We thank Dr. Charles Greenberg for the use of his Real time PCR machine. This work is supported by MUSC Hollings Cancer Center Startup Fund, Hollings Cancer Center ACS IRG, ASCO Conquer Cancer Foundation Career Development Award, NIH 1K08HL 103780-01A1, and NIH 3P30CA138313-01S3. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health or other funding agents.

1. Bone Marrow Cell Isolation
<ol>
	<li>Euthanize male donor FVB/NJ mice and female FVB/NJ mice using CO2 method followed by cervical dislocation. The female FVB/NJ bone marrow cells will be used as competitive cells.</li>
	<li>Use small scissors and forceps, dissect out femurs and tibiaes from mice and place them in a 60 mm tissue culture dish containing 6 ml ice-cold RPMI1640 with 5% heat inactivated FBS. Use kimwipe tissue to remove muscle and other tissues. Cut off both ends of each bone shaft in the dish.</li>
	<li>Connect the end of the bone with 23G needle on 3 cc syringe, flush out bone marrow with RPMI1640 with 5% heat inactivated FBS into the dish. Disaggregate bone marrow tissues by repeated aspirations using the same needle. Transfer the cell suspension to 15 ml centrifuge tube.</li>
	<li>Spin down the cells for 5 min at 400 x g, remove the supernatant, resuspend the cells in 1 ml of room temperature red blood cell lysis buffer (155 mM potassium bicarbonate, 10 mM Ammonium chloride, 0.1 mM of EDTA, PH=7.4) and incubate at room temperature for 5 min then add 5-10 ml of RPMI 1640 with 5% heat inactivated FBS.</li>
	<li>Pass the cells through a cell strainer. Collect the flow through to a new tube. Spin down for 5 min at 400 x g. Remove the supernatant; the cell pellet should not contain any red color. The absence of red color indicates a complete removal of red blood cells. Resuspend the cell pellet in 10 ml of RPMI1640 with 5% heat inactivated FBS. Gently vortex to make sure the cell suspension is completely uniform. Take an aliquot and count the cells in a hemacytometer. Calculate how much volume of cells needed for bone marrow transplantation and aliquot enough cells and mix male donor cells with competitor female cells at a ratio of 5:2. Spin down for 5 min at 400 x g, wash with PBS, resuspend in PBS with the final concentration of donor cells at 5&times;106/ml and competitor cells at 2&times;106/ml.</li>
</ol>
2. Competitive Bone Marrow Transplantation
<ol>
	<li>Irradiate female recipient mice (8-12 wks of age) with 137Cs gamma rays radiator at a single dose of 11Gy 4-6 hr before bone marrow transplantation.</li>
	<li>Place the irradiated female mice in a mouse restrainer. Inject the mixed donor and competitor cells via tail vein in 0.1 ml of total volume such that each mouse receives 5&times;105 donor cells and 2&times;105 competitor bone marrow cells.</li>
</ol>
3. Sample Collection
Couples weeks after bone marrow transplantation, collect peripheral blood samples (~50 &mu;l) from female recipient mouse by retro-orbital bleeding under anesthesia condition. Samples are collected into EDTA coated tubes. BM samples can also be collected at the end of experiment, usually at least 4 months post transplantation, with same procedures as previous described (Step 1); usually 20-40% of 1 tibia BM cells are enough to make enough amount of DNA. Blood or BM samples from age matched normal female and male mice are also collected to prepare standard curve.
4. Genomic DNA Isolation
<ol>
	<li>Add 4&times; volume of room temperature RBC lysis buffer (~ 200 &mu;l) to each blood sample. Mix well and incubate at room temperature for 5 min. Add 1 ml of PBS, then spin down to remove most of the lysed RBC.</li>
	<li>Isolate DNA using a blood DNA extraction kit (QIAmp DNA Blood extraction kit). Pre-warm the elution buffer (AE) at 37 &deg;C to enhance the yield of eluted DNA. Male and female DNAs for standard curve are isolated similarly.</li>
	<li>(Optional) Genomic DNA can be further purified or concentrated using EtOH precipitation method in the presence of 3 M Sodium Acetate (pH=5.5). The DNA pellets are then resuspended in 40-50 &mu;l distilled water for analysis immediately or stored at -20 &deg;C for future use.</li>
	<li>Measure the DNA concentration with Nanodrop ND-1000 spectra photometer. Samples with OD 260/280 between 1.8-2.0 are used for further analysis.</li>
	<li>Dilute DNA with DNAase free H2O to 4ng/&mu;l in a total volume of 50 &mu;l.</li>
</ol>
5. Standard Curve Preparation
Dilute male DNA and female DNA to a concentration of 4 ng/&mu;l, and make the DNA mixture according the Table1
<table border="1">
	<tbody>
		<tr>
			<td>% of male DNA in Female Background</td>
			<td>Volume (&mu;l) of 4ng/&mu;l male DNA</td>
			<td>Volume (&mu;l) of 4ng/&mu;l female DNA</td>
			<td>Total volume(&mu;l)</td>
		</tr>
		<tr>
			<td>0.2</td>
			<td>1</td>
			<td>499</td>
			<td>500</td>
		</tr>
		<tr>
			<td>0.5</td>
			<td>1</td>
			<td>199</td>
			<td>200</td>
		</tr>
		<tr>
			<td>2.5</td>
			<td>5</td>
			<td>195</td>
			<td>200</td>
		</tr>
		<tr>
			<td>12.5</td>
			<td>25</td>
			<td>175</td>
			<td>200</td>
		</tr>
		<tr>
			<td>50</td>
			<td>100</td>
			<td>100</td>
			<td>200</td>
		</tr>
		<tr>
			<td>87.5</td>
			<td>175</td>
			<td>25</td>
			<td>200</td>
		</tr>
		<tr>
			<td>100</td>
			<td>200</td>
			<td>0</td>
			<td>200</td>
		</tr>
	</tbody>
</table>
Table 1. Sample preparation for standard curve. Normal male and female FVB/NJ mice at the age of 8-12wks were sacrificed. Blood and BM cells were collected. DNAs from male cells and female cells were isolated and re-suspended at a concentration of 4ng/&mu;l. The male and female DNAs were mixed at various ratios to generate the DNA standard sample mixtures.
6. Real-time PCR
<ol>
	<li>Set up the PCR reaction plate by mixing SYBR Green supermix reagent with primers and genomic DNA. The reaction volume (20 &mu;l) contains 400 nM of each primer and 5 &mu;l of blood cell genomic DNA (4ng/&mu;l x5 &mu;l=20 ng) in each reaction. DNA samples and standards were set up in triplicate. The sequences of primers are shown in Table 2.</li>
</ol>
<table border="1">
	<tbody>
		<tr>
			<td>Gene name</td>
			<td>Forward</td>
			<td>Reverse</td>
		</tr>
		<tr>
			<td>Bcl2</td>
			<td>5&prime;-AAGCTGTCACAGAGGGGCTA</td>
			<td>5&prime;- CAGGCTGGAAGGAGAAGATG</td>
		</tr>
		<tr>
			<td>Zfy1</td>
			<td>5-TGGAGAGCCACAAGCTAACCA</td>
			<td>5'- CCCAGCATGAGAAAGATTCTTC</td>
		</tr>
	</tbody>
</table>
Table 2. RT-PCR primer sequence for murine Bcl2 and Zfy1.
<ol start="2">
	<li>Perform PCR reaction using Biorad iQ5 PCR machine with the following conditions: 95 &deg;C 3 min, 42 amplification cycles of 95 &deg;C for 10 sec, 58 &deg;C for 25 sec and 72 &deg;C for 15 sec, followed by a melting-curve step.</li>
	<li>Obtain Cycle threshold (Ct) values by Bio-Rad iQ5 2.1 Standard Edition Optical System. Calculate &delta;Ct (CtZfy1-CtBcl2) value, and Zfy1 expression level is calculated as the value of 2-&delta; Ct.</li>
	<li>Establish standard curves for each reaction series using 2-&delta;Ct reading from known male/female standard mixtures. The standard curves are generated by plotting the mean of 2-&delta;Ct value of triplicates to the known % male DNA in the mixture with linear regression fitting.</li>
</ol>

<ol>
	<li>McCulloch, E. A., Till, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+radiation+sensitivity+of+normal+mouse+bone+marrow+cells,+determined+by+quantitative+marrow+transplantation+into+irradiated+mice.">The radiation sensitivity of normal mouse bone marrow cells, determined by quantitative marrow transplantation into irradiated mice.</a> Radiat. Res. 13, 115-125 (1960).</li><li>Xiao, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hematopoietic+stem+cells+lacking+Ott1+display+aspects+associated+with+aging+and+are+unable+to+maintain+quiescence+during+proliferative+stress.">Hematopoietic stem cells lacking Ott1 display aspects associated with aging and are unable to maintain quiescence during proliferative stress.</a> Blood. 119, 4898-4907 (2012).</li><li>Kang, Y., Chen, B. J., Deoliveira, D., Mito, J., Chao, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+enhancement+of+donor+hematopoietic+cell+engraftment+by+the+CXCR4+antagonist+AMD3100+in+a+mouse+transplantation+model.">Selective enhancement of donor hematopoietic cell engraftment by the CXCR4 antagonist AMD3100 in a mouse transplantation model.</a> PLoS One. 5, e11316 (2010).</li><li>Sadeghi, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GVHD+after+chemotherapy+conditioning+in+allogeneic+transplanted+mice.">GVHD after chemotherapy conditioning in allogeneic transplanted mice.</a> Bone Marrow Transplant. 42, 807-818 (2008).</li><li>Taketo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FVB/N:+an+inbred+mouse+strain+preferable+for+transgenic+analyses.">FVB/N: an inbred mouse strain preferable for transgenic analyses.</a> Proc. Natl. Acad. Sci. U.S.A. 88, 2065-2069 (1991).</li><li>Morisaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotypic+analysis+using+a+Y-chromosome-specific+probe+following+bone+marrow+transplantation.">Genotypic analysis using a Y-chromosome-specific probe following bone marrow transplantation.</a> Am. J. Hematol. 27, 30-33 (1988).</li><li>Lo, Y. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+fetal+DNA+in+maternal+plasma+and+serum:+implications+for+noninvasive+prenatal+diagnosis.">Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis.</a> Am. J. Hum. Genet. 62, 768-775 (1998).</li><li>Byrne, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimerism+analysis+in+sex-mismatched+murine+transplantation+using+quantitative+real-time+PCR.">Chimerism analysis in sex-mismatched murine transplantation using quantitative real-time PCR.</a> Biotechniques. 32, 279-280 (2002).</li><li>Ma, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+recipient-derived+cells+in+allograft+neointima+formation+and+the+response+to+stent+implantation.">Contribution of recipient-derived cells in allograft neointima formation and the response to stent implantation.</a> PLoS One. 3, e1894 (2008).</li><li>Bosio, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+between+real-time+quantitative+PCR+and+DNA+hybridization+for+quantitation+of+male+DNA+following+myoblast+transplantation.">A comparison between real-time quantitative PCR and DNA hybridization for quantitation of male DNA following myoblast transplantation.</a> Cell Transplant. 13, 817-821 (2004).</li><li>Merchant, A., Joseph, G., Wang, Q., Brennan, S., Matsui, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+regulates+the+proliferation+and+differentiation+of+HSCs+and+myeloid+progenitors.">Gli1 regulates the proliferation and differentiation of HSCs and myeloid progenitors.</a> Blood. 115, 2391-2396 (2010).</li><li>Nagamine, C. M., Chan, K., Hake, L. E., Lau, Y. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+two+candidate+testis-determining+Y+genes+(Zfy-1+and+Zfy-2)+are+differentially+expressed+in+fetal+and+adult+mouse+tissues.">The two candidate testis-determining Y genes (Zfy-1 and Zfy-2) are differentially expressed in fetal and adult mouse tissues.</a> Genes &amp; development. 4, 63-74 (1990).</li><li>Grundler, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+PIM+serine/threonine+kinases+in+FLT3-ITD-induced+leukemogenesis+reveals+PIM1+as+regulator+of+CXCL12-CXCR4-mediated+homing+and+migration.">Dissection of PIM serine/threonine kinases in FLT3-ITD-induced leukemogenesis reveals PIM1 as regulator of CXCL12-CXCR4-mediated homing and migration.</a> J. Exp. Med. 206, 1957-1970 (2009).</li></ol>

We have no competing financial interests to disclose.

The objective of our current study is to provide the audiences a PCR based technique to quantify donor cell engraftment in a competitive murine bone marrow transplantation model. Several studies have been reported using RT-PCR to detect donor cells in transplantation models 9-10. Dr. Schwarzenberger's group first developed a murine bone marrow transplantation model using real-time PCR to amplify y-chromosome-specific 8. This method was used to study Gli-1 function in HSC activity 11. We t...

Murine bone marrow (BM) transplantation model was first developed in 1960s1. This model has been extensively used for the study of donor hematopoietic stem cell (HSC) biology in a host recipient mouse. Murine bone marrow transplant model has provided us with valuable knowledge on HSC functions and their regulation and is indispensable in HSC research. Allogeneic bone marrow transplant model like C57Bl/6JH2b-Balb/CH2d or congenic transplant model like C56Bl/6JCD45.2-B6.SJLCD45.1 are used in many laboratories to study the gene function on HSC activity2, effect of drug treatment on HSC function3 or transplantation related diseases such as graft-versus-host disease (GvHD)4.
Cell surface markers such as MHC haplotype or CD45.1 are commonly used for distinguishing donor-derived cells from recipient-originated cells. C57Bl/6JH2b, CD45.2, Balb/CH2d and B6.SJLCD45.1 are the most commonly used mouse strains in bone marrow transplantation because the donor cell contribution can be easily assessed by flow cytometry measuring CD45.1 vs. CD45.2 or H2b vs. H2d. However, many other strains such as FVB/NJ5 and C3H are also often used to generate genetically engineered transgenic or knockout mice. These mice may be backcrossed to an inbred line and maintained in a mixed genetic/MHC background. In these cases, determining donor cell engraftment and HSC function could be difficult as donor specific- cell surface markers may not be available.
Using Y-chromosome-specific DNA probe to detect the donor male cells by southern blot in sex-mismatched bone marrow transplantation was first developed by Dr. Miwa's group 6. Then, a real-time PCR for the sex-determining region Y was found to be an accurate and highly specific method to quantitate male fetal cells in the maternal blood system7. This concept was adapted by Dr. Schwarzenberger's group for the development of a real-time PCR technique in a murine bone marrow transplantation model to determine donor cell engraftment 8. We further modified this method for the measurement of donor cell engraftment in FVB/NJ mouse bone marrow transplant model. This method is currently extensively utilized in our group for studying the role of Pim1 kinase in HSC biology.

<table><tbody><tr><td>RPMI 1640</td><td>Hyclone</td><td>SH30255.01</td><td></td></tr><tr><td>FBS</td><td>Invitrogen</td><td>16140-017</td><td>Heat inactivated</td></tr><tr><td>Ammonium chloride</td><td>MP Biomedicaals</td><td>194806</td><td></td></tr><tr><td>Potassium Bicarbonate</td><td>Fisher</td><td>P184-500</td><td></td></tr><tr><td>QIAamp DNA Blood minikit</td><td>Qiagen</td><td>51106</td><td></td></tr><tr><td>Cell strainer</td><td>BD bioscience</td><td></td><td></td></tr><tr><td>iQ SYBR Green supermix</td><td>Biorad</td><td>170-8882</td><td></td></tr><tr><td>iQ5 real time PCR machine</td><td>Biorad</td><td></td><td></td></tr><tr><td>Spectra photometer</td><td>Nanodrop ND-1000</td><td>ND-1000</td><td></td></tr></tbody></table>

using quantitative real-time pcr to determine donor cell engraftment in a competitive murine bone marrow transplantation model

Murine bone marrow transplantation models provide an important tool in measuring hematopoietic stem cell (HSC) functions and determining genes/molecules that regulate HSCs. In these transplant model systems, the function of HSCs is determined by the ability of these cells to engraft and reconstitute lethally irradiated recipient mice. Commonly, the donor cell contribution/engraftment is measured by antibodies to donor- specific cell surface proteins using flow cytometry. However, this method heavily depends on the specificity and the ability of the cell surface marker to differentiate donor-derived cells from recipient-originated cells, which may not be available for all mouse strains. Considering the various backgrounds of genetically modified mouse strains in the market, this cell surface/ flow cytometry-based method has significant limitations especially in mouse strains that lack well-defined surface markers to separate donor cells from congenic recipient cells. Here, we reported a PCR-based technique to determine donor cell engraftment/contribution in transplant recipient mice. We transplanted male donor bone marrow HSCs to lethally irradiated congenic female mice. Peripheral blood samples were collected at different time points post transplantation. Bone marrow samples were obtained at the end of the experiments. Genomic DNA was isolated and the Y chromosome specific gene, Zfy1, was amplified using quantitative Real time PCR. The engraftment of male donor-derived cells in the female recipient mice was calculated against standard curve with known percentage of male vs. female DNAs. Bcl2 was used as a reference gene to normalize the total DNA amount. Our data suggested that this approach reliably determines donor cell engraftment and provides a useful, yet simple method in measuring hematopoietic cell reconstitution in murine bone marrow transplantation models. Our method can be routinely performed in most laboratories because no costly equipment such as flow cytometry is required.

Figure 1 and 2 showed examples of standard curves plotted with mean values of 2-&delta;Ct against percentages of male DNA. Figure 1A showed specific melting temperature for Bcl2 and Zfy1 amplicons localized at 78.5 &deg;C and 88.5 &deg;C, respectively. Bcl2 is used as a reference gene to normalize the total amount of loaded DNA in each PCR reaction. Bcl2 amplification curves (Log view) for each standard sample merge with each other independent of male DNA concentration, indica...

Watch this Scientific Journal Video about Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model at JoVE.com

Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model

Determining donor cell engraftment presents a challenge in mouse bone marrow transplant models that lack well-defined phenotypical markers. We described a methodology to quantify male donor cell engraftment in female transplant recipient mice. This method can be used in all mouse strains for the study of HSC functions.

Murine bone marrow transplantation models provide an important tool in measuring hematopoietic stem cell (HSC) functions and determining genes/molecules ...

using-quantitative-real-time-pcr-to-determine-donor-cell-engraftment

Research

JoVE Journal

Medicine

15.3K Views.  Medical University of South Carolina. Determining donor cell engraftment presents a challenge in mouse bone marrow transplant models that lack well-defined phenotypical markers. We described a methodology to quantify male donor cell engraftment in female transplant recipient mice. This method can be used in all mouse strains for the study of HSC functions.

Video: Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model

Transduction-Transplantation Mouse Model of Myeloproliferative Neoplasm

Transduction-transplantation is a quick and efficient way to model human hematologic malignancies in mice. This technique results in expression of the gene of interest in hematopoietic cells and can be used to study the gene's role in normal and/or malignant hematopoiesis. This protocol provides a detailed description on how to perform transduction-transplantation using calreticulin (CALR) mutations recently identified in myeloproliferative neoplasm (MPN) as an example. In this protocol whole bone marrow cells from 5-flurouracil (5-FU) treated donor mice are transduced with a retrovirus encoding mutant CALR and transplanted into lethally irradiated syngeneic hosts. Donor cells expressing mutant CALR are marked with green fluorescent protein (GFP). Transplanted mice develop an MPN phenotype including elevated platelets in the peripheral blood, expansion of megakaryocytes in the bone marrow, and bone marrow fibrosis. We provide a step-by-step account of how to generate retrovirus, calculate viral titer, transduce whole bone marrow cells, and transplant into irradiated recipient mice.

This manuscript provides a description of the methodology used to establish transduction-transplantation mouse models. A detailed account is given of technical errors to avoid when performing bone marrow transplants. A clear understanding should be gained of the importance of high viral titer, transfection/transduction, and irradiation.

Transduction-transplantation is a quick and efficient way to model human hematologic malignancies in mice. This technique results in expression of the ...

Cancer Research

Combining Intravital Fluorescent Microscopy (IVFM) with Genetic Models to Study Engraftment Dynamics of Hematopoietic Cells to Bone Marrow Niches

Increasing evidence indicates that normal hematopoiesis is regulated by distinct microenvironmental cues in the BM, which include specialized cellular niches modulating critical hematopoietic stem cell (HSC) functions1,2. Indeed, a more detailed picture of the hematopoietic microenvironment is now emerging, in which the endosteal and the endothelial niches form functional units for the regulation of normal HSC and their progeny3,4,5. New studies have revealed the importance of perivascular cells, adipocytes and neuronal cells in maintaining and regulating HSC function6,7,8. Furthermore, there is evidence that cells from different lineages, i.e. myeloid and lymphoid cells, home and reside in specific niches within the BM microenvironment. However, a complete mapping of the BM microenvironment and its occupants is still in progress.
Transgenic mouse strains expressing lineage specific fluorescent markers or mice genetically engineered to lack selected molecules in specific cells of the BM niche are now available. Knock-out and lineage tracking models, in combination with transplantation approaches, provide the opportunity to refine the knowledge on the role of specific &#34;niche&#34; cells for defined hematopoietic populations, such as HSC, B-cells, T-cells, myeloid cells and erythroid cells. This strategy can be further potentiated by merging the use of two-photon microscopy of the calvarium. By providing in vivo high resolution imaging and 3-D rendering of the BM calvarium, we can now determine precisely the location where specific hematopoietic subsets home in the BM and evaluate the kinetics of their expansion over time. Here, Lys-GFP transgenic mice (marking myeloid cells)9 and RBPJ knock-out mice (lacking canonical Notch signaling)10 are used in combination with IVFM to determine the engraftment of myeloid cells to a Notch defective BM microenvironment.

Combining Intravital Fluorescent Microscopy IVFM with Genetic Models to Study Engraftment Dynamics of Hematopoietic Cells to Bone Marrow Niches

Intravital fluorescence microscopy (IVFM) of the calvarium is applied in combination with genetic animal models to study the homing and engraftment of hematopoietic cells into bone marrow (BM) niches.

Increasing evidence indicates that normal hematopoiesis is regulated by distinct microenvironmental cues in the BM, which include specialized cellular ...

Developmental Biology

Competitive Transplants to Evaluate Hematopoietic Stem Cell Fitness

The gold standard definition of a hematopoietic stem cell (HSC) is a cell that when transferred into an irradiated recipient will have the ability to reestablish blood cell production for the lifespan of the recipient. This protocol explains how to set up a functional assay to compare the HSC capacities of two different populations of cells, such as bone marrow from mice of two different genotypes, and how to analyze the recipient mice by flow cytometry. The protocol uses HSC equivalents rather than cell sorting for standardization and discusses the advantages and disadvantages of both approaches. We further discuss different variations to the basic protocol, including serial transplants, limiting dilution assays, homing assays and non-competitive transplants, including the advantages and preferred uses of these varied approaches. These assays are central for the study of HSC function and could be used not only for the investigation of fundamental HSC intrinsic aspects of biology but also for the development of preclinical assays for bone marrow transplant and HSC expansion in culture.

This protocol provides step-by-step guidelines for setting up competitive mouse bone marrow transplant experiments to study hematopoietic stem/progenitor cell function without prior purification of stem cells by cell sorting.

The gold standard definition of a hematopoietic stem cell (HSC) is a cell that when transferred into an irradiated recipient will have the ability to ...

Induction of Graft-versus-host Disease and In Vivo T Cell Monitoring Using an MHC-matched Murine Model

Graft-versus-host disease (GVHD) is the limiting barrier to the broad use of bone marrow transplant as a curative therapy for a variety of hematological deficiencies. GVHD is caused by mature alloreactive T cells present in the bone marrow graft that are infused into the recipient and cause damage to host organs. However, in mice, T cells must be added to the bone marrow inoculum to cause GVHD. Although extensive work has been done to characterize T cell responses post transplant, bioluminescent imaging technology is a non-invasive method to monitor T cell trafficking patterns in vivo. 
Following lethal irradiation, recipient mice are transplanted with bone marrow cells and splenocytes from donor mice. T cell subsets from L2G85.B6 (transgenic mice that constitutively express luciferase) are included in the transplant. By only transplanting certain T cell subsets, one is able to track specific T cell subsets in vivo, and based on their location, develop hypotheses regarding the role of specific T cell subsets in promoting GVHD at various time points. At predetermined intervals post transplant, recipient mice are imaged using a Xenogen IVIS CCD camera. Light intensity can be quantified using Living Image software to generate a pseudo-color image based on photon intensity (red = high intensity, violet = low intensity). 
Between 4-7 days post transplant, recipient mice begin to show clinical signs of GVHD. Cooke et al.1 developed a scoring system to quantitate disease progression based on the recipient mice fur texture, skin integrity, activity, weight loss, and posture. Mice are scored daily, and euthanized when they become moribund. Recipient mice generally become moribund 20-30 days post transplant. 
Murine models are valuable tools for studying the immunology of GVHD. Selectively transplanting particular T cell subsets allows for careful identification of the roles each subset plays. Non-invasively tracking T cell responses in vivo adds another layer of value to murine GVHD models.

Induction of Graft-versus-host Disease and In Vivo T Cell Monitoring Using an MHC-matched Murine Model

Murine bone marrow transplantation is a widely used technique to study immunological mechanisms governing graft-versus-host disease in humans. The ability to monitor T cell trafficking patterns in vivo allows for detailed analysis of the development and perpetuation of T cell responses during graft-versus-host disease.

Graft-versus-host disease (GVHD) is the limiting barrier to the broad use of bone marrow transplant as a curative therapy for a variety of hematological ...

Immunology and Infection

Differentiating Functional Roles of Gene Expression from Immune and Non-immune Cells in Mouse Colitis by Bone Marrow Transplantation

To understand the role of a gene in the development of colitis, we compared the responses of wild-type mice and gene-of-interest deficient knockout mice to colitis. If the gene-of-interest is expressed in both bone marrow derived cells and non-bone marrow derived cells of the host; however, it is possible to differentiate the role of a gene of interest in bone marrow derived cells and non- bone marrow derived cells by bone marrow transplantation technique. To change the bone marrow derived cell genotype of mice, the original bone marrow of recipient mice were destroyed by irradiation and then replaced by new donor bone marrow of different genotype. When wild-type mice donor bone marrow was transplanted to knockout mice, we could generate knockout mice with wild-type gene expression in bone marrow derived cells. Alternatively, when knockout mice donor bone marrow was transplanted to wild-type recipient mice, wild-type mice without gene-of-interest expressing from bone marrow derived cells were produced. However, bone marrow transplantation may not be 100% complete. Therefore, we utilized cluster of differentiation (CD) molecules (CD45.1 and CD45.2) as markers of donor and recipient cells to track the proportion of donor bone marrow derived cells in recipient mice and success of bone marrow transplantation. Wild-type mice with CD45.1 genotype and knockout mice with CD45.2 genotype were used. After irradiation of recipient mice, the donor bone marrow cells of different genotypes were infused into the recipient mice. When the new bone marrow regenerated to take over its immunity, the mice were challenged by chemical agent (dextran sodium sulfate, DSS 5%) to induce colitis. Here we also showed the method to induce colitis in mice and evaluate the role of the gene of interest expressed from bone-marrow derived cells. If the gene-of-interest from the bone derived cells plays an important role in the development of the disease (such as colitis), the phenotype of the recipient mice with bone marrow transplantation can be significantly altered. At the end of colitis experiments, the bone marrow derived cells in blood and bone marrow were labeled with antibodies against CD45.1 and CD45.2 and their quantitative ratio of existence could be used to evaluate the success of bone marrow transplantation by flow cytometry. Successful bone marrow transplantation should show a vast majority of donor genotype (in term of CD molecule marker) over recipient genotype in both the bone marrow and blood of recipient mice.

Bone marrow transplantation provides a way to change the genotype of the bone marrow derived cells. If the gene of interest is expressed in both bone marrow derived cells and non-bone marrow derived cells, bone marrow transplantation can change the bone marrow derived cells to a different genotype without changing the non-bone marrow derived cell genotype.

To understand the role of a gene in the development of colitis, we compared the responses of wild-type mice and gene-of-interest deficient knockout mice ...

Quantitative Multispectral Analysis Following Fluorescent Tissue Transplant for Visualization of Cell Origins, Types, and Interactions

With the desire to understand the contributions of multiple cellular elements to the development of a complex tissue; such as the numerous cell types that participate in regenerating tissue, tumor formation, or vasculogenesis, we devised a multi-colored cellular transplant model of tumor development in which cell populations originate from different fluorescently colored reporter gene mice and are transplanted, engrafted or injected in and around a developing tumor. These colored cells are then recruited and incorporated into the tumor stroma. In order to quantitatively assess bone marrow derived tumor stromal cells, we transplanted GFP expressing transgenic whole bone marrow into lethally irradiated RFP expressing mice as approved by IACUC. 0ovarian tumors that were orthotopically injected into the transplanted mice were excised 6-8 weeks post engraftment and analyzed for bone marrow marker of origin (GFP) as well as antibody markers to detect tumor associated stroma using multispectral imaging techniques. We then adapted a methodology we call MIMicc- Multispectral Interrogation of Multiplexed cellular compositions, using multispectral unmixing of fluoroprobes to quantitatively assess which labeled cell came from which starting populations (based on original reporter gene labels), and as our ability to unmix 4, 5, 6 or more spectra per slide increases, we&#39;ve added additional immunohistochemistry associated with cell lineages or differentiation to increase precision. Utilizing software to detect co-localized multiplexed-fluorescent signals, tumor stromal populations can be traced, enumerated and characterized based on marker staining.1

Complex tissue masses, from organs to tumors, are composed of various cellular elements. We elucidated the contribution of cellular phenotypes within a tissue utilizing multi-labeled fluorescent transgenic mice in combination with multiparameter immunofluorescent staining followed by spectral unmixing to decipher cell origin as well as cell characteristics based on protein expression.

With the desire to understand the contributions of multiple cellular elements to the development of a complex tissue; such as the numerous cell types that ...

Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice

T cell receptor (TCR) signaling is essential in the development and differentiation of T cells in the thymus and periphery, respectively. The vast array of TCRs proves studying a specific antigenic response difficult. Therefore, TCR transgenic mice were made to study positive and negative selection in the thymus as well as peripheral T cell activation, proliferation and tolerance. However, relatively few TCR transgenic mice have been generated specific to any given antigen. Thus, studies involving TCRs of varying affinities for the same antigenic peptide have been lacking. The generation of a new TCR transgenic line can take six or more months. Additionally, any specific backcrosses can take an additional six months. In order to allow faster generation and screening of multiple TCRs, a protocol for retroviral transduction of bone marrow was established with stoichiometric expression of the TCR&#945; and TCR&#946; chains and the generation of retrogenic mice. Each retrogenic mouse is essentially a founder, virtually negating a founder effect, while the length of time to generate a TCR retrogenic is cut from six months to approximately six weeks. Here we present a rapid and flexible alternative to TCR transgenic mice that can be expressed on any chosen background with any particular TCR.

We present a rapid and flexible protocol for a single T cell receptor (TCR) retroviral-based in vivo expression system. Retroviral vectors are used to transduce bone marrow progenitor cells to study T cell development and function of a single TCR in vivo as an alternative to TCR transgenic mice.

T cell receptor (TCR) signaling is essential in the development and differentiation of T cells in the thymus and periphery, respectively.  The vast array ...

Retroviral Overexpression of CXCR4 on Murine B-1a Cells and Adoptive Transfer for Targeted B-1a Cell Migration to the Bone Marrow and IgM Production

As cell function is influenced by niche-specific factors in the cellular microenvironment, methods to dissect cell localization and migration can provide further insight on cell function. B-1a cells are a unique B cell subset in mice that produce protective natural IgM antibodies against oxidation-specific epitopes that arise during health and disease. B-1a cell IgM production differs depending on B-1a cell location, and therefore it becomes useful from a therapeutic standpoint to target B-1a localization to niches supportive of high antibody production. Here we describe a method to target B-1a cell migration to the bone marrow by retroviral-mediated overexpression of the C-X-C motif chemokine receptor 4 (CXCR4). Gene induction in primary murine B cells can be challenging and typically yields low transfection efficiencies of 10-20% depending on technique. Here we demonstrate that retroviral transduction of primary murine B-1a cells results in 30-40% transduction efficiency. This method utilizes adoptive cell transfer of transduced B-1a cells into B cell-deficient recipient mice so that donor B-1a cell migration and localization can be visualized. This protocol can be modified for other retroviral constructs and can be used in diverse functional assays post-adoptive transfer, including analysis of donor cell or host cell phenotype and function, or analysis of soluble factors secreted post B-1a cell transfer. The use of distinct donor and recipient mice differentiated by CD45.1 and CD45.2 allotype and the presence of a GFP reporter within the retroviral plasmid could also enable detection of donor cells in other, immune-sufficient mouse models containing endogenous B cell populations.

Here we describe a method for retroviral overexpression and adoptive transfer of murine B-1a cells to examine in vivo B-1a cell migration and localization. This protocol can be extended for diverse downstream functional assays including quantification of donor B-1a cell localization or analysis of donor cell-derived secreted factors post-adoptive transfer.

As cell function is influenced by niche-specific factors in the cellular microenvironment, methods to dissect cell localization and migration can provide ...

Bone Marrow Transplantation Procedures in Mice to Study Clonal Hematopoiesis

Clonal hematopoiesis is a prevalent age-associated condition that results from the accumulation of somatic mutations in hematopoietic stem and progenitor cells (HSPCs). Mutations in driver genes, that confer cellular fitness, can lead to the development of expanding HSPC clones that increasingly give rise to progeny leukocytes harboring the somatic mutation. Because clonal hematopoiesis has been associated with heart disease, stroke, and mortality, the development of experimental systems that model these processes is key to understanding the mechanisms that underly this new risk factor. Bone marrow transplantation procedures involving myeloablative conditioning in mice, such as total-body irradiation (TBI), are commonly employed to study the role of immune cells in cardiovascular diseases. However, simultaneous damage to the bone marrow niche and other sites of interest, such as the heart and brain, is unavoidable with these procedures. Thus, our lab has developed two alternative methods to minimize or avoid possible side effects caused by TBI: 1) bone marrow transplantation with irradiation shielding and 2) adoptive BMT to non-conditioned mice. In shielded organs, the local environment is preserved allowing for the analysis of clonal hematopoiesis while the function of resident immune cells is unperturbed. In contrast, the adoptive BMT to non-conditioned mice has the additional advantage that both the local environments of the organs and the hematopoietic niche are preserved. Here, we compare three different hematopoietic cell reconstitution approaches and discuss their strengths and limitations for studies of clonal hematopoiesis in cardiovascular disease.

We describe three methods of bone marrow transplantation (BMT): BMT with total-body irradiation, BMT with shielded irradiation, and BMT method with no pre-conditioning (adoptive BMT) for the study of clonal hematopoiesis in mouse models.

Clonal hematopoiesis is a prevalent age-associated condition that results from the accumulation of somatic mutations in hematopoietic stem and progenitor ...

Intrafemoral Injection for Bone Marrow Study in Live Mice

Simplified Intrafemoral Injections Using Live Mice Allow for Continuous Bone Marrow Analysis

Despite the complexity of hematopoietic cell transplantation in humans, researchers commonly perform intravenous or intrafemoral (IF) injections in mice. In murine models, this technique has been adapted to enhance the seeding efficiency of transplanted hematopoietic stem and progenitor cells (HSPCs). This paper describes a detailed step-by-step technical procedure of IF injection and the following bone marrow (BM) aspiration in mice that allows for serial characterization of cells present in the BM. This method enables the transplantation of valuable samples with low cell numbers that are particularly difficult to engraft by intravenous injection. This procedure facilitates the creation of xenografts that are critical for pathological analysis. While it is easier to access peripheral blood (PB), the cellular composition of PB does not reflect the BM, which is the niche for HSPCs. Therefore, procedures providing access to the BM compartment are essential for studying hematopoiesis. IF injection and serial BM aspiration, as described here, allow for the prospective retrieval and characterization of cells enriched in the BM, such as HSPCs, without sacrificing the mice.

This protocol describes the intrafemoral injection of a few hematopoietic or leukemic stem cells, including gene-edited cells, in murine xenograft models, which will not only enable the quick and safe transplantation of cells but also serial analyses of the bone marrow.

Despite the complexity of hematopoietic cell transplantation in humans, researchers commonly perform intravenous or intrafemoral (IF) injections in mice. ...

Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Transduction-Transplantation Mouse Model of Myeloproliferative Neoplasm

Combining Intravital Fluorescent Microscopy (IVFM) with Genetic Models to Study Engraftment Dynamics of Hematopoietic Cells to Bone Marrow Niches

Competitive Transplants to Evaluate Hematopoietic Stem Cell Fitness

Induction of Graft-versus-host Disease and In Vivo T Cell Monitoring Using an MHC-matched Murine Model

Differentiating Functional Roles of Gene Expression from Immune and Non-immune Cells in Mouse Colitis by Bone Marrow Transplantation

Quantitative Multispectral Analysis Following Fluorescent Tissue Transplant for Visualization of Cell Origins, Types, and Interactions

Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice

Retroviral Overexpression of CXCR4 on Murine B-1a Cells and Adoptive Transfer for Targeted B-1a Cell Migration to the Bone Marrow and IgM Production

Bone Marrow Transplantation Procedures in Mice to Study Clonal Hematopoiesis

Simplified Intrafemoral Injections Using Live Mice Allow for Continuous Bone Marrow Analysis