Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

NOTE: This method was used in the research article reported in Medler, S and Ansari, A.2.
1. Culturing and Harvesting the Cells
<ol>
	<li>Start a 5 mL culture of cells in YPD medium (10 g/L yeast extract, 20 g/L peptone, 2% dextrose) from a freshly streaked Saccharomyces cerevisiae plate.</li>
	<li>Grow the cells overnight in an orbital shaker at 30 &#176;C and 250 rpm.</li>
	<li>Dilute the overnight grown culture 100 times to a final volume of 100 mL in YPD medium in a 250-mL baffled flask. 
	NOTE: A total of 100 mL of culture is needed per TRO reaction; if multiple reactions are needed, a larger volume of culture must be used.</li>
	<li>Grow the cells to an optical density of 0.8 - 1.0 at 600 nm (A600 ~ 0.8 - 1.0).</li>
	<li>Harvest the cells by centrifugation at 820 x g for 5 min at 4 &#176;C in a sterile 50 mL conical tube.</li>
	<li>Resuspend the cells in 10 mL of ice cold TMN buffer (10 mM Tris-HCl pH 7.5, 5 mM MgCl2, 100 mM NaCl) and incubate on ice for 5 min.</li>
	<li>Centrifuge at 820 x g for 5 min at 4 &#176;C to pellet the cells. Gently remove the supernatant by aspiration.</li>
</ol>
2. Permeabilizing and Preparing Cells for Run-on Assay
<ol>
	<li>Resuspend the cells in 1 mL of 0.6% sarkosyl solution by pipetting up and down gently using a truncated P1000 tip. Transfer the cell suspension to a chilled 1.5 mL microcentrifuge tube.</li>
	<li>Shake the cells gently at 4 &#176;C for 25 min on a platform shaker. 
	NOTE: Microcentrifuge tubes should be packed into a 50 mL conical tube with ice to maintain a cold temperature, avoiding the possibility of any new initiation events occurring at the promoter at this stage.</li>
	<li>Centrifuge the cells at 1,200 x g for 6 min at 4 &#176;C using a tabletop refrigerated centrifuge.</li>
	<li>Gently aspirate the supernatant to remove any excess liquid from the permeabilized cell pellet.</li>
</ol>
3. Transcription Run-on Reaction
<ol>
	<li>Add 150 &#181;L of transcription run-on buffer (50 mM Tris-HCl pH 7.5, 100 mM KCl, 10 mM MgCl2, 2 mM DTT (dithiothreitol), 0.75 mM each of ATP, CTP, GTP, and BrUTP, 200 U RNase inhibitor) to the permeabilized cell pellet.</li>
	<li>Mix gently by pipetting up and down using a truncated P200 tip. 
	NOTE: If processing multiple samples, keep everything on ice until all samples are ready and then proceed to the next step.</li>
	<li>Incubate for 5 min at 30 &#176;C in a water bath. 
	NOTE: Adjust the time of incubation between 1 to 5 min to ensure optimal incorporation of BrUTP into the nascent RNA.</li>
	<li>Stop the reaction by adding 500 &#181;L of cold ready-to-use RNA isolation reagent. Incubate for 5 min at room temperature.</li>
</ol>
4. RNA Extraction
<ol>
	<li>Add 200 &#181;L of acid-washed glass beads to the cell suspension (step 3.4), and shake vigorously for 20 min at 4 &#176;C in a vortex mixer.</li>
	<li>Puncture the bottom of the microcentrifuge tube using a hot 22 G needle and place it on the top of a 15-mL sterile conical tube.</li>
	<li>Centrifuge at 300 x g for 1 min at 4 &#176;C to collect the cell lysate. Transfer the cell lysate to a 1.5 mL microcentrifuge tube.</li>
	<li>Add 500 &#181;L of cold RNA isolation reagent and 200 &#181;L of chloroform to the cell lysate. Mix the contents on a vortex mixer and centrifuge at 16,168 x g for 20 min at 4 &#176;C.</li>
	<li>Transfer the upper aqueous phase to a new microcentrifuge tube.</li>
	<li>Add an equal volume of cold phenol/chloroform/isoamyl alcohol (125:24:1) pH 4-5. Shake vigorously on a vortex mixer and centrifuge at 16,168 x g for 15 min at 4 &#176;C.</li>
	<li>Transfer the upper aqueous phase containing RNA to a new microcentrifuge tube. Repeat step 4.6 two more times.</li>
	<li>To the final RNA-containing aqueous phase, add 5 M NaCl stock to get a final concentration of 0.3 M. Add 3 times the volume of cold ethanol to precipitate the RNA.
	<ol>
		<li>Incubate for 1 h or overnight at -20 &#176;C. 
		NOTE: Perform steps 4.9 - 4.11 while the anti-BrdU beads are being incubated for blocking (see step 5.3).</li>
	</ol>
	</li>
	<li>Centrifuge at 16,168 x g for 20 min at 4 &#176;C. Remove the supernatant and resuspend the RNA pellet in 100 &#181;L of DEPC (diethylpyrocarbonate) water.</li>
	<li>Use a RNA isolation mini kit to separate the RNA from the unincorporated BrUTP nucleotides. Elute the RNA from the column with 100 &#181;L of RNase-free water.</li>
	<li>Incubate the RNA in a 65 &#176;C water bath for 5 min and then transfer to ice for at least 2 min.</li>
</ol>
5. Affinity Purification of BrUTP-labeled RNA
<ol>
	<li>To 25 &#181;L of anti-BrdU settled beads, add 500 &#181;L of 0.25x SSPE (Sodium Saline Phosphate EDTA) binding buffer (20x SSPE: 3 M NaCl, 0.2 M NaH2PO4, 0.02 M EDTA, pH 7.4, 1 mM EDTA, 0.05% Tween, 37.5 mM NaCl). Centrifuge at 200 x g for 30 s at 4 &#176;C and remove the supernatant.</li>
	<li>Repeat step 5.1 three times.</li>
	<li>Add 500 &#181;L of blocking buffer (1x binding buffer, 0.1% polyvinylpyrrolidone, 1 mg ultra-pure bovine serum albumin (BSA)) to the beads and shake gently for 1 - 2 h at 4 &#176;C on a platform shaker.</li>
	<li>Wash the beads two more times with 500 &#181;L of binding buffer, as described in step 5.1.</li>
	<li>Add 400 &#181;L of binding buffer to the beads.</li>
	<li>Transfer 100 &#181;L of RNA (from step 4.11) directly to the beads. Incubate with gentle shaking for 1 - 2 h at 4 &#176;C on a platform shaker.</li>
	<li>Wash the beads sequentially with 500 &#181;L of binding buffer, 500 &#181;L of low salt buffer (0.2x SSPE, 1 mM EDTA, 0.05% Tween), 500 &#181;L of high salt buffer (0.25x SSPE, 1 mM EDTA, 0.05% Tween, 100 mM NaCl), and twice with 500 &#181;L of TET buffer (1x TE, 0.05% Tween), spinning at 200 x g for 30 s at 4 &#176;C in between each wash.</li>
	<li>Elute the BrUTP-labeled RNA from beads sequentially, twice with 150 &#181;l and once with 200 &#181;l of elution buffer (20 mM DTT, 150 mM NaCl, 50 mM Tris-HCl pH 7.5, 1 mM EDTA, 0.1% SDS), by incubating for 4 min at 42 &#176;C in a water bath followed by a short spin to separate beads from the supernatant.</li>
</ol>
6. Precipitation of BrUTP Labeled RNA
<ol>
	<li>Add 500 &#181;L of cold phenol/chloroform/isoamyl alcohol (125:24:1) pH 4 - 5 to the affinity purified BrUTP labeled RNA. Mix on a vortex mixer and centrifuge at 16,168 x g for 15 min at 4 &#176;C.</li>
	<li>Transfer the upper aqueous phase to a new microcentrifuge tube.</li>
	<li>Add 5 M NaCl stock to get a final concentration of 0.3 M and 3 times the volume of cold ethanol to precipitate the RNA.</li>
	<li>Incubate at -20 &#176;C overnight.</li>
	<li>Collect the precipitated RNA by centrifugation at 16,168 x g for 30 min at 4 &#176;C.</li>
	<li>Remove the supernatant and allow the pellet to air dry for 10 min.</li>
	<li>Resuspend the RNA pellet in 26 &#181;L of DEPC water.</li>
	<li>Determine the final RNA concentration by measuring the absorbance at 260 nm using a spectrophotometer. Also, determine the 260/280 ratio. A ratio ~2 is indicative of a pure RNA sample.</li>
	<li>Store the RNA samples in aliquots at -80 &#176;C until needed for cDNA synthesis.</li>
</ol>
7. Reverse Transcription of BrUTP-labeled RNA
<ol>
	<li>Adjust the RNA concentration to 100 ng/&#181;L using DEPC water. Use 0.5 &#181;g of RNA for each cDNA synthesis reaction. 
	NOTE: The concentration of RNA template may vary from 0.5 to 1.0 &#181;g to achieve optimal cDNA synthesis.</li>
	<li>Reverse transcribe the RNA using multiple reverse primers designed downstream of the poly(A) site (termination site) as shown in Figure 3A.</li>
	<li>To each reverse transcription reaction, add 5 &#181;l RNA template (0.5 &#181;g), 1 &#181;L dNTP mix (10 mM each), 2 &#181;L of reverse primer C, D, E, F or G (50 &#181;M each) (see Figure 3A) and nuclease free water. The final reaction volume in each tube is 13 &#181;L. 
	NOTE: The number of reverse transcription reactions will depend on the number of reverse primers used for cDNA synthesis. For example, for ASC1 five reverse primers were used and therefore five reverse transcription reactions were set up. Label the tubes as C, D, E, F and G on the basis of the reverse primer used for cDNA synthesis.</li>
	<li>Incubate the tubes containing RNA template, dNTP mix and primers in a thermocycler at 65 &#176;C for 5 min to remove any secondary structural conformation, and then cool to 4 &#176;C for at least 2 min.</li>
	<li>Add 1 &#181;L reverse transcriptase (200 U/&#181;L), 4 &#181;L buffer and 2 &#181;L of 0.1 M DTT to each tube containing the RNA template and primer (step 7.4). Mix by pipetting gently up and down.</li>
	<li>Perform reverse transcription by incubating the reaction mix in a thermocycler at 42 &#176;C for 60 min.</li>
	<li>Inactivate the reverse transcriptase at 65 &#176;C for 20 min.</li>
	<li>Store the cDNA at -20 &#176;C or proceed to the next step.</li>
</ol>
8. Amplification of cDNA
<ol>
	<li>Perform the PCR reaction for amplification of each cDNA preparation (labeled C, D, E, F and G for ASC1) from step 7.8 as follows: 3.0 &#181;L cDNA template from step 7.8, 1.0 &#181;L forward primer B (10 &#181;M), 1.0 &#181;L reverse primer C or D or E or F or G (10 &#181;M), 2.5 &#181;L 10x polymerase PCR buffer, 0.5 &#181;L dNTP mix (10 mM each), 1.0 &#181;L MgCl2 (2.5 mM), 15.5 &#181;L PCR grade water, and 0.5 &#181;L thermostable polymerase enzyme. 
	NOTE: Different dilutions of cDNA template ranging from 1:5 to 1:100 should be tested to optimize the PCR product yield. A single promoter-proximal forward primer will be used to amplify cDNA obtained using different reverse primers. For example, a single forward primer B located near the promoter was used in combination with five reverse primers from C to G for ASC1. B-C, B-D, B-E, B-F and B-G were used in tubes labeled as C, D, E, F and G respectively as shown in Figure 3A.</li>
	<li>Run the PCR using the following thermal cycling parameters: 1 cycle 95 &#176;C for 2 min (hot start for activation of polymerase), 30 - 40 cycles 95 &#176;C for 30 s (denaturation), 54 &#176;C for 15 s (annealing), 68 &#176;C for 1 min (extension), and 1 cycle 68 &#176;C for 5 min (final extension). 
	NOTE: The annealing temperature will vary depending on the specific primers being used and the extension time will vary depending on the expected product size.</li>
	<li>Separate the PCR product by electrophoresis on 0.8%, 1.5%, or 2% agarose gels depending on the expected size of the product.</li>
	<li>Quantify the PCR product as described in El Kaderi et al., 201211. 
	NOTE: Alternatively, use real time RT-qPCR strategy to quantify the amount of nascent transcripts.</li>
</ol>

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The authors have nothing to disclose.

The strand-specific TRO protocol used here was adapted from the protocol used for GRO-Seq (Global Run On-Sequencing) analysis in mammalian cells12. We successfully modified the protocol to study nascent transcription in budding yeast. To specifically analyze the transcription termination defect, we adjusted the protocol further by getting rid of the RNA hydrolysis step. This allowed us to specifically detect the full length nascent transcripts that initiated from the transcription start site near ...

The eukaryotic transcription cycle consists of three major steps; initiation, elongation and termination. The termination of transcription by RNA polymerase II consists of two distinct, interdependent steps3. The first step involves cleavage, polyadenylation and release of mRNA from the template, and is immediately followed by the second step, marked by disengagement of polymerase from the template. Proper termination is crucial for the recycling of the polymerase during initiation/reinitiation of transcription, for preventing interference with the transcription of downstream genes, and for keeping aberrant transcription in check by limiting transcription of pervasive non-coding RNA4,5. Despite recent advances, termination is by far the least understood step of the RNA polymerase II transcription cycle. A reliable termination assay is essential for studying the mechanism underlying termination of transcription by RNA polymerase II in vivo.
A number of experimental approaches are used to detect the termination defect in an actively transcribing gene under physiological conditions. These include Northern blot, termination factor ChIP (Chromatin Immunoprecipitation) and the traditional TRO assay. Each of these techniques have some advantages and disadvantages. The traditional TRO assay used to be the most reliable and sensitive approach for detection of a transcription termination defect in vivo1. This assay localizes the transcriptionally active polymerase molecules on different regions of a gene inside the cell. Under normal conditions, the assay shows transcriptionally engaged polymerase molecules strictly distributed between the promoter and terminator region of the gene (Figure 1A). Upon defective termination, however, the polymerase is unable to read the termination signal and is detected in the region downstream of the 3&#8242; end of the gene (Figure 1B).
A transcription termination defect is manifested in the presence of a sense-transcribing polymerase that initiated from the promoter-proximal region, and being unable to read the termination signal, continues transcribing the region downstream of the 3&#8242; end of a gene as shown in Figure 2A. With the realization that the eukaryotic genome exhibits overwhelming pervasive transcription in sense as well as anti-sense directions in and around a gene 6,7,8,9,10, it soon became clear that the traditional TRO assay cannot detect if the polymerase signal downstream of a gene represents a promoter-initiated transcript (Figure 2A) or an aberrant RNA that initiated somewhere in the middle of the gene or downstream of the terminator element (Figure 2B), or the polymerase transcribing in the anti-sense direction from the 3&#8242; end of the gene (Figure 2C). The strand-specific TRO assay using BrUTP described here can distinguish if the observed readthrough polymerase signal represents promoter-initiated extended sense mRNA or an anti-sense transcript that initiated downstream of the gene under examination. We have successfully used this approach to demonstrate the role of Kin28 kinase in termination of transcription in budding yeast2. Employing the approach here we show that Rna14 is required for termination of transcription of ASC1 in budding yeast.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Phenol -chloroform-isoamyl alcohol mixture</td>
			<td>Sigma-Aldrich</td>
			<td>77619</td>
			<td>pH 4-5</td>
		</tr>
		<tr>
			<td>TRIzol reagent</td>
			<td>Life technologies</td>
			<td>15596-026</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor, human placenta</td>
			<td>New England Biolabs</td>
			<td>M0307S</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-BrdU beads</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323AC</td>
			<td></td>
		</tr>
		<tr>
			<td>Protoscript II</td>
			<td>New England Biolabs</td>
			<td>M03368L</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>Advantage 2 polymerase Mix</td>
			<td>Clontech</td>
			<td>639201</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>5-Bromouridine 5&#39; triphosphate sodium salt</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-214314A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>New England Biolabs</td>
			<td>N0451AA</td>
			<td></td>
		</tr>
		<tr>
			<td>CTP</td>
			<td></td>
			<td>N0454AA</td>
			<td></td>
		</tr>
		<tr>
			<td>GTP</td>
			<td></td>
			<td>N0452AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-pure bovine serum albumin (BSA)</td>
			<td>MC Labs</td>
			<td>UBSA-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Asc1 B</td>
			<td></td>
			<td></td>
			<td>AGATTCGTCGGTCACAAGTCC</td>
		</tr>
		<tr>
			<td>Asc1 C</td>
			<td></td>
			<td></td>
			<td>GAACTTTATACATATTCTTAGTT 
			AGCAGTC</td>
		</tr>
		<tr>
			<td>Asc1 D</td>
			<td></td>
			<td></td>
			<td>TGTACATATGTATTTTCGCAGCA</td>
		</tr>
		<tr>
			<td>Asc1 E</td>
			<td></td>
			<td></td>
			<td>GCCAAGGAGACTGAATTTAATG</td>
		</tr>
		<tr>
			<td>Asc1 F</td>
			<td></td>
			<td></td>
			<td>CTATGGAATGGGGGTTTTAAG</td>
		</tr>
		<tr>
			<td>Asc1 G</td>
			<td></td>
			<td></td>
			<td>GGTTATGGCAGACATGCCAC</td>
		</tr>
		<tr>
			<td>5s cDNA</td>
			<td></td>
			<td></td>
			<td>AGATTGCAGCACCTGAGT</td>
		</tr>
		<tr>
			<td>5&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>GGTTGCGGCCATATCTAC</td>
		</tr>
		<tr>
			<td>3&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>TGAGTTTCGCGTATGGTC</td>
		</tr>
	</tbody>
</table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here is a powerful experimental approach for analyzing the transcription termination defect under physiological conditions. Like the traditional TRO assay, it relies on the presence of a transcriptionally active polymerase beyond the 3&#8242; end of the gene as an indicator of a transcription termination defect1. It overcomes two major problems encountered with the traditional TRO assay. First, it can detect if the polymerase reading through the termination signal is the one that initiated transcription from the promoter-proximal region, or if it is simply representing a pervasively transcribing polymerase that initiated non-specifically from somewhere in the body or the 3&#8242; end of the gene. Secondly, it can distinguish if the transcriptionally active polymerase signal beyond the terminator region is truly the readthrough sense mRNA transcribing polymerase or a terminator-initiated non-coding anti-sense RNA signal. Briefly, the protocol involves permeabilizing the exponentially growing yeast cells, allowing the transcripts that initiated in vivo to elongate in the presence of the BrUTP nucleotide, purifying BrUTP-labelled RNA by the affinity approach, reverse transcribing the purified nascent RNA and amplifying the cDNA using strand-specific primers flanking the promoter and the terminator regions of the gene2.

To demonstrate the applicability of the BrUTP-strand-specific TRO procedure in detecting a transcription termination defect, we used a termination-defective, temperature-sensitive mutant of RNA14 called rna14-1. The role of Rna14 in termination of transcription by RNA polymerase II was demonstrated using the traditional TRO assay that detected RNA in the terminator-proximal region of selected genes1. The detection of RNA signal beyond the terminat...

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

analysis-termination-transcription-using-brutp-strand-specific

Research

JoVE Journal

Genetics

9.8K Views.  Wayne State University. We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes. 

Video: Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

In Vitro Transcription Assays and Their Application in Drug Discovery

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process requires multi-subunit DNA-dependent RNA polymerase (RNAP) and a series of transcription factors that act to modulate the activity of RNAP during gene expression. Sequencing gel electrophoresis of radiolabeled transcripts is used to provide detailed mechanistic information on how transcription proceeds and what parameters can affect it. In this paper we describe the protocol to study how the essential elongation factor NusA regulates transcriptional pausing, as well as a method to identify an antibacterial agent targeting transcription initiation through inhibition of RNAP holoenzyme formation. These methods can be used a as platform for the development of additional approaches to explore the mechanism of action of the transcription factors which still remain unclear, as well as new antibacterial agents targeting transcription which is an underutilized drug target in antibiotic research and development.

In Vitro Transcription Assays and Their Application in Drug Discovery

In this manuscript, we describe a protocol to functionally examine transcription and the inhibitory activity of antibacterial agents targeting bacterial transcription.

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process ...

Metagenomic Analysis of Silage

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of the microbial communities present within them. Two main metagenomic approaches exist; sequencing the 16S rRNA gene coding region, which exhibits sufficient variation between taxa for identification, and shotgun sequencing, in which genomes of the organisms that are present in the sample are analyzed and ascribed to "operational taxonomic units"; species, genera or families depending on the extent of sequencing coverage. 
In this study, shotgun sequencing was used to analyze the microbial community present in cattle silage and, coupled with a range of bioinformatics tools to quality check and filter the DNA sequence reads, perform taxonomic classification of the microbial populations present within the sampled silage, and achieve functional annotation of the sequences. These methods were employed to identify potentially harmful bacteria that existed within the silage, an indication of silage spoilage. If spoiled silage is not remediated, then upon ingestion it could be potentially fatal to the livestock.

Metagenomics was used to investigate the microbiome of silage cattle feed. Analysis was performed by shotgun sequencing. This approach was used to characterize the composition of the microbial community within the cattle feed.

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of ...

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. To assess the impact of PM on nuclear genetic integrity, structural chromosomal aberrations are scored in the metaphase spreads of mouse RAW264.7 macrophage cells. PM is collected from ambient air with a high volume total suspended particles sampler. The collected material is solubilized and filtered to retain the water-soluble, fine portion. The particles are characterized for chemical composition by nuclear magnetic resonance (NMR) spectroscopy. Different concentrations of particle suspension are added onto an in vitro culture of RAW264.7 mouse macrophages for a total exposure time of 72 hr, along with untreated control cells. At the end of exposure, the culture is treated with colcemid to arrest cells in metaphase. Cells are then harvested, treated with hypotonic solution, fixed in acetomethanol, dropped onto glass slides and finally stained with Giemsa solution. Slides are examined to assess the structural chromosomal aberrations (CAs) in metaphase spreads at 1,000X magnification using a bright-field microscope. 50 to 100 metaphase spread are scored for each treatment group. This technique is adapted for the detection of structural chromosomal aberrations (CAs), such as chromatid-type breaks, chromatid-type exchanges, acentric fragments, dicentric and ring chromosomes, double minutes, endoreduplication, and Robertsonian translocations in vitro after exposure to PM. It is a powerful method to associate a well-established cytogenetic endpoint to epigenetic alterations.

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

This protocol describes techniques for the quantification and characterization of chromosomal aberrations in vitro in RAW264.7 mouse macrophages after treatment with ambient air particulate matter.

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. ...

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. Therefore, DNA-protein interactions regulate multiple physiological, pathophysiological, and biological functions, such as cell differentiation, cell proliferation, cell cycle control, chromosome stability, epigenetic gene regulation, and cell transformation. In eukaryotic cells, the DNA interacts with histone and nonhistone proteins and is condensed into chromatin. Several technical tools can be used to analyze DNA-protein interactions, such as the Electrophoresis (gel) Mobility Shift Assay (EMSA) and DNase I footprinting. However, these techniques analyze the protein-DNA interaction in vitro, not within the cellular context. Chromatin immunoprecipitation (ChIP) is a technique that captures proteins at their specific DNA binding sites, thereby allowing for the identification of DNA-protein interactions within their chromatin context. It is done by fixation&#160;of the DNA-protein interaction, followed by&#160;immunoprecipitation of the protein of interest. Subsequently, the genomic site that the protein was bound to is characterized. Here, we describe and discuss ChIP and demonstrate its analytical value for the identification of the Transforming Growth Factor-&#946; (TGF-&#946;)-induced binding of the transcription factor SMAD2 to SMAD Binding Elements (SBE) within the promoter region of the tyrosine-protein kinase Kit (c-KIT) receptor ligand Stem Cell Factor (SCF).

DNA-protein interactions are essential for multiple biological processes. During the evaluation of cellular functions, the analysis of DNA-protein interactions is indispensable for understanding gene regulation. Chromatin immunoprecipitation (ChIP) is a powerful tool to analyze such interactions in vivo.

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to control gene expression. These regulatory proteins control gene expression either at the level of DNA (transcription) or at the level of RNA (pre-mRNA splicing, polyadenylation, mRNA transport, decay, and translation). Identification of regulatory sequences helps understand not only how a gene is switched on or off, but also which downstream genes are regulated by a particular regulatory protein. Here, we describe a one-step approach that allows saturation mutagenesis of a protein binding site in RNA. It involves doping DNA template with non-wild-type nucleotides within the binding site, synthesis of separate RNAs with each phosphorothioate nucleotide, and isolation of the bound fraction following incubation with protein. Interference from non-wild-type nucleotides results in their preferential exclusion from the protein-bound fraction. This is monitored by gel electrophoresis following selective chemical cleavage with iodine of phosphodiester bonds containing phosphorothioates (phosphorothioate mutagenesis or PTM). This single-step saturation mutagenesis approach is applicable to the characterization of any protein binding site in RNA.

Proteins that bind specific RNA sequences play critical roles in gene expression. Detailed characterization of these binding sites is crucial for our understanding of gene regulation. Here, a single-step approach for saturation mutagenesis of protein-binding sites in RNA is described. This approach is relevant for all protein-binding sites in RNA.

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth defects. The goal of this protocol is to quickly detect ZIKV in both human and mosquito samples. The current gold standard for ZIKV detection is quantitative reverse transcription PCR (qRT-PCR); reverse transcription loop-mediated isothermal amplification (RT-LAMP) may allow for a more efficient and low-cost testing without the need for expensive equipment. In this study, RT-LAMP is used for ZIKV detection in various biological samples within 30 min, without first isolating the RNA from the sample. This technique is demonstrated using ZIKV infected patient urine and serum, and infected mosquito samples. 18S ribosomal ribonucleic acid and actin are used as controls in human and mosquito samples, respectively.

Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

This protocol provides an efficient and low-cost method to detect Zika virus or control targets in human urine and serum samples or in mosquitoes by reverse transcription loop-mediated isothermal amplification (RT-LAMP). This method does not require RNA isolation and can be done within 30 min.

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth ...

Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and host cell proteins on viral DNA synthesis. Here we address the lack of a cell-based, high-coverage, and high-resolution assay that is capable of defining retroviral reverse transcription intermediates within the physiological context of virus infection. The described method captures the 3'-termini of nascent complementary DNA (cDNA) molecules within HIV-1 infected cells at single nucleotide resolution. The protocol involves harvesting of whole cell DNA, targeted enrichment of viral DNA via hybrid capture, adaptor ligation, size fractionation by gel purification, PCR amplification, deep sequencing, and data analysis. A key step is the efficient and unbiased ligation of adaptor molecules to open 3'-DNA termini. Application of the described method determines the abundance of reverse transcripts of each particular length in a given sample. It also provides information about the (internal) sequence variation in reverse transcripts and thereby any potential mutations. In general, the assay is suitable for any questions relating to DNA 3'-extension, provided that the template sequence is known.

Here we present a deep sequencing approach that provides an unbiased determination of nascent 3&#39;-termini as well as mutational profiles of single-stranded DNA molecules. The main application is the characterization of nascent retroviral complementary DNAs (cDNAs), the intermediates generated during the process of retroviral reverse transcription.

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and ...

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

In Vitro Transcription Assays and Their Application in Drug Discovery

Metagenomic Analysis of Silage

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells