우리는 그의 실시간 PCR 기계의 사용 찰스 박사 그린버그 감사드립니다. 이 작품은 MUSC 홀 링스 암 센터 시작 기금, 홀 링스 암 센터 ACS IRG, ASCO 암 재단 경력 개발 상을 정복, NIH 1K08HL 103780-01A1, 그리고 NIH 3P30CA138313-01S3에 의해 지원됩니다. 내용은 전적으로 저자의 책임이며 반드시 건강 또는 다른 기금 대리인의 국립 연구소의 공식 전망을 대표하지 않습니다.

1. 골수 세포 절연 <ol><li> 남성 기증자 FVB / NJ 마우스와 경부 전위 다음 CO 2 방법을 사용하여 여성 FVB / NJ 쥐를 안락사시켜야. 여성 FVB / NJ 골수 세포 경쟁 세포로 사용됩니다. </li><li> 마우스의 대퇴골과 tibiaes을 해부 5 % 열 inactivated FBS 6 ML 얼음처럼 차가운 RPMI1640을 포함하는 60mm 조직 배양 접시에 넣고, 작은 가위와 집게를 사용하십시오. 근육과 다른 조직을 제거 kimwipe 조직을 사용합니다. 접시에 각각의 뼈 샤프트의 양쪽 끝을 잘라. </li><li> 3 CC의 주사기에 23G 바늘로 뼈의 끝을 연결 그릇에 5% 열 inactivated FBS와 RPMI1640과 골수를 제거. 같은 바늘을 사용하여 반복 열망에 의해 골수 조직을 Disaggregate. 15 ML의 원심 분리기 튜브에 세포 현탁액을 전송합니다. </li><li> 400 XG에서 5 분 동안 세포를 스핀 다운, 표면에 뜨는을 제거, (155 MM P 상온 적혈구 용해 버퍼 1 ML에있는 세포를 resuspendotassium 중탄산염, 10 밀리미터 염화 암모늄, EDTA (에틸렌 다이아 민 테트라 초산), = 7.4 PH 0.1 ㎜)와 5 분 동안 실온에서 배양 한 다음 5% 열 inactivated FBS와 RPMI 1640의 5-10 ML를 추가합니다. </li><li> 셀 스트레이너를 통해 세포를 전달합니다. 새로운 튜브에 이르기까지의 흐름을 수집합니다. 400 X g에서 5 분을 위해 스핀 다운. 표면에 뜨는을 제거하고, 세포 펠렛은 붉은 색이 포함되어서는 안됩니다. 붉은 색의 부재는 적혈구의 전체 제거를 나타냅니다. 5% 열 inactivated FBS와 RPMI1640의 10 ML에있는 세포 펠렛을 Resuspend. 확인을 부드럽게 소용돌이 세포 현탁액은 완전히 균일입니다. 나누어지는 가지고 hemacytometer에서 셀을 계산합니다. 계산 얼마나 많은 골수 이식과 나누어지는 충분한 세포에 필요한 세포의 볼륨과 5시 2분의 비율에서 경쟁 암 세포를 가지고 남성 기증자 세포를 섞는다. 400 XG에서 5 분을 위해 스핀 다운, 2에서 5 × 10 6 / ML 및 경쟁 세포에 공여 세포의 최종 농도로 PBS에 PBS로 resuspend을 씻어 × 10 6 </suP&gt; / ML. </li></ol> 2. 경쟁 골수 이식 <ol><li> 골수 이식 전에 11Gy 4-6 시간의 단일 복용에 137Cs 감마 선 방열기로 비추다 여성받는 마우스 (세 8-12 wks). </li><li> 마우스 restrainer의 방사능 여성 마우스를 놓습니다. 각 마우스가 5 × 10 5 기증자 세포 2 × 10 5 경쟁자 골수 세포를받는 등 총 볼륨의 0.1 ML의 꼬리 정맥을 통해 혼합 기증자와 경쟁 세포를 주입. </li></ol> 3. 샘플 수집 커플 주 골수 이식 후 마취 상태에서 역 궤도 출혈에 의해 여성받는 마우스의 말초 혈액 샘플 (~ 50 μl)를 수집합니다. 샘플은 EDTA (에틸렌 다이아 민 테트라 초산) 코팅 튜브로 수집하고 있습니다. BM 샘플도 설명 이전과 동일한 절차 (1 단계)로, 보통 최소 4 개월 후 이식, 실험의 끝에서 수집 될 수있다;의 보통 20~40%한 경골 BM 세포는 DNA의 충분한 양을 만들 정도로 수 있습니다. 혈액 또는 BM 샘플 시대의 검색 일반 여성과 남성 생쥐는 표준 곡선을 준비하기 위해 수집됩니다. 4. 게놈 DNA 절연 <ol><li> 각 혈액 샘플에 방 온도 RBC 용해 버퍼의 4 × 볼륨 (~ 200 μl)를 추가합니다. 잘 섞은 후 5 분 동안 실온에서 알을 품다. PBS 1 ML을 추가 한 다음 lysed RBC의 대부분을 제거하는 스핀 다운. </li><li> 혈액 DNA 추출 키트 (QIAmp의 DNA 혈액 추출 키트)를 사용하여 DNA를 분리합니다. 37 번 프리 따뜻한 용출 버퍼 (AE) ° C 용출 DNA의 수율을 향상 할 수 있습니다. 표준 곡선에 대한 남성과 여성의 DNAs은 마찬가지로 격리되어 있습니다. </li><li> (선택 사항) 게놈의 DNA가 더 정화 또는 3 M의 아세트산 나트륨 (산도 = 5.5)의 존재에 EtOH 침전 방법을 사용하여 집중 할 수 있습니다. DNA 알약은 다음 즉시 분석을 위해 40-50 μl 증류수에 resuspended하거나 나중에 사용하기 위해 -20 ° C에 저장됩니다. </li><li> DNA의 concentr를 측정Nanodrop ND-1000 스펙트럼의 측광과 ation. OD 260 / 1.8-2.0 사이의 280과 샘플은 추가적인 분석을 위해 사용됩니다. </li><li> 50 μl의 총 볼륨에 4ng/μl 할 DNAase 무료 H 2 O와 DNA를 희석. </li></ol> 5. 표준 곡선 준비 4 NG / μl의 농도에 남성 DNA와 여자 DNA를 희석하고, Table1에 따르면 DNA 혼합물을 <table border="1"><tbody><tr><td> 여성 배경에서 남성의 DNA의 비율 (%) </td><td> 4ng/μl 남성 DNA의 양 (μl) </td><td> 4ng/μl 여성 DNA의 양 (μl) </td><td> 총 볼륨 (μl) </td></tr><tr><td> 0.2 </td><td> 1 </td><td> 499 </td><td> 500 </td></tr><tr><td> 0.5 </td><td> 1 </td><td> 199 </td><td> 200 </td></tr><tr><td> 2.5 </td><td> 5 </td><td> 195 </td><td> 200 </td></tr><tr><td> 12.5 </td><td> 25 </td><td> 175 </td><td> 200 </td></tr><tr><td> 50 </td><td> 100 </td><td> 100 </td><td> 200 </td></tr><tr><td> 87.5 </td><td> 175 </td><td> 25 </td><td> 200 </td></tr><tr><td> 100 </td><td> 200 </td><td> 0 </td><td> 200 </td></tr></tbody></table> 표준 곡선에 대한 표 1. 샘플 준비. 8 12wks 세의 나이에 일반 남성과 여성의 FVB / NJ 쥐들이 희생되었습니다. 혈액 및 BM 세포가 수집되었습니다. 남성 셀과 여성 셀에서 DNAs은 4ng/μl의 농도에서 분리하고 다시 중지되었습니다. 남성과 여성의 DNAs은 DNA 표준 샘플 혼합물을 생성하기 위해 다양한 비율로 혼합되었다. 6. 실시간 PCR <ol><li> 프리 머와 게놈 DNA와 SYBR 그린 supermix 시약을 혼합하여 PCR 반응 판을 설정합니다. 반응 볼륨 (20 μl)는 각 반응의 각 프라이머 및 혈액 세포 게놈의 DNA (4ng/μl X5의 μl = 20 NG)의 5 μl 400 nm의가 포함되어 있습니다. DNA samp레와 기준은 세중의에 설립되었습니다. 프리 머의 시퀀스는 표 2에 표시됩니다. </li></ol><table border="1"><tbody><tr><td> 유전자 이름 </td><td> 앞으로 </td><td> 역 </td></tr><tr><td> Bcl2 </td><td> 5&#39;-AAGCTGTCACAGAGGGGCTA </td><td> 5&#39;-CAGGCTGGAAGGAGAAGATG </td></tr><tr><td> Zfy1 </td><td> 5 TGGAGAGCCACAAGCTAACCA </td><td> 5&#39;-CCCAGCATGAGAAAGATTCTTC </td></tr></tbody></table> 손쥐 Bcl2 및 Zfy1에 대한 표 2. RT-PCR의 프라이머 순서. <ol start="2"><li> 다음 조건 Biorad iQ5 PCR 기계를 사용하여 PCR 반응을 수행 95 ° C 3 분, 95의 42 증폭 사이클 ° 10 초에 C, 58 ° 15 초 25 초 72 ° C에 대한 C, 녹는 곡선 다음 단계. </li><li> 바이오 RAD iQ5 2.1 일반용 광학 시스템에 의해 순환 임계 값 (CT) 값을 가져옵니다. 계산 δCt (CT Zfy1 &lt;/) 값을&gt; - CT Bcl2를 한모금하고, Zfy1 표현 수준은 2 δ CT의 값으로 계산됩니다. </li><li> 알려진 여성 / 남성 표준 혼합물로부터 2 δCt 읽기를 사용하여 각 반응 시리즈 표준 곡선을 설정합니다. 표준 곡선은 선형 회귀 피팅과 혼합에 알려져 % 남성 DNA에 triplicates의 2 δCt 값의 평균을 플로팅에 의해 생성됩니다. </li></ol>

<ol>
	<li>McCulloch, E. A., Till, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+radiation+sensitivity+of+normal+mouse+bone+marrow+cells,+determined+by+quantitative+marrow+transplantation+into+irradiated+mice.">The radiation sensitivity of normal mouse bone marrow cells, determined by quantitative marrow transplantation into irradiated mice.</a> Radiat. Res. 13, 115-125 (1960).</li><li>Xiao, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hematopoietic+stem+cells+lacking+Ott1+display+aspects+associated+with+aging+and+are+unable+to+maintain+quiescence+during+proliferative+stress.">Hematopoietic stem cells lacking Ott1 display aspects associated with aging and are unable to maintain quiescence during proliferative stress.</a> Blood. 119, 4898-4907 (2012).</li><li>Kang, Y., Chen, B. J., Deoliveira, D., Mito, J., Chao, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+enhancement+of+donor+hematopoietic+cell+engraftment+by+the+CXCR4+antagonist+AMD3100+in+a+mouse+transplantation+model.">Selective enhancement of donor hematopoietic cell engraftment by the CXCR4 antagonist AMD3100 in a mouse transplantation model.</a> PLoS One. 5, e11316 (2010).</li><li>Sadeghi, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GVHD+after+chemotherapy+conditioning+in+allogeneic+transplanted+mice.">GVHD after chemotherapy conditioning in allogeneic transplanted mice.</a> Bone Marrow Transplant. 42, 807-818 (2008).</li><li>Taketo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FVB/N:+an+inbred+mouse+strain+preferable+for+transgenic+analyses.">FVB/N: an inbred mouse strain preferable for transgenic analyses.</a> Proc. Natl. Acad. Sci. U.S.A. 88, 2065-2069 (1991).</li><li>Morisaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotypic+analysis+using+a+Y-chromosome-specific+probe+following+bone+marrow+transplantation.">Genotypic analysis using a Y-chromosome-specific probe following bone marrow transplantation.</a> Am. J. Hematol. 27, 30-33 (1988).</li><li>Lo, Y. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+fetal+DNA+in+maternal+plasma+and+serum:+implications+for+noninvasive+prenatal+diagnosis.">Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis.</a> Am. J. Hum. Genet. 62, 768-775 (1998).</li><li>Byrne, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimerism+analysis+in+sex-mismatched+murine+transplantation+using+quantitative+real-time+PCR.">Chimerism analysis in sex-mismatched murine transplantation using quantitative real-time PCR.</a> Biotechniques. 32, 279-280 (2002).</li><li>Ma, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+recipient-derived+cells+in+allograft+neointima+formation+and+the+response+to+stent+implantation.">Contribution of recipient-derived cells in allograft neointima formation and the response to stent implantation.</a> PLoS One. 3, e1894 (2008).</li><li>Bosio, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+between+real-time+quantitative+PCR+and+DNA+hybridization+for+quantitation+of+male+DNA+following+myoblast+transplantation.">A comparison between real-time quantitative PCR and DNA hybridization for quantitation of male DNA following myoblast transplantation.</a> Cell Transplant. 13, 817-821 (2004).</li><li>Merchant, A., Joseph, G., Wang, Q., Brennan, S., Matsui, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+regulates+the+proliferation+and+differentiation+of+HSCs+and+myeloid+progenitors.">Gli1 regulates the proliferation and differentiation of HSCs and myeloid progenitors.</a> Blood. 115, 2391-2396 (2010).</li><li>Nagamine, C. M., Chan, K., Hake, L. E., Lau, Y. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+two+candidate+testis-determining+Y+genes+(Zfy-1+and+Zfy-2)+are+differentially+expressed+in+fetal+and+adult+mouse+tissues.">The two candidate testis-determining Y genes (Zfy-1 and Zfy-2) are differentially expressed in fetal and adult mouse tissues.</a> Genes &amp; development. 4, 63-74 (1990).</li><li>Grundler, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+PIM+serine/threonine+kinases+in+FLT3-ITD-induced+leukemogenesis+reveals+PIM1+as+regulator+of+CXCL12-CXCR4-mediated+homing+and+migration.">Dissection of PIM serine/threonine kinases in FLT3-ITD-induced leukemogenesis reveals PIM1 as regulator of CXCL12-CXCR4-mediated homing and migration.</a> J. Exp. Med. 206, 1957-1970 (2009).</li></ol>

우리는 금융 이익은 공개 경쟁 없습니다.

현재 연구의 목적은 고객에게 경쟁력있는 손쥐 골수 이식 모델에서 기증자 세포 engraftment을 수량화 할 수있는 PCR 기반 기술을 제공하는 것입니다. 여러 연구 이식 모델 9-10에 공여 세포를 감지 할 수 RT-PCR을 사용하여보고되었습니다. 박사 Schwarzenberger의 그룹은 먼저 Y-염색체 별 8 증폭하기 위해 실시간 PCR을 사용하여 손쥐 골수 이식 모델을 개발했습니다. 이 방법은 HSC 활동 11</...

손쥐 골수 (BM) 이식 모델이 처음 1960 년대 1 개발되었습니다. 이 모델은 광범위하게 기증 조혈 줄기 세포 (HSC) 호스트받는 마우스 생물학 연구에 사용되었습니다. 손쥐 골수 이식 모델은 HSC 기능과 규제에 대한 귀중한 지식으로 우리를 제공하고 HSC 연구에 필수 불가결합니다. C56Bl/6J CD45.2 - B6.SJL CD45.1 같은 C57Bl/6J H2b-Balb / C H2d 또는 congenic 이식 모델 같은 Allogeneic 골수 이식 모델은 효과, HSC 활동 2 유전자 기능을 연구하기 위해 여러 실험실에서 사용되는 이러한 이식 - 대 - 호스트 질병 (GvHD) 4 등 HSC 기능 3 이식 관련 질환에 대한 약물 치료. 이러한 MHC haplotype 또는 CD45.1 등의 세포 표면 마커는 일반적으로받는 사람 - 유래 세포에서 구별 기증자 파생 셀에 사용됩니다. C57Bl/6J H2b, CD45.2 </su기증자 세포 기여 쉽게 CD45.1 대 CD45.2 또는 H2b 대를 측정 유동 세포 계측법에 의해 평가 될 수 있기 때문에 P는&gt;, Balb / C H2d 및 B6.SJL CD45.1는 골수 이식에서 가장 일반적으로 사용되는 마우스 변종 아르 H2d. 그러나, 이러한 FVB / NJ 5 C3H 등 여러 다른 변종은 종종 유전 공학 유전자 변형 또는 녹아웃 마우스를 생성하는 데 사용됩니다. 이 마우스는 타고난 줄에 backcrossed와 혼합 MHC / 유전 배경에서 유지 될 수 있습니다. 기증자 특정 세포 표면 마커를 사용할 수 없습니다 이러한 경우에는 기증자 세포 engraftment 및 HSC 기능을 결정하는 것은 어려울 수 있습니다. 섹스 일치하지 않는 골수 이식의 남부 얼룩으로 기증자 남성 세포를 감지하는 Y-염색체 특정 DNA 프로브를 사용하면 첫째 박사 미와의 그룹 6 개발되었습니다. 그런 다음 섹스를 결정 지역 Y에 대한 실시간 PCR은 교장 quantitate 할 수있는 정확하고 구체적인 방법으로 발견되었다산모 혈액 시스템 7 르 태아 세포. 이 개념은 공여 세포 engraftment 8 결정하는 손쥐 골수 이식 모델에서 실시간 PCR 기술의 개발을위한 박사 Schwarzenberger의 그룹에 의해 조정되었다. 우리는 더 FVB / NJ 마우스 골수 이식 모델에서 기증자 세포 engraftment의 측정을 위해이 방법을 수정했습니다. 이 방법은 현재 광범위하게 HSC 생물학 Pim1 키나제의 역할을 공부에 대한 우리의 그룹에 사용된다.

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td><td> 코멘트 (선택 사항) </td></tr><tr><td> RPMI 1640 </td><td> Hyclone </td><td> SH30255.01 </td><td></td></tr><tr><td> FBS </td><td> Invitrogen </td><td> 16140-017 </td><td> inactivated 열 </td></tr><tr><td> 염화 암모늄 </td><td> MP Biomedicaals </td><td> 194806 </td><td></td></tr><tr><td> 칼륨 중탄산염 </td><td> 어부 </td><td> P184-500 </td><td></td></tr><tr><td> QIAamp DNA 혈액 minikit </td><td> Qiagen </td><td> 51,106 </td><td></td></tr><tr><td> 셀 스트레이너 </td><td> bioscience BD </td><td></td><td></td></tr><tr><td> iQ의 SYBR 그린 supermix </td><td> Biorad </td><td> 170-8882 </td><td></td></tr><tr><td> iQ5 실시간 PCR 기계 </td><td> Biorad </td><td></td><td></td></tr><tr><td> 스펙트럼 측광 </td><td> ND-1000 Nanodrop </td><td> ND-1000 </td><td></td></tr></tbody></table>

using quantitative real-time pcr to determine donor cell engraftment in a competitive murine bone marrow transplantation model

손쥐 골수 이식 모델은 조혈 줄기 세포 (HSC) 기능과 결정 유전자 / HSCs를 조절 분자를 측정에 중요한 도구를 제공합니다. 이러한 이식 모델 시스템에서 HSCs의 기능이 합치다 및 reconstitute lethally 방사능받는 마우스에 이러한 세포의 능력에 의해 결정됩니다. 일반적으로, 기증자 세포 기여 / engraftment는 유동 세포 계측법을 사용하여 기증자 특정 세포 표면 단백질에 대한 항체에 의해 측정됩니다. 그러나,이 방법은 크게 특이성 및 모든 마우스 변종을 사용할 수 없습니다 수신자 - 유래 세포에서 기증자 파생 세포를 차별화 할 수있는 세포 표면 마커의 능력에 따라 달라집니다. 시장에서 유전자 변형 마우스 변종의 다양한 배경을 고려,이 세포 표면 / 흐름 세포 계측법 기반의 방법은 특히 congenic받는 CE에서 별도의 기증자 세포에 잘 정의 된 표면 마커를 결여 마우스 변종에 상당한 한계를 가지고있다재편. 여기, 우리는 이식받는 마우스에 기증자 세포 engraftment / 공헌을 결정하는 PCR 기반 기술을 발표했다. 우리는 lethally 방사능 congenic 여성 마우스로 남성 기증 골수 HSCs를 이식. 주변 혈액 샘플은 다른 시간 지점 게시물 이식에서 수집되었다. 골수 샘플은 실험의 끝에 획득했다. 게놈 DNA의 고립 된와 Y 염색체 특정 유전자 Zfy1은 정량 실시간 PCR을 사용하여 증폭되었다. 여성받는 쥐 남성 기증자 파생 세포의 engraftment는 남성 대 여성 DNAs의 알려진 비율과 표준 곡선으로부터 계산되었다. Bcl2은 전체 DNA 금액을 정상화 할 수있는 참조 유전자로 사용되었다. 우리의 데이터는 접근이 안정적으로 공여 세포 engraftment을 결정하고 손쥐 골수 이식 모델에서 조혈 세포 reconstitution을 측정에 유용하면서도 간단한 방법을 제공합니다 것을 제안했습니다. 우리의 방법은 정기적으로 대부분의 실험실에서 수행 할 수 있기 때문에 더이러한 유동 세포 계측법과 같은 비용이 많이 드는 장비가 필요합니다.

그림 1과 2는 표준 곡선의 예는 남성 DNA의 비율에 대한 2 δCt의 평균 값으로 꾸몄다 보여 주었다. 그림 1A는 각각, 78.5 ° C와 88.5 ° C에서 지역화 Bcl2 및 Zfy1 amplicons에 특정 녹는 온도를 보여 주었다. Bcl2는 각 PCR 반응에로드 DNA의 총 양을 정상화 할 수있는 참조 유전자로 사용됩니다. 각 표준 시료에 대한 Bcl2 증폭 곡선 (로그보기)로드의 DNA (그림 1B)의 동등...

Watch this Scientific Journal Video about Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model at JoVE.com

Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model

기증자 세포 engraftment을 결정하는 것은 잘 정의 phenotypical 마커를 부족 마우스 골수 이식 모델에서 도전을 선물한다. 우리는 여성 이식받는 마우스의 남성 기증자 세포 engraftment을 수량화하는 방법을 설명했다. 이 방법은 HSC 기능의 연구에 대한 모든 마우스 변종에 사용할 수 있습니다.

경쟁 손쥐 골수 이식 모델에서 기증자 세포 Engraftment를 확인하려면 수량 실시간 PCR을 사용하여

Murine bone marrow transplantation models provide an important tool in measuring hematopoietic stem cell (HSC) functions and determining genes/molecules ...

using-quantitative-real-time-pcr-to-determine-donor-cell-engraftment

Research

JoVE Journal

Medicine

15.3K 조회수.  Medical University of South Carolina. 기증자 세포 engraftment을 결정하는 것은 잘 정의 phenotypical 마커를 부족 마우스 골수 이식 모델에서 도전을 선물한다. 우리는 여성 이식받는 마우스의 남성 기증자 세포 engraftment을 수량화하는 방법을 설명했다. 이 방법은 HSC 기능의 연구에 대한 모든 마우스 변종에 사용할 수 있습니다.

비디오: Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model

A Mouse Model of in Utero Transplantation

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus. For example, in utero transplantation (IUT) of hematopoietic stem cells has been used to successfully treat patients with severe combined immunodeficiency.1,2 In several other conditions, however, IUT has been attempted without success.3 Given these mixed results, the availability of an efficient non-human model to study the biological sequelae of stem cell transplantation and gene therapy is critical to advance this field. We and others have used the mouse model of IUT to study factors affecting successful engraftment of in utero transplanted hematopoietic stem cells in both wild-type mice4-7 and those with genetic diseases.8,9 The fetal environment also offers considerable advantages for the success of in utero gene therapy. For example, the delivery of adenoviral10, adeno-associated viral10, retroviral11, and lentiviral vectors12,13 into the fetus has resulted in the transduction of multiple organs distant from the site of injection with long-term gene expression. in utero gene therapy may therefore be considered as a possible treatment strategy for single gene disorders such as muscular dystrophy or cystic fibrosis. Another potential advantage of IUT is the ability to induce immune tolerance to a specific antigen. As seen in mice with hemophilia, the introduction of Factor IX early in development results in tolerance to this protein.14 
In addition to its use in investigating potential human therapies, the mouse model of IUT can be a powerful tool to study basic questions in developmental and stem cell biology. For example, one can deliver various small molecules to induce or inhibit specific gene expression at defined gestational stages and manipulate developmental pathways. The impact of these alterations can be assessed at various timepoints after the initial transplantation. Furthermore, one can transplant pluripotent or lineage specific progenitor cells into the fetal environment to study stem cell differentiation in a non-irradiated and unperturbed host environment.
The mouse model of IUT has already provided numerous insights within the fields of immunology, and developmental and stem cell biology. In this video-based protocol, we describe a step-by-step approach to performing IUT in mouse fetuses and outline the critical steps and potential pitfalls of this technique.

A Mouse Model of in Utero Transplantation

The mouse model of in utero transplantation is a versatile tool that can be used to study the potential clinical applications of stem cell transplantation and gene therapy in the fetus. In this protocol, we present a general approach to performing this technique

의 마우스 모델 Utero에 이식

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus.  For example, in ...

연구

의학

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process including development1, apoptosis2, and cell cycle regulation3. MiRNAs are estimated to regulate the expression of 30% to 90% of human genes4 by binding to their target messenger RNAs (mRNAs)5. Widespread dysregulation of miRNAs has been reported in various diseases and cancer subtypes6. Due to their prevalence and unique structure, these small molecules are likely to be the next generation of biomarkers, therapeutic agents and/or targets.
Methods used to investigate miRNA expression include SYBR green I dye- based as well as Taqman-probe based qPCR. If miRNAs are to be effectively used in the clinical setting, it is imperative that their detection in fresh and/or archived clinical samples be accurate, reproducible, and specific. qPCR has been widely used for validating expression of miRNAs in whole genome analyses such as microarray studies7. The samples used in this protocol were from patients who underwent radical prostatectomy for clinically localized prostate cancer; however other tissues and cell lines can be substituted in. Prostate specimens were snap-frozen in liquid nitrogen after resection. Clinical variables and follow-up information for each patient were collected for subsequent analysis8.
Quantification of miRNA levels in prostate tumor samples. The main steps in qPCR analysis of tumors are: Total RNA extraction, cDNA synthesis, and detection of qPCR products using miRNA-specific primers. Total RNA, which includes mRNA, miRNA, and other small RNAs were extracted from specimens using TRIzol reagent. Qiagen's miScript System was used to synthesize cDNA and perform qPCR (Figure 1). Endogenous miRNAs are not polyadenylated, therefore during the reverse transcription process, a poly(A) polymerase polyadenylates the miRNA. The miRNA is used as a template to synthesize cDNA using oligo-dT and Reverse Transcriptase. A universal tag sequence on the 5' end of oligo-dT primers facilitates the amplification of cDNA in the PCR step. PCR product amplification is detected by the level of fluorescence emitted by SYBR Green, a dye which intercalates into double stranded DNA. Specific miRNA primers, along with a Universal Primer that binds to the universal tag sequence will amplify specific miRNA sequences. 
The miScript Primer Assays are available for over a thousand human-specific miRNAs, and hundreds of murine-specific miRNAs. Relative quantification method was used here to quantify the expression of miRNAs. To correct for variability amongst different samples, expression levels of a target miRNA is normalized to the expression levels of a reference gene. The choice of a gene on which to normalize the expression of targets is critical in relative quantification method of analysis. Examples of reference genes typically used in this capacity are the small RNAs RNU6B, RNU44, and RNU48 as they are considered to be stably expressed across most samples. In this protocol, RNU6B is used as the reference gene.

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR qPCR

Quantitative Real Time polymerase chain reaction (qPCR) is a rapid and sensitive method to investigate the expression levels of various microRNA (miRNA) molecules in tumor samples. Using this method expression of hundreds of different miRNA molecules can be amplified, quantified, and analyzed from the same cDNA template.

정량 실시간 PCR (qPCR)에 의한 전립선 종양에 MicroRNA 감지

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process ...

Pre-clinical Evaluation of Tyrosine Kinase Inhibitors for Treatment of Acute Leukemia

Receptor tyrosine kinases have been implicated in the development and progression of many cancers, including both leukemia and solid tumors, and are attractive druggable therapeutic targets. Here we describe an efficient four-step strategy for pre-clinical evaluation of tyrosine kinase inhibitors (TKIs) in the treatment of acute leukemia. Initially, western blot analysis is used to confirm target inhibition in cultured leukemia cells. Functional activity is then evaluated using clonogenic assays in methylcellulose or soft agar cultures. Experimental compounds that demonstrate activity in cell culture assays are evaluated in vivo using NOD-SCID-gamma (NSG) mice transplanted orthotopically with human leukemia cell lines. Initial in vivo pharmacodynamic studies evaluate target inhibition in leukemic blasts isolated from the bone marrow. This approach is used to determine the dose and schedule of administration required for effective target inhibition. Subsequent studies evaluate the efficacy of the TKIs in vivo using luciferase expressing leukemia cells, thereby allowing for non-invasive bioluminescent monitoring of leukemia burden and assessment of therapeutic response using an in vivo bioluminescence imaging system. This strategy has been effective for evaluation of TKIs in vitro and in vivo and can be applied for identification of molecularly-targeted agents with therapeutic potential or for direct comparison and prioritization of multiple compounds.

Receptor tyrosine kinases are ectopically expressed in many cancers and have been identified as therapeutic targets in acute leukemia. This manuscript describes an efficient strategy for pre-clinical evaluation of tyrosine kinase inhibitors for the treatment of acute leukemia.

급성 백혈병의 치료에 대한 티로신 키나제 억제제의 전임상 평가

Receptor tyrosine kinases have been implicated in the development and progression of many cancers, including both leukemia and solid tumors, and are ...

Murine Cervical Heart Transplantation Model Using a Modified Cuff Technique

Mouse models are of special interest in research since a wide variety of monoclonal antibodies and commercially defined inbred and knockout strains are available to perform mechanistic in vivo studies. While heart transplantation models using a suture technique were first successfully developed in rats, the translation into an equally widespread used murine equivalent was never achieved due the technical complexity of the microsurgical procedure. In contrast, non-suture cuff techniques, also developed initially in rats, were successfully adapted for use in mice1-3. This technique for revascularization involves two major steps I) everting the recipient vessel over a polyethylene cuff; II) pulling the donor vessel over the formerly everted recipient vessel and holding it in place with a circumferential tie. This ensures a continuity of the endothelial layer, short operating time and very high patency rates4.
Using this technique for vascular anastomosis we performed more than 1,000 cervical heart transplants with an overall success rate of 95%. For arterial inflow the common carotid artery and the proximal aortic arch were anastomosed resulting in a retrograde perfusion of the transplanted heart. For venous drainage the pulmonary artery of the graft was anastomosed with the external jugular vein of the recipient5.
Herein, we provide additional details of this technique to supplement the video.

The murine cervical heart transplantation model is well suited for immunological as well as ischemia reperfusion injury studies. We modified the procedure using a non-suture cuff technique and performed more than 1,000 successful transplants with this approach.
Herein, we provide additional details of this technique to supplement the video.

수정 커프 기술을 사용하여 쥐의 자궁 심장 이식 모델

Mouse models are of special interest in research since a wide variety of monoclonal antibodies and commercially defined inbred and knockout strains are ...

A Three-dimensional Tissue Culture Model to Study Primary Human Bone Marrow and its Malignancies

Tissue culture has been an invaluable tool to study many aspects of cell function, from normal development to disease. Conventional cell culture methods rely on the ability of cells either to attach to a solid substratum of a tissue culture dish or to grow in suspension in liquid medium. Multiple immortal cell lines have been created and grown using such approaches, however, these methods frequently fail when primary cells need to be grown ex vivo. Such failure has been attributed to the absence of the appropriate extracellular matrix components of the tissue microenvironment from the standard systems where tissue culture plastic is used as a surface for cell growth. Extracellular matrix is an integral component of the tissue microenvironment and its presence is crucial for the maintenance of physiological functions such as cell polarization, survival, and proliferation. Here we present a 3-dimensional tissue culture method where primary bone marrow cells are grown in extracellular matrix formulated to recapitulate the microenvironment of the human bone (rBM system). Embedded in the extracellular matrix, cells are supplied with nutrients through the medium supplemented with human plasma, thus providing a comprehensive system where cell survival and proliferation can be sustained for up to 30 days while maintaining the cellular composition of the primary tissue. Using the rBM system we have successfully grown primary bone marrow cells from normal donors and patients with amyloidosis, and various hematological malignancies. The rBM system allows for direct, in-matrix real time visualization of the cell behavior and evaluation of preclinical efficacy of novel therapeutics. Moreover, cells can be isolated from the rBM and subsequently used for in vivo transplantation, cell sorting, flow cytometry, and nucleic acid and protein analysis. Taken together, the rBM method provides a reliable system for the growth of primary bone marrow cells under physiological conditions.

In standard culture methods cells are taken out of their physiological environment and grown on the plastic surface of a dish. To study the behavior of primary human bone marrow cells we created a 3-D culture system where cells are grown under conditions recapitulating the native microenvironment of the tissue.

차 사람 골수 및 악성 종양을 연구하는 세 가지 차원 조직 배양 모델

Tissue culture has been an invaluable tool to study many aspects of cell function, from normal development to disease. Conventional cell culture methods ...

Cerebrospinal Fluid MicroRNA Profiling Using Quantitative Real Time PCR

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their translational repression. Changes in miRNA expression have been shown to be involved in the development of all major complex diseases. Furthermore, recent findings showed that miRNAs can be secreted to the extracellular environment and enter the bloodstream and other body fluids where they can circulate with high stability. The function of such circulating miRNAs remains largely elusive, but systematic high throughput approaches, such as miRNA profiling arrays, have lead to the identification of miRNA signatures in several pathological conditions, including neurodegenerative disorders and several types of cancers. In this context, the identification of miRNA expression profile in the cerebrospinal fluid, as reported in our recent study, makes miRNAs attractive candidates for biomarker analysis.
There are several tools available for profiling microRNAs, such as microarrays, quantitative real-time PCR (qPCR), and deep sequencing. Here, we describe a sensitive method to profile microRNAs in cerebrospinal fluids by quantitative real-time PCR. We used the Exiqon microRNA ready-to-use PCR human panels I and II V2.R, which allows detection of 742 unique human microRNAs. We performed the arrays in triplicate runs and we processed and analyzed data using the GenEx Professional 5 software.
Using this protocol, we have successfully profiled microRNAs in various types of cell lines and primary cells, CSF, plasma, and formalin-fixed paraffin-embedded tissues.

We describe a protocol of real time PCR to profile microRNAs in the cerebrospinal fluid (CSF). With the exception of RNA extraction protocols, the procedure can be extended to RNA extracted from other body fluids, cultured cells, or tissue specimens.

정량 실시간 PCR을 사용하여 뇌척수액의 마이크로 RNA 프로파일

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their ...

Murine Corneal Transplantation: A Model to Study the Most Common Form of Solid Organ Transplantation

Corneal transplantation is the most common form of organ transplantation in the United States with between 45,000 and 55,000 procedures performed each year. While several animal models exist for this procedure and mice are the species that is most commonly used. The reasons for using mice are the relative cost of using this species, the existence of many genetically defined strains that allow for the study of immune responses, and the existence of an extensive array of reagents that can be used to further define responses in this species. This model has been used to define factors in the cornea that are responsible for the relative immune privilege status of this tissue that enables corneal allografts to survive acute rejection in the absence of immunosuppressive therapy. It has also been used to define those factors that are most important in rejection of such allografts. Consequently, much of what we know concerning mechanisms of both corneal allograft acceptance and rejection are due to studies using a murine model of corneal transplantation. In addition to describing a model for acute corneal allograft rejection, we also present for the first time a model of late-term corneal allograft rejection.

Mice have been used as a model for studying many forms of transplantation, including corneal transplantation. We describe in this report a murine model for both acute and late-term corneal transplantation.

쥐의 각막 이식 : 고체 장기 이식의 가장 일반적인 형태를 연구하기위한 모델

Corneal transplantation is the most common form of organ transplantation in the United States with between 45,000 and 55,000 procedures performed each ...

Ex Situ Normothermic Machine Perfusion of Donor Livers

In contrast to conventional static cold preservation (0-4 &#176;C), ex situ machine perfusion may provide better preservation of donor livers. Continuous perfusion of organs provides the opportunity to improve organ quality and allows ex situ viability assessment of donor livers prior to transplantation. This video article provides a step by step protocol for ex situ normothermic machine perfusion (37 &#176;C) of human donor livers using a device that provides a pressure and temperature controlled pulsatile perfusion of the hepatic artery and continuous perfusion of the portal vein. The perfusion fluid is oxygenated by two hollow fiber membrane oxygenators and the temperature can be regulated between 10 &#176;C and 37 &#176;C. During perfusion, the metabolic activity of the liver as well as the degree of injury can be assessed by biochemical analysis of samples taken from the perfusion fluid. Machine perfusion is a very promising tool to increase the number of livers that are suitable for transplantation.

Ex Situ Normothermic Machine Perfusion of Donor Livers

Here we present a protocol describing oxygenated ex situ machine perfusion of donor liver grafts. This article contains a step by step protocol to procure and prepare the liver graft for machine perfusion, prepare the perfusion fluid, prime the perfusion machine and perform oxygenated normothermic machine perfusion of the liver graft.

기증자의 간을의 현지 외 정상 체온 기계 관류

In contrast to conventional static cold preservation (0-4 &#176;C), ex situ machine perfusion may provide better preservation of donor livers. Continuous ...

Evaluation of Lung Metastasis in Mouse Mammary Tumor Models by Quantitative Real-time PCR

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated death 1. Common sites of metastatic spread include lung, lymph node, brain, and bone 2. Mechanisms that drive metastasis are intense areas of cancer research. Consequently, effective assays to measure metastatic burden in distant sites of metastasis are instrumental for cancer research. Evaluation of lung metastases in mammary tumor models is generally performed by gross qualitative observation of lung tissue following dissection. Quantitative methods of evaluating metastasis are currently limited to ex vivo and in vivo imaging based techniques that require user defined parameters. Many of these techniques are at the whole organism level rather than the cellular level 3-6. Although newer imaging methods utilizing multi-photon microscopy are able to evaluate metastasis at the cellular level 7, these highly elegant procedures are more suited to evaluating mechanisms of dissemination rather than quantitative assessment of metastatic burden. Here, a simple in vitro method to quantitatively assess metastasis is presented. Using quantitative Real-time PCR (QRT-PCR), tumor cell specific mRNA can be detected within the mouse lung tissue.

This protocol describes how to use quantitative Real-time PCR (QRT-PCR) to detect tumor cell specific mRNA representing metastasis within the mouse lung tissue.

정량 실시간 PCR에 의해 마우스 유방 종양 모델에서 폐 전이의 평가

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated ...

The Generation of Closed Femoral Fractures in Mice: A Model to Study Bone Healing

Bone fractures impose a tremendous socio-economic burden on patients, in addition to significantly affecting their quality of life. Therapeutic strategies that promote efficient bone healing are non-existent and in high demand. Effective and reproducible animal models of fractures healing are needed to understand the complex biological processes associated with bone regeneration. Many animal models of fracture healing have been generated over the years; however, murine fracture models have recently emerged as powerful tools to study bone healing. A variety of open and closed models have been developed, but the closed femoral fracture model stands out as a simple method for generating rapid and reproducible results in a physiologically relevant manner. The goal of this surgical protocol is to generate unilateral closed femoral fractures in mice and facilitate a post-fracture stabilization of the femur by inserting an intramedullary steel rod. Although devices such as a nail or a screw offer greater axial and rotational stability, the use of an intramedullary rod provides a sufficient stabilization for consistent healing outcomes without producing new defects in the bone tissue or damaging nearby soft tissue. Radiographic imaging is used to monitor the progression of callus formation, bony union, and subsequent remodeling of the bony callus. Bone healing outcomes are typically associated with the strength of the healed bone and measured with torsional testing. Still, understanding the early cellular and molecular events associated with fracture repair is critical in the study of bone tissue regeneration. The closed femoral fracture model in mice with intramedullary fixation serves as an attractive platform to study bone fracture healing and evaluate therapeutic strategies to accelerate healing.

The murine closed femoral fracture model is a powerful platform to study fracture healing and novel therapeutic strategies to accelerate bone regeneration. The goal of this surgical protocol is to generate unilateral closed femoral fractures in mice using an intramedullary steel rod to stabilize the femur.

Bone fractures impose a tremendous socio-economic burden on patients, in addition to significantly affecting their quality of life. Therapeutic strategies ...