV vectors are (i) the prior isolation of various naturally occurring viral serotypes with distinct properties, and (ii) the subsequent establishment of powerful technologies for their molecular engineering and repurposing in high throughput. Further boosting the potential of these techniques are recently implemented strategies for barcoding selected AAV capsids on the DNA and RNA level, permitting their comprehensive and parallel in vivo stratification in all major organs and cell types in a single animal. Here, we present a basic pipeline encompassing this set of complementary avenues, using AAV peptide display to represent the diverse arsenal of available capsid engineering technologies. Accordingly, we first describe the pivotal steps for the generation of an AAV peptide display library for the in vivo selection of candidates with desired properties, followed by a demonstration of how to barcode the most interesting capsid variants for secondary in vivo screening. Next, we exemplify the methodology for the creation of libraries for next-generation sequencing (NGS), including barcode amplification and adaptor ligation, before concluding with an overview of the most critical steps during NGS data analysis. As the protocols reported here are versatile and adaptable, researchers can easily harness them to enrich the optimal AAV capsid variants in their favorite disease model and for gene therapy applications.

Generation of an AAV2 peptide display library. As a first step toward the selection of engineered AAVs, the generation of a plasmid library is described. The peptide insert is produced by using degenerate primers. Reducing the combination of codons in those from 64 to 20 has the advantages of eliminating stop codons and facilitating NGS analysis, by reducing library diversity on the DNA but not the protein level. The oligonucleotide insert is purchased as single-stranded DNA (Figure ...

Watch this Scientific Journal Video about Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants at JoVE.com

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants

AAV peptide display library generation and subsequent validation through the barcoding of candidates with novel properties for the creation of next-generation AAVs.

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus (AAV) Capsid Variants

Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by ...

isolation-next-generation-gene-therapy-vectors-through-engineering

Research

JoVE Journal

Bioengineering

4.4K Views.  University of Heidelberg. Dit protocol dicht een aanzienlijke kloof tussen de natuurlijke evolutie van virussen en hun gebruik als recombinante vectoren voor menselijke gentherapie door hun engineering, diversificatie en stratificatie mogelijk te maken. Deze techniek maakt de high-throughput parallelle screening op nieuwe, geïsoleerde of gemanipuleerde adeno-geassocieerde virussen, kortweg AAV, varianten mogelijk, waardoor wordt bespaard op dieraantallen, werk, kosten en tijd. De geïdentificeerde AVV capsid variante...

Video: Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants

Engineering and Evolution of Synthetic Adeno-Associated Virus (AAV) Gene Therapy Vectors via DNA Family Shuffling

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique combination of beneficial properties1. These include the apathogenicity of the underlying wildtype viruses and the highly advanced methodologies for production of high-titer, high-purity and clinical-grade recombinant vectors2. A further particular advantage of the AAV system over other viruses is the availability of a wealth of naturally occurring serotypes which differ in essential properties yet can all be easily engineered as vectors using a common protocol1,2. Moreover, a number of groups including our own have recently devised strategies to use these natural viruses as templates for the creation of synthetic vectors which either combine the assets of multiple input serotypes, or which enhance the properties of a single isolate. The respective technologies to achieve these goals are either DNA family shuffling3, i.e. fragmentation of various AAV capsid genes followed by their re-assembly based on partial homologies (typically &gt;80% for most AAV serotypes), or peptide display4,5, i.e. insertion of usually seven amino acids into an exposed loop of the viral capsid where the peptide ideally mediates re-targeting to a desired cell type. For maximum success, both methods are applied in a high-throughput fashion whereby the protocols are up-scaled to yield libraries of around one million distinct capsid variants. Each clone is then comprised of a unique combination of numerous parental viruses (DNA shuffling approach) or contains a distinctive peptide within the same viral backbone (peptide display approach). The subsequent final step is iterative selection of such a library on target cells in order to enrich for individual capsids fulfilling most or ideally all requirements of the selection process. The latter preferably combines positive pressure, such as growth on a certain cell type of interest, with negative selection, for instance elimination of all capsids reacting with anti-AAV antibodies. This combination increases chances that synthetic capsids surviving the selection match the needs of the given application in a manner that would probably not have been found in any naturally occurring AAV isolate. Here, we focus on the DNA family shuffling method as the theoretically and experimentally more challenging of the two technologies. We describe and demonstrate all essential steps for the generation and selection of shuffled AAV libraries (Fig. 1), and then discuss the pitfalls and critical aspects of the protocols that one needs to be aware of in order to succeed with molecular AAV evolution.

Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling

We demonstrate the basic technique to molecularly engineer and evolve synthetic Adeno-associated viral (AAV) gene therapy vectors via DNA family shuffling. Moreover, we provide general guidelines and representative examples for selection and analysis of individual chimeric capsids with enhanced properties on target cells in culture or in mice.

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique ...

Immunology and Infection

Transplantation of Induced Pluripotent Stem Cell-derived Mesoangioblast-like Myogenic Progenitors in Mouse Models of Muscle Regeneration

Patient-derived iPSCs could be an invaluable source of cells for future autologous cell therapy protocols. iPSC-derived myogenic stem/progenitor cells similar to pericyte-derived mesoangioblasts (iPSC-derived mesoangioblast-like stem/progenitor cells: IDEMs) can be established from iPSCs generated from patients affected by different forms of muscular dystrophy. Patient-specific IDEMs can be genetically corrected with different strategies (e.g. lentiviral vectors, human artificial chromosomes) and enhanced in their myogenic differentiation potential upon overexpression of the myogenesis regulator MyoD. This myogenic potential is then assessed in vitro with specific differentiation assays and analyzed by immunofluorescence. The regenerative potential of IDEMs is further evaluated in vivo, upon intramuscular and intra-arterial transplantation in two representative mouse models displaying acute and chronic muscle regeneration. The contribution of IDEMs to the host skeletal muscle is then confirmed by different functional tests in transplanted mice. In particular, the amelioration of the motor capacity of the animals is studied with treadmill tests. Cell engraftment and differentiation are then assessed by a number of histological and immunofluorescence assays on transplanted muscles. Overall, this paper describes the assays and tools currently utilized to evaluate the differentiation capacity of IDEMs, focusing on the transplantation methods and subsequent outcome measures to analyze the efficacy of cell transplantation.

Induced pluripotent stem cell (iPSC)-derived myogenic progenitors are promising candidates for cell therapy strategies to treat muscular dystrophies. This protocol describes transplantation and functional measurements required to evaluate the engraftment and differentiation of iPSC-derived mesoangioblasts (a type of muscle progenitors) in mouse models of acute and chronic muscle regeneration.

Patient-derived iPSCs could be an invaluable source of cells for future autologous cell therapy protocols. iPSC-derived myogenic stem/progenitor cells ...

Novel Atomic Force Microscopy Based Biopanning for Isolation of Morphology Specific Reagents against TDP-43 Variants in Amyotrophic Lateral Sclerosis

Because protein variants play critical roles in many diseases including TDP-43 in Amyotrophic Lateral Sclerosis (ALS), alpha-synuclein in Parkinson&#8217;s disease and beta-amyloid and tau in Alzheimer&#8217;s disease, it is critically important to develop morphology specific reagents that can selectively target these disease-specific protein variants to study the role of these variants in disease pathology and for potential diagnostic and therapeutic applications. We have developed novel atomic force microscopy (AFM) based biopanning techniques that enable isolation of reagents that selectively recognize disease-specific protein variants. There are two key phases involved in the process, the negative and positive panning phases. During the negative panning phase, phages that are reactive to off-target antigens are eliminated through multiple rounds of subtractive panning utilizing a series of carefully selected off-target antigens. A key feature in the negative panning phase is utilizing AFM imaging to monitor the process and confirm that all undesired phage particles are removed. For the positive panning phase, the target antigen of interest is fixed on a mica surface and bound phages are eluted and screened to identify phages that selectively bind the target antigen. The target protein variant does not need to be purified providing the appropriate negative panning controls have been used. Even target protein variants that are only present at very low concentrations in complex biological material can be utilized in the positive panning step. Through application of this technology, we acquired antibodies to protein variants of TDP-43 that are selectively found in human ALS brain tissue. We expect that this protocol should be applicable to generating reagents that selectively bind protein variants present in a wide variety of different biological processes and diseases.

Using atomic force microscopy in combination with biopanning technology we created a negative and positive biopanning system to acquire antibodies against disease-specific protein variants present in any biological material, even at low concentrations. We were successful in obtaining antibodies to TDP-43 protein variants involved in Amyotrophic Lateral Sclerosis.

Because protein variants play critical roles in many diseases including TDP-43 in Amyotrophic Lateral Sclerosis (ALS), alpha-synuclein in ...

Isolation of Murine Adipose Tissue-derived Microvascular Fragments as Vascularization Units for Tissue Engineering

A functional microvascular network is of pivotal importance for the survival and integration of engineered tissue constructs. For this purpose, several angiogenic and prevascularization strategies have been established. However, most cell-based approaches include time-consuming in vitro steps for the formation of a microvascular network. Hence, they are not suitable for intraoperative one-step procedures. Adipose tissue-derived microvascular fragments (ad-MVF) represent promising vascularization units. They can be easily isolated from fat tissue and exhibit a functional microvessel morphology. Moreover, they rapidly reassemble into new microvascular networks after in vivo implantation. In addition, ad-MVF have been shown to induce lymphangiogenesis. Finally, they are a rich source of mesenchymal stem cells, which may further contribute to their high vascularization potential. In previous studies we have demonstrated the remarkable vascularization capacity of ad-MVF in engineered bone and skin substitutes. In the present study, we report on a standardized protocol for the enzymatic isolation of ad-MVF from murine fat tissue.

We present a protocol to isolate adipose tissue-derived microvascular fragments that represent promising vascularization units. They can be rapidly isolated, do not require in vitro processing and, thus, may be used for one-step prevascularization in different fields of tissue engineering.

A functional microvascular network is of pivotal importance for the survival and integration of engineered tissue constructs. For this purpose, several ...

Production, Purification, and Quality Control for Adeno-associated Virus-based Vectors

Gene delivery tools based on adeno-associated viruses (AAVs) are a popular choice for the delivery of transgenes to the central nervous system (CNS), including gene therapy applications. AAV vectors are non-replicating, able to infect both dividing and non-dividing cells&#160;and provide long-term transgene expression. Importantly, some serotypes, such as the newly described PHP.B, can cross the blood-brain-barrier (BBB) in animal models, following systemic delivery. AAV vectors can be efficiently produced in the laboratory. However, robust and reproducible protocols are required to obtain AAV vectors with sufficient purity levels and titer values high enough for in vivo applications. This protocol describes an efficient and reproducible strategy for AAV vector production, based on an iodixanol gradient purification strategy. The iodixanol purification method is suitable for obtaining batches of high-titer AAV vectors of high purity, when compared to other purification methods. Furthermore, the protocol is generally faster than other methods currently described. In addition, a quantitative polymerase chain reaction (qPCR)-based strategy is described for a fast and accurate determination of the vector titer, as well as a silver staining method to determine the purity of the vector batch. Finally, representative results of gene delivery to the CNS, following systemic administration of AAV-PHP.B, are presented. Such results should be possible in all labs using the protocols described in this article.

Here, we describe an efficient and reproducible strategy to produce, titer, and quality-control batches of adeno-associated virus vectors. It allows the user to obtain a vector preparation with high-titer&#160;(&#8805;1 x 1013 vector genomes/mL) and a high purity, ready for in vitro or in vivo use.

Gene delivery tools based on adeno-associated viruses (AAVs) are a popular choice for the delivery of transgenes to the central nervous system (CNS), ...

Neuroscience

Production of Adeno-Associated Virus Vectors in Cell Stacks for Preclinical Studies in Large Animal Models

Adeno-associated virus (AAV) vectors are among the most clinically advanced gene therapy vectors, with three AAV gene therapies approved for humans. Clinical advancement of novel applications for AAV involves transitioning from small animal models, such as mice, to larger animal models, including dogs, sheep, and nonhuman primates. One of the limitations of administering AAV to larger animals is the requirement for large quantities of high-titer virus. While suspension cell culture is a scalable method for AAV vector production, few research labs have the equipment (e.g., bioreactors) or know how to produce AAV in this manner. Moreover, AAV titers are often significantly lower when produced in suspension HEK 293 cells as compared to adherent HEK293 cells. Described here is a method for producing large quantities of high-titer AAV using cell stacks. A detailed protocol for titering AAV as well as methods for validating vector purity are also described. Finally, representative results of AAV-mediated transgene expression in a sheep model are presented. This optimized protocol for large-scale production of AAV vectors in adherent cells will enable molecular biology laboratories to advance the testing of their novel AAV therapies in larger animal models.

Here we provide a detailed procedure for large-scale production of research-grade AAV vectors using adherent HEK 293 cells grown in cell stacks and affinity chromatography purification. This protocol consistently yields &#62;1 x 1013 vector genomes/mL, providing vector quantities appropriate for large animal studies.

Adeno-associated virus (AAV) vectors are among the most clinically advanced gene therapy vectors, with three AAV gene therapies approved for humans. ...

Purification of AAV Vectors by Single-Step Heparin Affinity Chromatography

Isolation of Adeno-Associated Viral Vectors Through a Single-Step and Semi-Automated Heparin Affinity Chromatography Protocol

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. However, the commonly used methods to purify AAVs make use of cesium chloride or iodixanol density gradient ultracentrifugation. Despite their advantages, these methods are time-consuming, have limited scalability, and often result in vectors with low purity. To overcome these constraints, researchers are turning their attention to chromatography techniques. Here, we present an optimized heparin-based affinity chromatography protocol that serves as a universal capture step for the purification of AAVs.
This method relies on the intrinsic affinity of AAV serotype 2 (AAV2) for heparan sulfate proteoglycans. Specifically, the protocol entails the co-transfection of plasmids encoding the desired AAV capsid proteins with those of AAV2, yielding mosaic AAV vectors that combine the properties of both parental serotypes. Briefly, after the lysis of producer cells, a mixture containing AAV particles is directly purified following an optimized single-step heparin affinity chromatography protocol using a standard fast protein liquid chromatography (FPLC) system. Purified AAV particles are subsequently concentrated and subjected to comprehensive characterization in terms of purity and biological activity. This protocol offers a simplified and scalable approach that can be performed without the need for ultracentrifugation and gradients, yielding clean and high viral titers.

Author Spotlight: Improved Method for Production and Purification of Adeno-Associated Viral Vectors

This manuscript describes a detailed protocol for the generation and purification of adeno-associated viral vectors using an optimized heparin-based affinity chromatography method. It presents a simple, scalable, and cost-effective approach, eliminating the need for ultracentrifugation. The resulting vectors exhibit high purity and biological activity, proving their value in preclinical studies.

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. ...

Efficient Adeno-Associated Virus Vector Production Using a Cell Factory Platform

A Streamlined and Standardized Procedure for Generating High-Titer, High-Quality Adeno-Associated Virus Vectors Utilizing a Cell Factory Platform

Preclinical gene therapy research, particularly in rodent and large animal models, necessitates the production of AAV vectors with high yield and purity. Traditional approaches in research laboratories often involve extensive use of cell culture dishes to cultivate HEK293T cells, a process that can be both laborious and problematic. Here, a unique in-house method is presented, which simplifies this process with a specific cell factory (or cell stacks, CF10) platform. An integration of polyethylene glycol/aqueous two-phase partitioning with iodixanol gradient ultracentrifugation improves both the yield and purity of the generated AAV vectors. The purity of the AAV vectors is verified through SDS-PAGE and silver staining, while the ratio of full to empty particles is determined using transmission electron microscopy (TEM). This approach offers an efficient cell factory platform for the production of AAV vectors at high yields, coupled with an improved purification method to meet the quality demands for in vivo studies.

Author Spotlight: Advancing Gene Therapy Research with High-Titer Adeno-Associated Virus Vector Production

As the field of gene therapy continues to evolve, there is a growing need for innovative methods that can address these challenges. Here, a unique method is presented, which streamlines the process of generating high-yield and high-purity AAV vectors using a cell factory platform, meeting the quality standards for in vivo studies.

Preclinical gene therapy research, particularly in rodent and large animal models, necessitates the production of AAV vectors with high yield and purity. ...

Standardized Protocol for Viral Genome Quantification Using Digital Droplet PCR

Quantification of Adeno-Associated Viral Genomes in Purified Vector Samples by Digital Droplet Polymerase Chain Reaction

Adeno-associated virus (AAV) is a non-pathogenic virus used as a delivery vehicle to transfer therapeutic genes into patients. Accurate quantification of AAV genome copy number in vector preparations is essential for bioprocess optimization and dosage calculation in both preclinical and clinical studies of AAV-based gene therapy products. Currently, a consensus protocol for AAV viral genome titration is lacking. Here, we present a digital droplet PCR (dd_PCR) protocol for the quantification of viral genomes in purified vector samples. Samples are treated with DNase I to eliminate unpackaged contaminant DNA. DNase-treated samples are then mixed with an appropriate primer-probe set (designed according to the target AAV genome) and PCR reagents, and then loaded into a droplet generator. The prepared droplets are transferred into a PCR plate, where PCR amplification is performed and analyzed. The viral genome titer is calculated based on the concentration (copies/&#181;L), accounting for sample dilutions. A successful measurement shows a clear separation of the positive and negative droplet clouds, has at least 10,000 accepted droplets, shows a value between 10 copies/&#181;L and 10,000 copies/&#181;L, and has a coefficient of variation (CV) between repeats lower than 20%. Reliable viral genome titration will aid in the development of safe and effective AAV-based gene therapy products.

Author Spotlight: Optimizing Digital Droplet PCR Method for Accurate Adeno-Associated Viral Genome Quantification

Precise quantification of adeno-associated virus (AAV) vector genome copies is critical, but a standardized protocol has yet to be established. This protocol describes a validated method for preparing purified AAV samples and conducting digital droplet polymerase chain reaction (dd_PCR) to reliably quantify the viral genome titer.

Adeno-associated virus (AAV) is a non-pathogenic virus used as a delivery vehicle to transfer therapeutic genes into patients. Accurate quantification of ...

AAV Isolation by Double Iodixanol Density Gradient Centrifugation

Suspension Culture Production and Purification of Adeno-Associated Virus by Iodixanol Density Gradient Centrifugation for In Vivo Applications

This protocol describes recombinant adeno-associated virus (rAAV) production and purification by iodixanol density gradient centrifugation, a serotype-agnostic method of purifying AAV first described in 1999. rAAV vectors are widely used in gene therapy applications to deliver transgenes to various human cell types. In this work, the recombinant virus is produced by transfection of Expi293 cells in suspension culture with plasmids encoding the transgene, vector capsid, and adenoviral helper genes. Iodixanol density gradient centrifugation purifies full AAV particles based on particle density. Additionally, three steps are included in this now-ubiquitous methodology in order to increase total virus yield, decrease the risk of precipitation due to contaminating proteins, and further concentrate the final virus product, respectively: precipitation of viral particles from cell media using a solution of polyethylene glycol (PEG) and sodium chloride, the introduction of a second round of iodixanol density gradient centrifugation, and buffer exchange via a centrifugal filter. Using this method, it is possible to consistently achieve titers in the range of 1012 viral particles/mL of exceptional purity for in vivo use.

Author Spotlight: Efficient Adeno-Associated Virus Isolation for Pre-Clinical Applications

Adeno-associated virus is produced in suspension cell culture and purified by double iodixanol density gradient centrifugation. Steps are included to increase total virus yield, decrease the risk of virus precipitation, and further concentrate the final virus product. Expected final titers reach 1012 viral particles/mL and are suitable for pre-clinical in vivo use.

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus (AAV) Capsid Variants

Samenvatting

Meer video's verkennen