This work was supported by National Natural Science Foundation of China (32272530), the New Twenty Policies for University in Jinan Project (2021GXRC040), Major Scientific and Technological Innovation Projects in Shandong Province (2021TZXD002), and the Science and Education Integration Project of Qilu University of Technology (2022PYI009, 2022PY016, 2022PT105).

D. antiqua are obtained from the field of Fanzhen, Taian.
1. Preparation of sterile diets
<ol>
	<li>Peel off the outer layers of the scallions and discard the green leaves. Keep the white part of the scallions (Figure 1A) and wash them with sterile water, repeating the rinsing process three times. Cut the white part of the scallions into 1-2 cm diced pieces using scissors (see Table of Materials) sterilized with 75 % EtOH solution (mentioned in step 2.5) for later use.</li>
	<li>Weigh 50 g of the diced scallions and place them into a food processor (see Table of Materials). Add 50 mL of sterilized water and grind them in five times for 2 min each. All of the diced scallions should be grounded into a paste-like consistency (Figure 2A).</li>
	<li>Use tweezers to transfer 10 pieces 3rd instar larvae of D. antiqua into a 10 mL centrifuge tube containing 10 mL of 1x PBS, and grind them with a disposable grinding pestle (see Table of Materials) for about 5 min to obtain a larval grinding liquid.</li>
	<li>Pour the pasty scallion liquid and larval grinding liquid into a clean 500 mL conical flask (see Table of Materials). Wrap the conical flask mouth with two layers of transparent sealing film, and then place the flask in a shaking incubator (see Table of Materials) for fermentation at 25 &#176;C and 180 rpm for 12 h (Figure 2B).</li>
	<li>Cut out seven layers of square gauze with 10 cm sides (no need for sterility) with scissors and stack them together to form a simple filter device. Slowly pour the fermented scallion liquid onto the gauze and squeeze out the filtered liquid into a new 500 mL conical flask. Wrap the remaining scallion residue on the gauze in tin foil for later use.</li>
	<li>Filter the filtrate obtained in the previous step using a vacuum pump (see Table of Materials) and a Buchner funnel. Put the filter paper wetted by deionized water on the Buchner funnel, and then pour the filtrate and perform suction filtration for three times with different filter paper. Collect the final filtrate in the 500 mL conical flask.</li>
	<li>Perform another filtration using a 0.22 &#181;M filter bottle and a vacuum pump. Screw the cover of the suction filter flask in an ultra-clean bench (see Table of Materials) for further use. At this point, the fermented scallion residue and filtrate are obtained (Figure 2C). 
	NOTE: The filtered liquid obtained from this step will be sterile. (0.22 &#181;M filter bottle is a sterile vacuum filtration system for sterilizing the filtrate).</li>
	<li>Repeat the previous steps to obtain unfermented scallion residue and filtrate. Here the difference is that the fermentation is not needed.</li>
	<li>Weigh 0.24 g choline chloride and 0.56 g L-ascorbic acid (see Table of Materials) in a 10 mL centrifuge tube. Add 3 mL of deionized water and shake vigorously until they are completely dissolved. In the ultra-clean bench, use a new 5 mL syringe and attach three 0.22 &#181;M syringe filters (see Table of Materials) to sterilize the solution, and place it in a sterile 10 mL centrifuge tube for later use. 
	NOTE: Choline chloride is an essential neurotransmitter for the growth of insects, while L-ascorbic acid acts as a preservative.</li>
	<li>Weigh 2 g agar powder and 6 g TSB (see Table of Materials) and pour them into a 500 mL conical flask. Then add 100 mL of deionized water to prepare the culture medium. After rinsing the glass rod with deionized water, use it to stir the mixture until it is well mixed. Then, seal the conical flask using two layers of transparent sealing film.</li>
	<li>Wrap the fermented scallions and unfermented scallions (mentioned in step 1.5 and step 1.8) in aluminum foil and sterilize them, along with the culture medium, in an autoclave at 121 &#176;C for 20 min.</li>
	<li>In the ultra-clean bench, pour the sterilized choline chloride, L-ascorbic acid, and sterile filtrate into the culture medium while gently swirling to mix them thoroughly. Finally, add the fermented and unfermented scallions and shake vigorously by hand to obtain the sterile diets. Pour the diets into the 50 mL centrifuge tubes (sterile; vent cap with a 0.22 &#181;M PVDF hydrophobic membrane) (see Table of Materials) at an angle (Figure 2D). 
	&#8203;NOTE: After sterilization, the temperature of the culture medium should be maintained between 65-80 &#176;C to prevent rapid cooling and solidification when adding scallions or other ingredients. Besides, in each tube, pour approximately 10-15 mL of diets. Once the diets have solidified, store the tubes in a refrigerator at 4 &#176;C, if it is not be used immediately.</li>
</ol>
2. Acquisition of axenic eggs
<ol>
	<li>Laboratory rearing system for D. antiqua
	<ol>
		<li>Place a rearing cage in a 25 &#176;C internally LED illuminated incubator (24 h a cycle, the ratio of light to dark is 16:8) to rear male and female adults, allowing them to mate and lay eggs. Fill the water dispenser (Figure 1B) with water and seal it with moistened cotton wool to provide water for the adults.</li>
		<li>Place four 35 mm x 12 mm Petri dish bottoms in a 94 mm x 16 mm Petri dish lid. Wet cotton wool with ionized water and then place moist cotton wool at two of the Petri dish bottoms, and on top of the cotton wool, add one tablespoon of sucrose.</li>
		<li>Fill the other two Petri dish bottoms with two tablespoons of sucrose and yeast extract (see Table of Materials), which serve as food for the adult insects (Figure 1C). 
		NOTE: The sucrose and yeast extract mentioned in step 2.1.2 and step 2.1.3 do not need to be sterilized.</li>
		<li>Put a 94 mm x 16 mm Petri dish bottom containing moistened sand and a piece of unrooted, peeled garlic clove (Figure 1D) inside the fly cage to collect eggs. The female will be attracted by the smell of the garlic and lay eggs around it.</li>
	</ol>
	</li>
	<li>Collection of eggs
	<ol>
		<li>Take out the oviposition device, which is a 94 mm x 16 mm Petri dish containing sand and garlic mentioned above (step 2.14), from the cage. Pour the sand together with the garlic into a 500 mL beaker, and use tap water to flush the remaining eggs from the garlic into the beaker. At this point, the eggs are floating in the water.</li>
		<li>Take a 100-mesh sieve (see Table of Materials), and moisten it with tap water. Then pour the water containing the floating eggs from the beaker onto the sieve. The eggs will remain on the sieve.</li>
		<li>After the eggs naturally dry on the sieve, use a brush to gently sweep the eggs onto a Petri dish.</li>
	</ol>
	</li>
	<li>On the first day, flush the oviposition device to collect the eggs without disinfection or sterilization. On the second day at four o&#39;clock in the afternoon, flush the eggs again and collect them by sieving them with clean water. 
	NOTE: Collecting the eggs on the second day is to ensure consistent growth rate in the subsequent stages. Four o&#39;clock in the afternoon is the egg-laying peak for D. antiqua. Thus, it is ideal to collect the eggs at this time.</li>
	<li>Place the collected eggs onto a sterile cell sieve (see Table of Materials) in the ultra-clean bench (Figure 3A).</li>
	<li>Prepare the solution for egg sterilization
	<ol>
		<li>Take 5 mL of 5.2% NaClO (see Table of Materials) and transfer it into a sterilized 250 mL conical flask. Add 95 mL of sterilized water to make a total volume of 100 mL, resulting in a 0.26 % NaClO solution.</li>
		<li>To prepare a 75% EtOH solution, take 75 mL of 99.7 % EtOH and transfer it into a sterilized 250 mL conical flask. Add 25 mL of sterilized water to make a total volume of 100 mL, resulting in a 75% EtOH solution.</li>
	</ol>
	</li>
	<li>Pour 30 mL NaClO into a Petri dish and pour 30 mL EtOH into another Petri dish. Place the cell sieve containing eggs mentioned in step 2.4 into the dish containing NaClO. Soak it in the 0.26% NaClO solution for 0.5 min. Then transfer the sieve to the dish containing EtOH, allowing it to soak in the 75% EtOH solution for another 0.5 min.</li>
	<li>Repeat this process three times, alternating between 0.26% NaClO and 75% EtOH every 0.5 min. After that, axenic eggs will be obtained. At this point, the sieve containing the eggs should be submerged in EtOH. 
	NOTE: To ensure thorough sterilization, use a 1 mL pipette to aspirate NaClO and EtOH and disperse the eggs. Repeat the rinsing process multiple times. This step will further clean the surface of the eggs from residual bacteria and impurities, ensuring a clean and sterile surface.</li>
</ol>
3. Rearing of axenic larvae
<ol>
	<li>To transfer the sterilized eggs, use a pair of scissors that have been sterilized with an alcohol lamp to cut the end tip of a 1 mL pipette (Figure 3B). Ensure that the end opening of the cut pipette is larger than the diameter of the eggs (about 2 mm). Then, use the pipette to transfer the eggs from the EtOH solution (eggs together with the solution) (Figure 3C) to a centrifuge tube containing the sterile diets, and each tube should contain approximately 20-50 eggs (Figure 3D). Repeat this process until all the eggs have been transferred. 
	NOTE: The diameter of the pipette tip should be as large as possible to avoid breaking the eggs during transfer, which could lead to their death.</li>
	<li>Use a pipette to remove any excess ethanol from the tube. Place the centrifuge tube closed with lids inside a self-sealing bag, and place a piece of cotton at the opening of the bag to allow for air circulation. Finally, place the bag inside a 25 &#176;C incubator (relative humidity: 50%-70%; photoperiod: 16 h light: 8 h dark) for observation and cultivation.</li>
	<li>Approximately three days later, the axenic eggs in the diets start to hatch (Figure 4A). The hatched larvae will be active and the surface of the sterile diets will no longer be smooth. The larvae will start feeding on the diets.</li>
	<li>Continue to observe the larvae until they reach the stage of 2nd instar larvae. Keep monitoring their growth and development during this period.</li>
	<li>After 9-12 days, more than 80% of the eggs have developed into 3rd instar larvae (Figure 4B). This indicates successful growth and development of the larvae.</li>
</ol>
4. Validation of axenic larvae with culture-dependent assays
<ol>
	<li>Randomly select three axenic 3rd instar larvae from the centrifuge tube.</li>
	<li>Place the larvae in a 94 mm x 16 mm Petri dish containing 75% alcohol for cleaning. After that, transfer them to a container with sterile water for further rinsing.</li>
	<li>Use a disinfected dissecting forceps that has been sterilized with 75% EtOH solution to grasp the larvae (the head and tail are shown in Figure 5A). Use dissecting scissors to remove the head and tail ends (Figure 5B). Hold the tail of the larvae with the forceps and use another forceps to gently squeeze from the tail to the head and extract the internal organs (the result shown in Figure 5C). Place the internal organs in deionized water and gently pull off the intestine by pressing on the adipose tissue with forceps, and place the extracted internal (Figure 5D) in sterile water for further use.</li>
	<li>Place the intestine into a sterile 1.5 mL centrifuge tube, add 500 &#181;L of sterilized 1x PBS buffer, and use a disposable pestle to grind the intestinal tissue into a homogenate.</li>
	<li>Take 100 &#181;L of the homogenate and add it to a nutrient agar medium. Use an L-shaped spreader (see Table of Materials) for streaking the agar plate.</li>
	<li>Place the Petri dish in a biochemical incubator at 28 &#176;C and incubate for 72 h to observe the growth of colonies.</li>
</ol>
5. Validation of axenic larvae with culture-independent assays
<ol>
	<li>Extract total DNA from the gut tissue of axenic larvae using a DNA extraction kit (see Table of Materials) following manufacturer&#39;s instructions.</li>
	<li>Measure the DNA concentration using a UV spectrophotometer.</li>
	<li>Perform PCR reaction using universal bacterial 16S rRNA primers (1492R: 5&#39;- GGTTACCTTGTTACGACTT -3&#39;, 27F: 5&#39;- AGAGTTTGATCATGGCTCAG -3&#39;). The total reaction volume is 25 &#181;L, and it consists of 1 &#181;L DNA template, 0.5 &#181;L forward primer, 0.5 &#181;L reverse primer, 10.5 &#181;L ddH2O, and 12.5 &#181;L 2x Taq PCR Master Mix (see Table of Materials). Set the PCR reaction conditions as follows: initial denaturation at 94 &#176;C for 3 min; 35 cycles of denaturation at 94 &#176;C for 30 s, annealing at 55 &#176;C for 30 s, and extension at 72 &#176;C for 90 s; final extension at 72 &#176;C for 10 min. Store the PCR products at 4 &#176;C for further analysis.</li>
	<li>Perform PCR reaction using universal fungal ITS primers (ITS1: 5&#39;- TCCGTAGGTGAACCTGCGG -3&#39;, ITS4: 5&#39;- TCCTCCGCTTATTGATATGC -3&#39;). The total reaction volume is 25 &#181;L, and it consists of 1 &#181;L DNA template, 0.5 &#181;L forward primer, 0.5 &#181;L reverse primer, 10.5 &#181;L ddH2O, and 12.5 &#181;L 2x Taq PCR Master Mix. Set the PCR conditions at 95 &#176;C for 5 min; 35 cycles of 95 &#176;C for 30 s, 55 &#176;C for 1 min, and 72 &#176;C for 90 s; followed by 72 &#176;C for 10 min. Store the PCR products at 4 &#176;C for further analysis.</li>
	<li>Use Super Green nucleic acid dye (see Table of Materials) to mix with each of the two types of PCR products evenly, and analyze them by electrophoresis on a 1% agarose gel in 1x TAE buffer (diluted from 50x TAE, see&#160;Table of Materials). Use 3 &#181;L of DNA marker (see Table of Materials) as a reference.</li>
	<li>Use a UV transilluminator to observe the gel and locate the target fragment.</li>
</ol>

Studying Development of Axenic Delia antiqua and Ensuring Bacteria-Free Growth

<ol>
	<li>Al-Asmakh, M., Zadjali, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+germ-free+animal+models+in+microbiota-related+research.">Use of germ-free animal models in microbiota-related research.</a> Journal of Microbiology and Biotechnology. 25 (10), 1583-1588 (2015).</li><li>Bhattarai, Y., Kashyap, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ-free+mice+model+for+studying+host-microbial+interactions.">Germ-free mice model for studying host-microbial interactions.</a> Methods in Molecular Biology. 1438, 123-135 (2016).</li><li>Douglas, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiorganismal+insects:+diversity+and+function+of+resident+microorganisms.">Multiorganismal insects: diversity and function of resident microorganisms.</a> Annual Review of Entomology. 60 (1), 17-34 (2015).</li><li>Wang, G. -. H., Brucker, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+method+for+Nasonia+germ-free+rearing.">An optimized method for Nasonia germ-free rearing.</a> Scientific Reports. 12 (1), 219 (2022).</li><li>Nishide, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aseptic+rearing+procedure+for+the+stinkbug+Plautia+stali+(Hemiptera:+Pentatomidae)+by+sterilizing+food-derived+bacterial+contaminants.">Aseptic rearing procedure for the stinkbug Plautia stali (Hemiptera: Pentatomidae) by sterilizing food-derived bacterial contaminants.</a> Applied Entomology and Zoology. 52 (3), 407-415 (2017).</li><li>Ma, M., Liu, P., Yu, J., Han, R., Xu, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparing+and+rearing+axenic+insects+with+tissue+cultured+seedlings+for+host-gut+microbiota+interaction+studies+of+the+leaf+beetle.">Preparing and rearing axenic insects with tissue cultured seedlings for host-gut microbiota interaction studies of the leaf beetle.</a> Journal of Visualized Experiments. 176, e63195 (2021).</li><li>Zhu, Z., Wang, D., Liu, Y., Tang, T., Wang, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+the+rearing+procedure+of+germ-free+wasps.">Optimizing the rearing procedure of germ-free wasps.</a> Journal of Visualized Experiments. 197, e65292 (2023).</li><li>Somerville, J., Zhou, L. Q., Raymond, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aseptic+rearing+and+infection+with+gut+bacteria+improve+the+fitness+of+transgenic+diamondback+moth,+Plutella+xylostella.">Aseptic rearing and infection with gut bacteria improve the fitness of transgenic diamondback moth, Plutella xylostella.</a> Insects. 10 (4), 89 (2019).</li><li>Shuoying, N., Jiufeng, W., Jinian, F., Hugo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+the+current+potential+and+future+world+wide+distribution+of+the+onion+maggot,+Delia+antiqua+using+maximum+entropy+ecological+niche+modeling.">Predicting the current potential and future world wide distribution of the onion maggot, Delia antiqua using maximum entropy ecological niche modeling.</a> PLoS ONE. 12 (2), e0171190 (2017).</li><li>Ellis, P. R., Eckenrode, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Factors+influencing+resistance+in+Allium+sp.+to+onion+maggot.">Factors influencing resistance in Allium sp. to onion maggot.</a> Bulletin of the Entomological Society of America. 25 (2), 151-154 (1979).</li><li>Nault, B. A., Straub, R. W., Taylor, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+novel+insecticide+seed+treatments+for+managing+onion+maggot+(Diptera+:+Anthomyiidae)+in+onion+fields.">Performance of novel insecticide seed treatments for managing onion maggot (Diptera : Anthomyiidae) in onion fields.</a> Crop Protection. 25 (1), 58-65 (2006).</li><li>Leach, A., Reiners, S., Fuchs, M., Nault, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluating+integrated+pest+management+tactics+for+onion+thrips+and+pathogens+they+transmit+to+onion.">Evaluating integrated pest management tactics for onion thrips and pathogens they transmit to onion.</a> Agriculture Ecosystems &amp; Environment. 250, 89-101 (2017).</li><li>Zhou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+Inhibition+on+Beauveria+bassiana+Contributes+to+Microbiota+Stability+in+Delia+antiqua.">Bacterial Inhibition on Beauveria bassiana Contributes to Microbiota Stability in Delia antiqua.</a> Frontiers in Microbiology. 12, 710800 (2021).</li><li>Zhou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Symbiotic+bacterium-derived+organic+acids+protect+delia+antiqua+larvae+from+entomopathogenic+fungal+infection.">Symbiotic bacterium-derived organic acids protect delia antiqua larvae from entomopathogenic fungal infection.</a> mSystems. 5 (6), 00778-00820 (2020).</li><li>Jing, T. Z., Qi, F. H., Wang, Z. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Most+dominant+roles+of+insect+gut+bacteria:+digestion,+detoxification,+or+essential+nutrient+provision.">Most dominant roles of insect gut bacteria: digestion, detoxification, or essential nutrient provision.</a> Microbiome. 8 (1), 38 (2020).</li><li>Kietz, C., Pollari, V., Meinander, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generating+germ-free+drosophila+to+study+gut-microbe+interactions:+protocol+to+rear+Drosophila+under+axenic+conditions.">Generating germ-free drosophila to study gut-microbe interactions: protocol to rear Drosophila under axenic conditions.</a> Current Protocols in Toxicology. 77 (1), e52 (2018).</li><li>Schretter, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+gut+microbial+factor+modulates+locomotor+behaviour+in+Drosophila.">A gut microbial factor modulates locomotor behaviour in Drosophila.</a> Nature. 563 (7731), 402 (2018).</li><li>Brummel, T., Ching, A., Seroude, L., Simon, A. F., Benzer, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+lifespan+enhancement+by+exogenous+bacteria.">Drosophila lifespan enhancement by exogenous bacteria.</a> Proceedings of the National Academy of Sciences of the United States of America. 101 (35), 12974-12979 (2004).</li><li>Romoli, O., Schonbeck, J. C., Hapfelmeier, S., Gendrin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+germ-free+mosquitoes+via+transient+colonisation+allows+stage-specific+investigation+of+host-microbiota+interactions.">Production of germ-free mosquitoes via transient colonisation allows stage-specific investigation of host-microbiota interactions.</a> Nature Communications. 12 (1), 942 (2021).</li><li>Ma, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+and+immunological+effects+of+gut+microbiota+in+leaf+beetles+at+the+local+and+systemic+levels.">Metabolic and immunological effects of gut microbiota in leaf beetles at the local and systemic levels.</a> Integrative Zoology. 16 (3), 313-323 (2021).</li><li>Zhang, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differences+between+microbial+communities+of+pinus+species+having+differing+level+of+resistance+to+the+pine+wood+nematode.">Differences between microbial communities of pinus species having differing level of resistance to the pine wood nematode.</a> Microbial Ecology. 84 (4), 1245-1255 (2022).</li><li>Jung, S., Kim, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synergistic+effect+of+Xenorhabdus+nematophila+K1+and+Bacillus+thuringiensis+subsp+aizawai+against+Spodoptera+exigua+(Lepidoptera+:+Noctuidae).">Synergistic effect of Xenorhabdus nematophila K1 and Bacillus thuringiensis subsp aizawai against Spodoptera exigua (Lepidoptera : Noctuidae).</a> Biological Control. 39 (2), 201-209 (2006).</li><li>Raymond, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mid-gut+microbiota+is+not+required+for+the+pathogenicity+of+Bacillus+thuringiensis+to+diamondback+moth+larvae.">A mid-gut microbiota is not required for the pathogenicity of Bacillus thuringiensis to diamondback moth larvae.</a> Environmental Microbiology. 11 (10), 2556-2563 (2009).</li><li>Weersma, R. K., Zhernakova, A., Fu, J. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+between+drugs+and+the+gut+microbiome.">Interaction between drugs and the gut microbiome.</a> Gut. 69 (8), 1510-1519 (2020).</li><li>Llop, P., Latorre, A., Moya, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+epidemiology+of+antibiotic+resistance:+looking+for+an+appropriate+animal+model+system.">Experimental epidemiology of antibiotic resistance: looking for an appropriate animal model system.</a> Microbiology Spectrum. 6 (1), (2018).</li><li>Doll, J. P., Trexler, P. C., Reynolds, L. I., Bernard, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+peracetic+acid+to+obtain+germfree+invertebrate+eggs+for+gnotobiotic+studies.">The use of peracetic acid to obtain germfree invertebrate eggs for gnotobiotic studies.</a> American Midland Naturalist. 6 (1), 239 (1963).</li><li>Dillon, R., Charnley, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutualism+between+the+desert+locust+Schistocerca+gregaria+and+its+gut+microbiota.">Mutualism between the desert locust Schistocerca gregaria and its gut microbiota.</a> Research in Microbiology. 153 (8), 503-509 (2002).</li><li>Tegtmeier, D., Thompson, C. L., Schauer, C., Brune, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxygen+affects+gut+bacterial+colonization+and+metabolic+activities+in+a+gnotobiotic+cockroach+model.">Oxygen affects gut bacterial colonization and metabolic activities in a gnotobiotic cockroach model.</a> Applied and Environmental Microbiology. 82 (4), 1080-1089 (2016).</li><li>Muhammad, A., Habineza, P., Hou, Y. M., Shi, Z. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+red+palm+weevil+Rhynchophorus+Ferrugineus+(Olivier)+(Coleoptera:+Dryophthoridae)+germ-free+larvae+for+host-gut+microbes+interaction+studies.">Preparation of red palm weevil Rhynchophorus Ferrugineus (Olivier) (Coleoptera: Dryophthoridae) germ-free larvae for host-gut microbes interaction studies.</a> Bio-Protocol. 9 (24), e3456 (2019).</li><li>Bavani, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sterilization+of+Lucilia+sericata+(Diptera:+Calliphoridae)+Eggs+for+maggot+debridement+therapy.">Sterilization of Lucilia sericata (Diptera: Calliphoridae) Eggs for maggot debridement therapy.</a> Journal of Medical Entomology. 59 (3), 1076-1080 (2022).</li><li>Han, L. Z., Li, S. B., Liu, P. L., Peng, Y. F., Hou, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+artificial+diet+for+continuous+rearing+of+Chilo+suppressalis+(Lepidoptera:+Crambidae).">New artificial diet for continuous rearing of Chilo suppressalis (Lepidoptera: Crambidae).</a> Annals of the Entomological Society of America. 105 (2), 253-258 (2012).</li><li>Bezerra, C. E. S., Amaral, B. B., Souza, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rearing+Chrysoperla+externa+larvae+on+artificial+diets.">Rearing Chrysoperla externa larvae on artificial diets.</a> Neotropical Entomology. 46 (1), 93-99 (2017).</li><li>Feng, H. Q., Jin, Y. L., Li, G. P., Feng, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+an+artificial+diet+for+successive+rearing+of+Apolygus+lucorum+(Hemiptera:+Miridae).">Establishment of an artificial diet for successive rearing of Apolygus lucorum (Hemiptera: Miridae).</a> Journal of Economic Entomology. 105 (6), 1921-1928 (2012).</li><li>Hassan, B., Siddiqui, J. A., Xu, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vertically+transmitted+gut+bacteria+and+nutrition+influence+the+immunity+and+fitness+of+Bactrocera+dorsalis+larvae.">Vertically transmitted gut bacteria and nutrition influence the immunity and fitness of Bactrocera dorsalis larvae.</a> Frontiers in Microbiology. 11, 596352 (2020).</li><li>Li, X. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+the+intestinal+bacterial+community+in+black+soldier+fly+larval+guts+and+its+influence+on+insect+growth+and+development.">Dynamics of the intestinal bacterial community in black soldier fly larval guts and its influence on insect growth and development.</a> Insect Science. 30 (4), 947-963 (2023).</li><li>Moran, N. A., McCutcheon, J. P., Nakabachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomics+and+Evolution+of+heritable+bacterial+symbionts.">Genomics and Evolution of heritable bacterial symbionts.</a> Annual Review of Genetics. 42, 165-190 (2008).</li><li>Weinert, L. A., Araujo-Jnr, E. V., Ahmed, M. Z., Welch, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+incidence+of+bacterial+endosymbionts+in+terrestrial+arthropods.">The incidence of bacterial endosymbionts in terrestrial arthropods.</a> Proceedings of the Royal Society B-Biological Sciences. 282 (1807), 20150249 (2015).</li><li>Weeks, A. R., Turelli, M., Harcombe, W. R., Reynolds, K. T., Hoffmann, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+parasite+to+mutualist:+Rapid+evolution+of+Wolbachia+in+natural+populations+of+Drosophila.">From parasite to mutualist: Rapid evolution of Wolbachia in natural populations of Drosophila.</a> PLOS Biology. 5 (5), 997-1005 (2007).</li></ol>

The authors have no conflicts of interest to disclose.

Insects possess a highly complex gut microbiota20,21, necessitating the use of axenic insects inoculated with specific gut microbial strains for studying insect-microorganism interactions. The preparation of axenic insects is crucial for such research endeavors. Antibiotic treatment is a method used to eliminate gut microbiota. For example, Jung and Kim22 fed Spodoptera exigua with penicillin, while Raymond23</su...

Axenic animals, defined as animals in which no viable microorganisms or parasites can be detected, are valuable experimental models for studying host-microorganism interactions1,2. Insects, the largest group of invertebrates, can form symbiotic relationships with microorganisms3. Axenic insects can be used to study host-symbiont interactions in symbiotic systems4. For example, Nishide et al.5 established a practical sterile rearing procedure for the malodor worm Plautia stali, enabling reliable and rigorous analysis of host-symbiont interactions in model symbiotic systems. Axenic insects can be produced by sterilizing the egg stage and providing sterile food to the larvae and adults6,7. Axenic insects are of great significance and are widely used in biological research. For instance, a study conducted by Somerville et al.8 demonstrated that diamondback moths inoculated with Enterobacter cloacae improved the adaptability of transgenic males.
Delia antiqua Meigen is an economically important pest of onions and other Liliaceae crops worldwide, with its larvae damaging the bulbs of onions and other Liliaceae crops9. D. antiqua is mainly found in temperate climates and is widespread in onion-cultivation areas of the Americas, Europe, and Asia. If not properly controlled, it can cause crop losses in onions (Allium cepa L.), garlic (Allium sativum L.), shallots (Allium fistulosum L.), and leeks (Alliumchoenoprasum L.) ranging from 50% to 100%10,11. The larvae feed on the below-ground parts of plants, and this feeding causes the seedlings to wilt and eventually die. In addition, damaged plants can allow pathogens to enter, leading to bulb rotting12. Even if the plants are not completely consumed by the larvae, the damage they cause renders the onion plants unmarketable and results in economic losses.
Insects are closely associated with gut microbiota, and most insect guts contain a variety of symbiotic bacteria that thrive on the nutrients provided by the host13,14. Jing et al.15 showed that the primary function of the intestinal symbiotic community is to provide essential nutrients, followed by functions related to digestion and detoxification. In certain cases, gut bacteria can serve as a microbial resource for pest management purposes. Consequently, studying the individual gut bacteria&#39;s performances and specific functions within the body of D. antiqua is desirable. Therefore, preparing axenic larvae is particularly important for studying the interactions between specific bacterial strains and insects16. Currently, a commonly used method to eliminate insect gut bacteria is the use of an antibiotic combination to eradicate associated microbes17,18,19. Unlike using antibiotics alone, which can only reduce microbial numbers, axenic rearing of insects allows for control over the composition and quantity of microorganisms, enabling more accurate validation of gut microbiota functionality.
Thus, this article introduces a protocol for preparing and rearing axenic D. antiqua. Axenic larval food is obtained by utilizing high-temperature sterilization of natural diets combined with half-fermented foods. The eggs are sterilized following an experimental protocol to obtain axenic eggs, and finally, axenic larvae are cultured from the axenic eggs. The axenic rearing system was carried out for only one generation for the experiment. This will provide convenience for studying the interaction between insects and gut microbiota.

<table><tbody><tr><td>0.22 &amp;mu;M filter bottle</td><td>Thermo Scientific</td><td>450-0045</td><td></td></tr><tr><td>0.22 &amp;mu;M Syringe Filter</td><td>Biosharp</td><td>BS-QT-011</td><td></td></tr><tr><td>100-mesh sieve</td><td>Zhejiang Shangyu Jinding Standard Sieve Factory</td><td>No Catalog numbers</td><td></td></tr><tr><td>1x PBS solution</td><td>Solarbio</td><td>P1020</td><td></td></tr><tr><td>2x Taq PCR Master Mix</td><td>GENVIEW</td><td>GR1113-1ML</td><td></td></tr><tr><td>5.2% NaClO solution</td><td>Sinopharm Chemical Reagent Co., Ltd.</td><td>80010428</td><td></td></tr><tr><td>500 mL Conical flask</td><td>Thermo Scientific</td><td>4103-0500</td><td></td></tr><tr><td>50 mL vented centrifuge tube</td><td>JET BIOFIL</td><td>BRT-011-050</td><td></td></tr><tr><td>50x TAE buffer</td><td>GENVIEW</td><td>GT1307</td><td></td></tr><tr><td>Agar powder</td><td>Ding Guo</td><td>DH010-1.1</td><td></td></tr><tr><td>Biochemical incubator</td><td>STIK</td><td>21040121500010</td><td></td></tr><tr><td>Cell sieve</td><td>SAINING</td><td>5022200</td><td></td></tr><tr><td>Choline chloride</td><td>Sangon Biotech</td><td>A600299-0100</td><td></td></tr><tr><td>ddH&lt;sub&gt;2&lt;/sub&gt;O</td><td>Ding Guo</td><td>PER018-2</td><td></td></tr><tr><td>Disposable grinding pestle</td><td>JET BIOFIL</td><td>CSP-003-002</td><td></td></tr><tr><td>DNA extraction kit</td><td>Sangon Biotech</td><td>B518221-0050</td><td></td></tr><tr><td>DNA Marker</td><td>Sangon Biotech</td><td>B600335-0250</td><td></td></tr><tr><td>Ethanol absolute</td><td>Sinopharm Chemical Reagent Co., Ltd.</td><td>10009218</td><td></td></tr><tr><td>Filter paper</td><td>NEWSTAR</td><td>1087309025</td><td></td></tr><tr><td>Food processor</td><td>Guangdong Midea Life Electric Appliance Manufacturing Co., Ltd.</td><td>WBL25B26</td><td></td></tr><tr><td>Illuminated&amp;nbsp; incubator</td><td>Shanghai ESTABLISH Instrumentation Co., Ltd.</td><td>A16110768</td><td></td></tr><tr><td>L-Ascorbic acid</td><td>Sangon Biotech</td><td>A610021-0100</td><td></td></tr><tr><td>L-shaped spreader</td><td>SAINING</td><td>6040000</td><td></td></tr><tr><td>Nutrient agar medium</td><td>Hope Bio</td><td>HB0109</td><td></td></tr><tr><td>Scissors</td><td>Bing Yu</td><td>&amp;nbsp;BY-103</td><td>Purchase on Jingdong</td></tr><tr><td>Shock incubator</td><td>Shanghai Zhichu Instrument Co., Ltd.</td><td>2020000014</td><td></td></tr><tr><td>Sucrose</td><td>GENVIEW</td><td>CS326-500G</td><td></td></tr><tr><td>Super Green nucleic acid dye</td><td>Biosharp</td><td>BS355A</td><td></td></tr><tr><td>Super-clean table</td><td>Heal Force</td><td>AC130052</td><td></td></tr><tr><td>TSB</td><td>Hope Bio</td><td>HB4114</td><td></td></tr><tr><td>Vacuum pump</td><td>Zhejiang Taizhou Seeking Precision Vacuum Pump Co., Ltd.</td><td>22051031</td><td></td></tr><tr><td>Yeast extract</td><td>Thermo Scientific</td><td>LP0021B</td><td></td></tr></tbody></table>

rearing axenic delia antiqua with half-fermented sterile diets

Axenic insects are obtained from sterile artificial rearing systems using sterile media. These insects, characterized by their small size, short growth cycle, and low feed requirements, are ideal for studying the relationship between microorganisms and hosts. The gut microbiota significantly influences the physiological characteristics of insect hosts, and introducing specific strains into axenic insects provides a method for verifying gut microbial functions. Delia antiqua, a threatening pest in the order Diptera, family Anthomyiidae, and genus Delia, primarily feeds on onions, garlic, leeks, and other vegetables of the family Liliaceae. Its larvae feed on the bulbs, causing rotting, wilting, and even death of entire plants. By rearing axenic larvae, follow-up studies can be conducted to observe the effects of intestinal microflora on the growth and development of D. antiqua. Unlike the method involving antibiotic elimination of associated microbes, this article presents a low-cost and high-efficiency approach to raising axenic D. antiqua. After surface sterilization of D. antiqua eggs, half-fermented sterile diets were used to raise larvae, and the axenic state of D. antiqua was verified through culture-dependent and culture-independent assays. In conclusion, the combination of insect egg sterilization and the preparation of sterile diets for larval culture has enabled the development of an efficient and simple method for obtaining axenic D. antiqua. This method provides a powerful approach to studying insect-microflora interactions.

The life stages of D. antiqua are depicted in Figure 4. The complete life cycle comprises eggs, larvae, pupa (Figure 4C), and adults (Figure 4D). They are cultivated in sterile centrifuge tubes, and their appearance and survival rate are indistinguishable from D. antiqua raised under non-axenic conditions. The growth and development times for each stage of D. antiqua can be found in Fi...

Watch this Scientific Journal Video about Axenic Rearing of Delia antiqua to Detect the Impact of Intestinal Microbes on Its Growth and Development at JoVE.com

Author Spotlight: Axenic Rearing of Delia antiqua to Detect the Impact of Intestinal Microbes on Its Growth and Development 

A simple procedure for rearing axenic Delia antiqua with half-fermented sterile diets is described. Only one Wolbachia strain was detected in each instar of axenic D. antiqua using PCR.

Rearing Axenic Delia antiqua with Half-Fermented Sterile Diets

Axenic insects are obtained from sterile artificial rearing systems using sterile media. These insects, characterized by their small size, short growth ...

rearing-axenic-delia-antiqua-with-half-fermented-sterile-diets

Research

JoVE Journal

Biology

625 Views.  Qilu University of Technology (Shandong Academy of Sciences). Ons onderzoeksgebied is microbiële ecologie, en we willen microbiële interacties onderzoeken door axenische Delia-antiqua te kweken. Er worden vragen beantwoord over de diversiteit aan darmschimmels van Delia antiqua en hun invloed op de groei en ontwikkeling van Delia antiqua. Er is een eenvoudige methode ontwikkeld voor het kweken van axenische Delia antiqua met halfgefermenteerde steriele diëten en er werd slechts één geïdentificeerde Wolbachia-stam gedetecteerd in elke instar van De...

Video: Auteur in de schijnwerpers: Axenische kweek van Delia antiqua om de impact van darmmicroben op de groei en ontwikkeling ervan te detecteren 

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is a model for understanding microbial interactions with animal hosts, facilitated by approaches to rear large sample sizes of Drosophila under microorganism-free (axenic) conditions, or with defined microbial communities (gnotobiotic). This work outlines a method for collection of Drosophila embryos, hypochlorite dechorionation and sterilization, and transfer to sterile diet. Sterilized embryos are transferred to sterile diet in 50 ml centrifuge tubes, and developing larvae and adults remain free of any exogenous microbes until the vials are opened. Alternatively, flies with a defined microbiota can be reared by inoculating sterile diet and embryos with microbial species of interest. We describe the introduction of 4 bacterial species to establish a representative gnotobiotic microbiota in Drosophila. Finally, we describe approaches for confirming bacterial community composition, including testing if axenic Drosophila remain bacteria-free into adulthood.

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

A method for rearing Drosophila melanogaster under axenic and gnotobiotic conditions is presented. Fly embryos are dechorionated in sodium hypochlorite, transferred aseptically to sterile diet, and reared in closed containers. Inoculating diet and embryos with bacteria leads to gnotobiotic associations, and bacterial presence is confirmed by plating whole-body Drosophila homogenates.

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is ...

Developmental Biology

Solid Plate-based Dietary Restriction in Caenorhabditis elegans

Reduction of food intake without malnutrition or starvation is known to increase lifespan and delay the onset of various age-related diseases in a wide range of species, including mammals. It also causes a decrease in body weight and fertility, as well as lower levels of plasma glucose, insulin, and IGF-1 in these animals. This treatment is often referred to as dietary restriction (DR) or caloric restriction (CR). The nematode Caenorhabditis elegans has emerged as an important model organism for studying the biology of aging. Both environmental and genetic manipulations have been used to model DR and have shown to extend lifespan in C. elegans. However, many of the reported DR studies in C. elegans were done by propagating animals in liquid media, while most of the genetic studies in the aging field were done on the standard solid agar in petri plates. Here we present a DR protocol using standard solid NGM agar-based plate with killed bacteria.

Solid Plate-based Dietary Restriction in Caenorhabditis elegans

Here we present a protocol for performing solid plate-based dietary restriction in C. elegans with killed bacteria.

Reduction of food intake without malnutrition or starvation is known to increase lifespan and delay the onset of various age-related diseases in a wide ...

Production of Germ-Free Fast-Growing Broilers from a Commercial Line for Microbiota Studies

Studies of the gut microbiota contribution to the host physiology and immunocompetence are facilitated by the availability of germ-free animal models, which are considered the gold standard. Nesting birds are ideal models for the production of germ-free animals since there is no need to raise their relatives under sterile conditions. Germ-free chickens are mainly generated from specific-pathogen-free (SPF) experimental lines, which are poorly representative of commercial chicken lines.&#160;The method proposed here allowed the production of germ-free chickens from the fast growing broiler line Ross PM3, commonly used by the poultry industry.&#160;Eggs were quickly collected after laying at a broiler breeder farm.&#160;They underwent a strict decontamination process from the collection to the introduction in a sterile egg hatching isolator.&#160;The chicks have been hatched and kept in these sterile isolators during the period necessary to control their sterility. Originally developed for an experimental SPF white leghorn line, the present protocol has been adapted not only to the Ross PM3 broiler line but also to quails. It therefore represents a robust and readily adaptable procedure to other poultry species and nesting birds of economic, biological or ecological relevance.

Here we describe a method for the generation of germ-free chicks from eggs of a commercial broiler line, the Ross PM3. This method can be adapted for the generation of germ-free animals from other poultry species.

Studies of the gut microbiota contribution to the host physiology and immunocompetence are facilitated by the availability of germ-free animal models, ...

Immunology and Infection

Culturing Caenorhabditis elegans in Axenic Liquid Media and Creation of Transgenic Worms by Microparticle Bombardment

In this protocol, we present the required materials, and the procedure for making modified&#160;C. elegans&#160;Habituation and Reproduction media (mCeHR). Additionally, the steps for exposing and acclimatizing C. elegans grown on E. coli to axenic liquid media are described. Finally, downstream experiments that utilize axenic C. elegans illustrate the benefits of this procedure. The ability to analyze and determine C. elegans&#160;nutrient requirement was illustrated by growing N2 wild type worms in axenic liquid media with varying heme concentrations. This procedure can be replicated with other nutrients to determine the optimal concentration for worm growth and development or, to determine the toxicological effects of drug treatments. The effects of varied heme concentrations on the growth of wild type worms were determined through qualitative microscopic observation and by quantitating the number of worms that grew in each heme concentration. In addition, the effect of varied nutrient concentrations can be assayed by utilizing worms that express fluorescent sensors that respond to changes in the nutrient of interest. Furthermore, a large number of worms were easily produced for the generation of transgenic C. elegans using microparticle bombardment.

Culturing Caenorhabditis elegans in Axenic Liquid Media and Creation of Transgenic Worms by Microparticle Bombardment

C. elegans is usually grown on solid agar plates or in liquid cultures seeded with E. coli. To prevent bacterial byproducts from confounding toxicological and nutritional studies, we utilized an axenic liquid medium, CeHR, to grow and synchronize a large number of worms for a range of downstream applications.

In this protocol, we present the required materials, and the procedure for making modified&#160;C. elegans&#160;Habituation and Reproduction media ...

Establishment and Maintenance of Gnotobiotic American Cockroaches (Periplaneta americana)

Gnotobiotic animals are a powerful tool for the study of controls on microbiome structure and function. Presented here is a protocol for the establishment and maintenance of gnotobiotic American cockroaches (Periplaneta americana). This approach includes built-in sterility checks for ongoing quality control. Gnotobiotic insects are defined here as cockroaches that still contain their vertically transmitted endosymbiont (Blattabacterium) but lack other microbes that normally reside on their surface and in their digestive tract. For this protocol, egg cases (oothecae) are removed from a (nonsterile) stock colony and surface sterilized. Once collected and sterilized, the oothecae are incubated at 30 &#176;C for approximately 4&#8722;6 weeks on brain-heart infusion (BHI) agar until they hatch or are removed due to contamination. Hatched nymphs are transferred to an Erlenmeyer flask containing a BHI floor, sterile water, and sterile rat food. To ensure that the nymphs are not housing microbes that are unable to grow on BHI in the given conditions, an additional quality control measure uses restriction fragment-length polymorphism (RFLP) to test for nonendosymbiotic microbes. Gnotobiotic nymphs generated using this approach can be inoculated with simple or complex microbial communities and used as a tool in gut microbiome studies.

Establishment and Maintenance of Gnotobiotic American Cockroaches Periplaneta americana

This protocol is used in establishing and maintaining gnotobiotic American cockroaches (Periplaneta americana) by surface sterilizing the egg cases (oothecae) prior to hatching. These gnotobiotic insects contain their vertically transmitted Blattabacterium endosymbionts but have axenic guts.

Gnotobiotic animals are a powerful tool for the study of controls on microbiome structure and function. Presented here is a protocol for the establishment ...

Preparing and Rearing Axenic Insects with Tissue Cultured Seedlings for Host-Gut Microbiota Interaction Studies of the Leaf Beetle

Insect guts are colonized by diverse bacteria that can profoundly impact the host&#39;s physiological traits. Introducing a particular bacterial strain into an axenic insect is a powerful method to verify gut microbial function and elucidate the mechanisms underlying gut microbe-host interactions. Administering antibiotics or sterilizing egg surfaces are two commonly used methods to remove gut bacteria from insects. However, in addition to the potential adverse effects of antibiotics on insects, previous studies indicated that feeding antibiotics could not eliminate gut bacteria. Thus, germ-free artificial diets are generally employed to maintain axenic insects, which is a tedious and labor-intensive process that cannot fully resemble nutritional components in natural food. Described here is an efficient and simple protocol to prepare and maintain axenic larvae of a leaf beetle&#160;(Plagiodera versicolora). Specifically, surfaces of the beetle eggs were sterilized, following which germ-free poplar leaves were used to rear axenic larvae. The axenic status of the insects was further confirmed via culture-dependent and culture-independent assays. Collectively, by combining egg disinfection and germ-free cultivation, an efficient and convenient method was developed to obtain axenic P. versicolora, providing a readily transferable tool for other leaf-eating insects.

To obtain an axenic insect, its egg surface is sterilized, and the hatched larva is subsequently reared using axenic leaves. This method provides an efficient way for axenic insect preparation without administering antibiotics or developing an artificial diet, which can also be applied to other leaf-eating insects.

Insect guts are colonized by diverse bacteria that can profoundly impact the host&#39;s physiological traits. Introducing a particular bacterial strain ...

Long-Term Culture of Individual Caenorhabditis elegans on Solid Media for Longitudinal Fluorescence Monitoring and Aversive Interventions

Caenorhabditis elegans are widely used to study aging biology. The standard practice in C. elegans aging studies is to culture groups of worms on solid nematode growth media (NGM), allowing the efficient collection of population-level data for survival and other physiological phenotypes, and periodic sampling of subpopulations for fluorescent biomarker quantification. Limitations to this approach are the inability to (1) follow individual worms over time to develop age trajectories for phenotypes of interest and (2) monitor fluorescent biomarkers directly in the context of the culture environment. Alternative culture approaches use liquid culture or microfluidics to monitor individual animals over time, in some cases including fluorescence quantification, with the tradeoff that the culture environment is contextually distinct from solid NGM. The WorMotel is a previously described microfabricated multi-well device for culturing isolated worms on solid NGM. Each worm is maintained in a well containing solid NGM surrounded by a moat filled with copper sulfate, a contact repellent for C. elegans, allowing longitudinal monitoring of individual animals. We find copper sulfate insufficient to prevent worms from fleeing when subjected to aversive interventions common in aging research, including dietary restriction, pathogenic bacteria, and chemical agents that induce cellular stress. The multi-well devices are also molded from polydimethylsiloxane, which produces high background artifacts in fluorescence imaging. This protocol describes a new approach for culturing isolated roundworms on solid NGM using commercially available polystyrene microtrays, originally designed for human leukocyte antigen (HLA) typing, allowing the measurement of survival, physiological phenotypes, and fluorescence across the lifespan. A palmitic acid barrier prevents worms from fleeing, even in the presence of aversive conditions. Each plate can culture up to 96 animals and easily adapts to a variety of conditions, including dietary restriction, RNAi, and chemical additives, and is compatible with automated systems for collecting lifespan and activity data.

Long-Term Culture of Individual Caenorhabditis elegans on Solid Media for Longitudinal Fluorescence Monitoring and Aversive Interventions

Here, we present a protocol to culture isolated individual nematodes on solid media for lifelong physiological parameter tracking and fluorescence quantification. This culture system includes a palmitic acid barrier around single-worm wells to prevent animals from fleeing, allowing the use of aversive interventions, including pathogenic bacteria and chemical stressors.

Caenorhabditis elegans are widely used to study aging biology. The standard practice in C. elegans aging studies is to culture groups of worms on solid ...

Long-Term Culture and Monitoring of Isolated Caenorhabditis elegans on Solid Media in Multi-Well Devices

The nematode Caenorhabditis elegans is among the most common model systems used in aging research owing to its simple and inexpensive culture techniques, rapid reproduction cycle (~3 days), short lifespan (~3 weeks), and numerous available tools for genetic manipulation and molecular analysis. The most common approach for conducting aging studies in C. elegans, including survival analysis, involves culturing populations of tens to hundreds of animals together on solid nematode growth media (NGM) in Petri plates. While this approach gathers data on a population of animals, most protocols do not track individual animals over time. Presented here is an optimized protocol for the long-term culturing of individual animals on microfabricated polydimethylsiloxane (PDMS) devices called WorMotels. Each device allows up to 240 animals to be cultured in small wells containing NGM, with each well isolated by a copper sulfate-containing moat that prevents the animals from fleeing. Building on the original WorMotel description, this paper provides a detailed protocol for molding, preparing, and populating each device, with descriptions of common technical complications and advice for troubleshooting. Within this protocol are techniques for the consistent loading of small-volume NGM, the consistent drying of both the NGM and bacterial food, options for delivering pharmacological interventions, instructions for and practical limitations to reusing PDMS devices, and tips for minimizing desiccation, even in low-humidity environments. This technique allows the longitudinal monitoring of various physiological parameters, including stimulated activity, unstimulated activity, body size, movement geometry, healthspan, and survival, in an environment similar to the standard technique for group culture on solid media in Petri plates. This method is compatible with high-throughput data collection when used in conjunction with automated microscopy and analysis software. Finally, the limitations of this technique are discussed, as well as a comparison of this approach to a recently developed method that uses microtrays to culture isolated nematodes on solid media.

Long-Term Culture and Monitoring of Isolated Caenorhabditis elegans on Solid Media in Multi-Well Devices

Presented here is an optimized protocol for culturing isolated individual nematodes on solid media in microfabricated multi-well devices. This approach allows individual animals to be monitored throughout their lives for a variety of phenotypes related to aging and health, including activity, body size and shape, movement geometry, and survival.

The nematode Caenorhabditis elegans is among the most common model systems used in aging research owing to its simple and inexpensive culture techniques, ...

Bradysia coprophila Lab Protocols and Chromosomal Research

Laboratory Maintenance of the Lower Dipteran Fly Bradysia (Sciara) coprophila: A New/Old Emerging Model Organism

Laboratory stocks of the lower dipteran fly, Bradysia (Sciara) coprophila, have been maintained for over a century. Protocols for laboratory upkeep of B. coprophila are presented here. These protocols will be useful for the rapidly increasing number of laboratories studying B. coprophila to take advantage of its unique biological features, which include (1) a monopolar spindle in male meiosis I; (2) non-disjunction of the X dyad in male meiosis II; (3) chromosome imprinting to distinguish maternal from paternal homologs; (4) germ line-limited (L) chromosomes; (5) chromosome elimination (paternal chromosomes in male meiosis I; one to two X chromosomes in early embryos; L chromosomes from the soma in early embryos); (6) sex determination by the mother (there is no Y chromosome); and (7) developmentally regulated DNA amplification at the DNA puff loci in larval salivary gland polytene chromosomes. 
It is now possible to explore these many unique features of chromosome mechanics by using the recent advances in sequencing and assembly of the B. coprophila genome and the development of transformation methodology for genomic engineering. The growing scientific community that uses B. coprophila for research will benefit from the protocols described here for mating the flies (phenotypic markers for mothers that will have only sons or only daughters; details of mass mating for biochemical experiments), checking embryo hatch, feeding larvae, and other comments on its rearing.

Author Spotlight: Exploring Bradysia coprophila's Unique Biology &#8211; A Guide to Laboratory Maintenance

This paper outlines the laboratory maintenance (including mating and feeding) of the lower dipteran fly Bradysia (Sciara) coprophila.

Laboratory stocks of the lower dipteran fly, Bradysia (Sciara) coprophila, have been maintained for over a century. Protocols for laboratory upkeep of B. ...

Cultivation Strategies for Uncultured Microbial Diversity in the Chicken GI Tract

Strategies to Enhance Cultivation of Anaerobic Bacteria from Gastrointestinal Tract of Chicken

The gastrointestinal tract (GIT) of chicken is a complex ecosystem harboring trillions of microbes that play a pivotal role in the host&#39;s physiology, digestion, nutrient absorption, immune system maturation, and prevention of pathogen intrusion. For optimal animal health and productivity, it is imperative to characterize these microorganisms and comprehend their role. While the GIT of poultry holds a reservoir of microorganisms with potential probiotic applications, most of the diversity remains unexplored. To enhance our understanding of uncultured microbial diversity, concerted efforts are required to bring these microorganisms into culture. Isolation and cultivation of GIT-colonizing microorganisms yield reproducible material, including cells, DNA, and metabolites, offering new insights into metabolic processes in the environment. Without cultivation, the role of these organisms in their natural settings remains unclear and limited to a descriptive level. Our objective is to implement cultivation strategies aimed at improving the isolation of a diverse range of anaerobic microbes from the chicken&#39;s GIT, leveraging multidisciplinary knowledge from animal physiology, animal nutrition, metagenomics, feed biochemistry, and modern cultivation strategies. Additionally, we aim to implement the use of proper practices for sampling, transportation, and media preparation, which are known to influence isolation success. Appropriate methodologies should ensure a consistent oxygen-free environment, optimal atmospheric conditions, appropriate host incubation temperature, and provision for specific nutritional requirements in alignment with their distinctive needs. By following these methodologies, cultivation will not only yield reproducible results for isolation but will also facilitate isolation procedures, thus fostering a comprehensive understanding of the intricate microbial ecosystem within the chicken&#39;s GIT.

Author Spotlight: Advancing Intestinal Bacteria Cultivation for Poultry

The protocol presents two methodologies to improve the isolation of anaerobic intestinal bacteria. The first focuses on the isolation of a diverse range of bacteria using different culture media. The second focuses on the cultivation steps of a specific microbial group, possibly assimilating myo-inositol, to fully comprehend its ecological significance.

The gastrointestinal tract (GIT) of chicken is a complex ecosystem harboring trillions of microbes that play a pivotal role in the host&#39;s physiology, ...

Rearing Axenic Delia antiqua with Half-Fermented Sterile Diets

Samenvatting

Meer video's verkennen