Aby wyświetlić tę treść, wymagana jest subskrypcja JoVE. Zaloguj się lub rozpocznij bezpłatny okres próbny.
Method Article
This study describes a new method of isolating murine brown adipocytes for gene and protein expression analysis.
Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs contain both multilocular lipid droplets and abundant mitochondria, and they express uncoupling protein 1 (UCP1). BAs are categorized into two sub-types based on their origin: embryo derived classical BAs (cBAs) and white adipocytes derived BAs. Due to their relatively low density, BAs cannot be isolated from BAT with traditional centrifugation method. In this study, a new method was developed to isolate BAs from mice for gene and protein expression analysis. In this protocol, interscapular BAT from adult mice was digested with Collagenase and Dispase solution, and the dissociated BAs were enriched with 6% iodixanol solution. Isolated BAs were then lysed with Trizol reagent for simultaneous isolation of RNA, DNA, and protein. After RNA isolation, the organic phase of the lysate was used for protein extraction. Our data showed that 6% iodixanol solution efficiently enriched BAs without interfering with follow-up gene and protein expression studies. Platelet-derived growth factor (PDGF) is a growth factor that regulates the growth and proliferation of mesenchymal cells. Compared to the brown adipose tissue, isolated BAs had significantly higher expression of Pdgfa. In summary, this new method provides a platform for studying the biology of brown adipocytes at a single cell-type level.
Both mice and humans have two types of adipose tissues: white adipose tissue (WAT) and brown adipose tissue (BAT)1. WAT stores energy in the form of triglycerides in white adipocytes, and the brown adipocytes (BAs) of BAT dissipate chemical energy as heat2. Based on their developmental origin, BAs are further categorized into classical BAs (cBAs) that formed during embryo development and white adipocytes derived BAs (beige/brite cells, converted from white adipocytes under stress conditions)3. BAs are multilocular and express the thermogenic protein uncoupling protein 1 (UCP1)4. Interscapular BAT (iBAT) depot is one of the primary cBAs depots in small mammals5, whereas beige cells are dispersed within WAT6.
Due to their nature of dissipating energy, BAs have received much attention as a therapeutic target for reducing obesity7. To exploit BAs for the purpose of treating obesity, it is essential to understand the molecular mechanisms that control BAs function, survival, and recruitment. Adipose tissues including BAT and WAT are heterogeneous. Except for adipocytes, adipose tissues contain many other cell types, such as endothelial cells, mesenchymal stem cells and macrophages8. Although genetic tools to specifically deplete candidate genes in mice BAs are available, such as UCP1::Cre line9, techniques for purifying BAs from BAT or WAT are limited, making it hard to study BAs at a single-cell type level. Additionally, without obtaining pure BAs, the relationship between BAs and non-BAs will not be clearly delineated. For instance, platelet-derived growth factor receptor alpha (PDGFRα) has been used as a marker for undifferentiated mesenchymal cells, and it is expressed in the endothelial and interstitial cells of BAT. In cold stressed BAT, PDGFRα positive progenitor cells give rise to new BAs10. PDGFRα is activated by its ligand PDGF, a growth factor that regulates the growth and proliferation of mesenchymal cells11; however, it is unclear whether BAs influence the behavior of PDGFRα positive progenitor cells by secreting PDGF.
Recently, a BAs isolation protocol has been published, which is based on fluorescence-activated cell sorting (FACS)12. In this protocol, 3% bovine serum albumin (BSA) solution was used to separate BAs from non-BAs, and the enriched BAs were further purified by FACS. The application of this protocol is limited by the requirement of FACS process, which relies on both equipment and FACS operation experiences. In this study, a new protocol for isolating BAs from BAT was developed. The BAs isolated by this protocol can be directly used for gene and protein expression studies. Furthermore, data from this study suggest that BAs are a major PDGF resource.
Access restricted. Please log in or start a trial to view this content.
All mice were maintained in pathogen-free conditions, and all procedures were approved by Masonic Medical research Institutional Animal Care and Use Committee (IACUC). UCP1::Cre9 and Rosa 26tdTomato mice lines13 were reported previously. All mice were kept at room temperature with a 12 h light/dark cycle.
1. Preparing the Solutions and brown adipose tissue (BAT)
2. BAs isolation procedure
3. RNA and protein isolation from BAs
Access restricted. Please log in or start a trial to view this content.
Preparation of interacapular BAT for brown adipocytes isolation
The brown adipocytes (BAs) isolation process is depicted in Figure 1A. The whole process, from preparing BAT and digestion/separation solutions to obtaining isolated BAs will take around 4 h.
In adult mice, abundant BAT exists in the interscapular region. This interscapular BAT (iBAT) is covered by muscle layers and WAT (Figure 1B). Before starting th...
Access restricted. Please log in or start a trial to view this content.
In this study, a new method of isolating BAs for gene and protein expression analysis was developed.
In a published BAs isolation protocol, 3% BSA solution was used to enrich BAs12. Nevertheless, the enriched BAs achieved by this published protocol could not be directly used for protein expression analysis. This is because the concentrated BSA existing in the BAs solution interferes with following-up protein extraction. When the BAs enriched in the 3% BSA solution were ...
Access restricted. Please log in or start a trial to view this content.
None
Z. Lin was supported by National Institutes of Health HL138454-01 and Masonic Medical Research Institute funds.
Access restricted. Please log in or start a trial to view this content.
Name | Company | Catalog Number | Comments |
Antibodies | |||
Antigen | Company | Catalog | |
PPARγ | LSBio | Ls-C368478 | |
PDGFRa | Santa Cruz | sc-398206 | |
UCP1 | R&D system | IC6158P | |
Chemical and solutions | |||
Collagenase, Type II | Thermo Fisher Scientific | 17101015 | |
1-Bromo-3-chloropropane | Sigma-Aldrich | B62404 | |
Bovine Serum Albumin (BSA) | Goldbio | A-421-10 | |
Calcium chloride | Bio Basic | CT1330 | |
Chloroform | IBI Scientific | IB05040 | |
Dispase II, protease | Sigma-Aldrich | D5693 | |
EDTA | Bio Basic | EB0107 | |
Ethanol | IBI Scientific | IB15724 | |
LiQuant Universal Green qPCR Master Mix | LifeSct | LS01131905Y | |
Magnesium Chloride Hexahydrate | Boston BioProducts | P-855 | |
OneScrip Plus cDNA Synthesis SuperMix | ABM | G454 | |
OptiPrep (Iodixanol) | Cosmo Bio USA | AXS-1114542 | |
PBS (10x) | Caisson Labs | PBL07 | |
PBS (1x) | Caisson Labs | PBL06 | |
Pierce BCA Protein Assay Kit | Thermo Fisher Scientific | 23227 | |
Potassium Chloride | Boston BioProducts | P-1435 | |
SimplyBlue safe Stain | Invitrogen | LC6060 | |
Sodium dodecyl sulfate (SDS) | Sigma-Aldrich | 75746 | |
Trizol reagent | Life technoologies | 15596018 | |
Primers | |||
Gene name (Species) | Forward | Reverse | |
Pdgfra (Mouse) | CTCAGCTGTCTCCTCACAgG | CAACGCATCTCAGAGAAAAGG | |
Pdgfa (Mouse) | TGTGCCCATTCGCAGGAAGAG | TTGGCCACCTTGACACTGCG | |
36B4(Mouse) | TGCTGAACATCTCCCCCTTCTC | TCTCCACAGACAATGCCAGGAC | |
Ucp1 | ACTGCCACACCTCCAGTCATT | CTTTGCCTCACTCAGGATTGG | |
Equipment | |||
Name | Company | Application | |
Keyence BZ-X700 | Keyence | Imaging brown adipocytes | |
Magnetic stirrer | VWR | Dissociate BAT | |
QuantStudio 6 Flex Real-Time PCR System | Applied Biosystem | Quantitative PCR | |
The Odyssey Fc Imaging system | LI-COR | Western blot immaging |
Access restricted. Please log in or start a trial to view this content.
Zapytaj o uprawnienia na użycie tekstu lub obrazów z tego artykułu JoVE
Zapytaj o uprawnieniaThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. Wszelkie prawa zastrzeżone