Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

הערה: שיטה זו שימשה במאמר במחקר דיווחו Medler, S ו- אנסארי, א 2. 1. Culturing ו קציר תאים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> התחל תרבות 5 מ&quot;ל של תאים במדיום YPD (תמצית שמרים 10 גר &#39;/ ל, 20 גר&#39; / ל peptone, 2 דקסטרוז%) מתוך צלחת cerevisiae Saccharomyces טרי מפוספס. </li><li style=";text-align:right;direction:rtl"> לגדל את התאים לילה ב שייקר מסלולית ב 30 ° C ו 250 סל&quot;ד. </li><li style=";text-align:right;direction:rtl"> לדלל את תרבות מבוגר לילה 100 פעמים לנפח סופי של 100 מ&quot;ל במדיום YPD בבקבוק 250 מ&quot;ל מבולבל. הערה: סך של 100 מ&quot;ל של התרבות נדרשת לכל תגובה TRO; אם תגובות מרובות נדרשות, נפח גדול יותר של התרבות חייב לשמש. </li><li style=";text-align:right;direction:rtl"> לגדל את תאי צפיפות אופטית של 0.8 - 1.0 ב 600 ננומטר (600 ~ 0.8 - 1.0). </li><li style=";text-align:right;direction:rtl"> קציר התאים על ידי צנטריפוגה ב 820 XG במשך 5 דקות ב 4 ° C בצינור 50 מ&quot;ל חרוטי סטרילית. </li><li style=";text-align:right;direction:rtl"> Resuspend התאים 10 מ&quot;ל של bu TMN קר קרחffer (10 mM Tris-HCl pH 7.5, 5 מ&quot;מ 2 MgCl, 100 מ&quot;מ NaCl) ו דגירה על קרח למשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה ב 820 XG במשך 5 דקות ב 4 ° C עד גלולת התאים. בעדינות להסיר את supernatant על ידי שאיפה. </li></ol> 2. Permeabilizing תאי הכנות לקראת Run-על Assay <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Resuspend התאים 1 מ&quot;ל של תמיסת 0.6% sarkosyl ידי pipetting למעלה ולמטה בעדינות בעזרת טיפ P 1000 קטום. מעבירים את ההשעיה לתא צינור 1.5 מ&quot;ל microcentrifuge צונן. </li><li style=";text-align:right;direction:rtl"> לנער את התאים בעדינות על 4 מעלות צלזיוס למשך 25 דקות על שייקר פלטפורמה. הערה: צינורות Microcentrifuge צריכים להיות ארוזים לתוך צינור חרוטים 50 מיליליטר עם קרח כדי לשמור על טמפרטורה קרה, הימנעות את האפשרות של כל אירועי ייזום חדשים המתרחשים האמרגן בשלב זה. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה התאים ב 1200 XG במשך 6 דקות ב 4 ° C באמצעות צנטריפוגות בקירור שולחן. </li><li style=";text-align:right;direction:rtl"> בעדינות לשאוב supernatant להסיר את הנוזלים העודפים מן לכלתא גלול meabilized. </li></ol> תגובת 3. תמלול Run-על <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוספת 150 μL של שעתוק ריצה על חיץ (50 mM Tris-HCl pH 7.5, 100 מ&quot;מ KCl, 10 מ&quot;מ MgCl 2, 2 מ&quot;מ DTT (dithiothreitol), 0.75 מ&quot;מ כל אחד ATP, CTP, GTP, ו BrUTP, 200 U RNase מעכב) אל תא גלולה permeabilized. </li><li style=";text-align:right;direction:rtl"> מערבבים בעדינות על ידי pipetting למעלה ולמטה באמצעות קצה P 200 קטום. הערה: אם עיבוד דגימות מרובות, לשמור הכל על קרח עד שכל הדגימות מוכנות ולאחר מכן להמשיך לשלב הבא. </li><li style=";text-align:right;direction:rtl"> דגירה במשך 5 דקות ב 30 מעלות צלזיוס באמבט מים. הערה: כוונן את זמן הדגירה בין 1 ל 5 דקות כדי להבטיח שילוב אופטימלי של BrUTP לתוך RNA המתהווה. </li><li style=";text-align:right;direction:rtl"> עצור את התגובה על ידי הוספת 500 μL של מגיב בידוד RNA קר מוכן לשימוש. דגירה במשך 5 דקות בטמפרטורת החדר. </li></ol> 4. RNA הפקה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוספת 200 μL של חרוזי זכוכית חומצה שטף לתא suspensiעל (שלב 3.4), ולנער במרץ למשך 20 דקות ב 4 ° C במיקסר מערבולת. </li><li style=";text-align:right;direction:rtl"> לנקב את החלק התחתון של הצינור microcentrifuge באמצעות מחט 22 G חם ומניחים אותו על גבי צינור חרוטי סטרילי 15 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה XG ב 300 דקות 1 ב 4 ° C כדי לאסוף את lysate התא. מעבירים את lysate לתא צינור 1.5 מ&quot;ל microcentrifuge. </li><li style=";text-align:right;direction:rtl"> הוספת 500 μL של מגיב בידוד RNA קר 200 μL של כלורופורם אל lysate התא. מערבבים את התוכן על מערבל מערבולת צנטריפוגות ב 16,168 XG במשך 20 דקות ב 4 ° C. </li><li style=";text-align:right;direction:rtl"> מעבירים את השלב מימית העליון לצינור microcentrifuge חדש. </li><li style=";text-align:right;direction:rtl"> הוסף נפח שווה של פנול / כלורופורם קר / isoamyl אלכוהול (125: 24: 1) pH 4-5. לנער במרץ על מערבל מערבולת צנטריפוגות ב 16,168 XG במשך 15 דקות ב 4 ° C.. </li><li style=";text-align:right;direction:rtl"> מעביר את RNA המכיל בשלב מהימי העליון לצינור microcentrifuge חדש. חזור על שלב 4.6 פעמים נוספות. </li><li style=";text-align:right;direction:rtl"> אל השלב מהימי הסופי המכיל RNA, להוסיף 5 M NaCl stock כדי לקבל ריכוז סופי של 0.3 מ &#39;להוסיף 3 פעמים את הנפח של אתנול קר לזרז את הרנ&quot;א. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> דגירה של 1 ש &#39;או לילה ב -20 ° C. הערה: בצע את שלבי 4.9 - 4.11 בעוד החרוזים אנטי BrdU שמתבצעים וטופחו לחסימה (ראה שלב 5.3). </li></ol></li><li style=";text-align:right;direction:rtl"> צנטריפוגה ב 16,168 XG במשך 20 דקות ב 4 °. הסר את supernatant ו resuspend גלולה רנ&quot;א 100 μL של מים DEPC (diethylpyrocarbonate). </li><li style=";text-align:right;direction:rtl"> השתמש ערכת מיני בידוד RNA להפריד בין RNA מן נוקלאוטידים BrUTP מאוגדים. Elute רנ&quot;א מהעמודה עם 100 μL של מים RNase חינם. </li><li style=";text-align:right;direction:rtl"> דגירה RNA באמבט מים C ° 65 במשך 5 דקות ולאחר מכן להעביר קרח דק 2 לפחות. </li></ol> טיהור זיקה 5. RNA BrUTP שכותרתו <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כדי 25 μL של אנטי BrdU התיישבו חרוזים, להוסיף 500 μL של 0.25x SSPE (נתרן מלוחים פוספט EDTA) במאגר מחייב (20x SSPE: 3 M NaCl, 0.2 M לאא 2 PO 4 </sub&gt;, 0.02 M EDTA, pH 7.4, 1 mM EDTA, 0.05% Tween, 37.5 מ&quot;מ NaCl). צנטריפוגה ב XG 200 עבור 30 s ב 4 ° C ולהסיר את supernatant. </li><li style=";text-align:right;direction:rtl"> חזור על שלב 5.1 שלוש פעמים. </li><li style=";text-align:right;direction:rtl"> הוספת 500 μL של חיץ חסימת (1x חיץ מחייב, 0.1% polyvinylpyrrolidone, 1 מ&quot;ג אלבומין אולטרה-טהור שור (BSA)) על חרוזים ולנער בעדינות במשך 1 - 2 שעות ב 4 ° C על שייקר פלטפורמה. </li><li style=";text-align:right;direction:rtl"> שטפו את החרוזים פעמיים נוספות עם 500 μL של חיץ מחייב, כפי שמתואר בשלב 5.1. </li><li style=";text-align:right;direction:rtl"> להוסיף 400 μL של חיץ מחייב את החרוזים. </li><li style=";text-align:right;direction:rtl"> העברת 100 μL של RNA (משלב 4.11) ישירות חרוזים. דגירה עם רעד עדין במשך 1 - 2 שעות ב 4 ° C על שייקר פלטפורמה. </li><li style=";text-align:right;direction:rtl"> שטוף את ברצף החרוזים עם 500 μL של חיץ מחייב, 500 μL של חיץ מלח נמוך (SSPE 0.2X, 1 mM EDTA, 0.05% Tween), 500 μL של חיץ מלח גבוה (0.25x SSPE, 1 mM EDTA, 0.05% Tween, 100 מ&quot;מ NaCl), ופעמיים עם 500 μL של חיץ TET (1x TE, 0.05% Tween), מסתובב בביתXG 200 למשך 30 שניות ב 4 מעלות צלזיוס בין כל שטיפה. </li><li style=";text-align:right;direction:rtl"> Elute רנ&quot;א BrUTP שכותרתו אמנות עשויים חרוזים ברצף, פעמיים עם 150 μl ופעם עם 200 μl של חיץ elution (20 מ&quot;מ DTT, 150 מ&quot;מ NaCl, 50 mM Tris-HCl 7.5 pH, 1 mM EDTA, 0.1% SDS), על ידי דוגרים עבור 4 דקות ב 42 מעלות צלזיוס באמבט מים ואחריו סיבוב קצר להפריד חרוזים מן supernatant. </li></ol> רטיבות 6. RNA שכותרתו BrUTP <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוספת 500 μL של פנול / כלורופורם קר / isoamyl אלכוהול (125: 24: 1) pH 4 - 5 עד הזיקה המטוהרת BrUTP שכותרתו RNA. מערבבים על מערבל מערבולת צנטריפוגות ב 16,168 XG במשך 15 דקות ב 4 ° C. </li><li style=";text-align:right;direction:rtl"> מעבירים את השלב מימית העליון לצינור microcentrifuge חדש. </li><li style=";text-align:right;direction:rtl"> הוסף 5 מניות M NaCl כדי לקבל ריכוז סופי של פעמים 0.3 M ו -3 היקף אתנול קר לזרז את הרנ&quot;א. </li><li style=";text-align:right;direction:rtl"> לדגור לילה -20 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> אסוף את הרנ&quot;א זירז ידי צנטריפוגה ב 16,168 XG במשך 30 דקות ב 4 ° C. &lt;/ Li&gt; <li style=";text-align:right;direction:rtl"> הסר את supernatant ולאפשר גלולה לייבוש באוויר במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> Resuspend גלולה רנ&quot;א 26 μL של מים DEPC. </li><li style=";text-align:right;direction:rtl"> קבע את ריכוז RNA הסופי על ידי מדידת הספיגה ב 260 ננומטר באמצעות ספקטרופוטומטר. כמו כן, קבע את היחס 260/280. יחס ~ 2 מעיד על מדגם RNA טהור. </li><li style=";text-align:right;direction:rtl"> אחסן את דגימות רנ&quot;א aliquots ב -80 ° C עד הצורך לסינתזה cDNA. </li></ol> 7. שעתוק לאחור של רנ&quot;א שכותרתו BrUTP <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> התאם את הריכוז RNA ל 100 ng / μL באמצעות מים DEPC. השתמש 0.5 מיקרוגרם של רנ&quot;א עבור כל תגובה סינתזה cDNA. הערה: ריכוז תבנית RNA עשוי לנוע בין 0.5 ל 1.0 מיקרוגרם להשיג סינתזת cDNA אופטימלית. </li><li style=";text-align:right;direction:rtl"> הפוך לתמלל את RNA באמצעות פריימרים הפוכים מרובים שנועדו במורד זרם של (אתר הסיום) פולי (א) אתר כפי שמוצג באיור 3 א. </li><li style=";text-align:right;direction:rtl"> לתגובה כל שעתוק לאחור, להוסיף 5 μl RNA templatדואר (0.5 מיקרוגרם), 1 μL תמהיל dNTP (10 מ&quot;מ כל אחד), 2 μL של C פריימר הפוכה, D, E, F או G (50 מיקרומטר אחד) (ראה איור 3 א) ומים חינם nuclease. היקף התגובה האחרון בצינור אחד הוא 13 μL. הערה: מספר התגובות שעתוק לאחור יהיה תלוי במספר פריימרים הפוך המשמש לסינתזת cDNA. לדוגמא, עבור ASC1 חמישה פריימרים הפוכים שמשו ולכן חמש תגובות שעתוק לאחור הוקמו. לייבל הצינורות כמו C, D, E, F ו- G על בסיס של פריימר הפוכה המשמש לסינתזת cDNA. </li><li style=";text-align:right;direction:rtl"> דגירת הצינורות המכילים תבנית RNA, תמהיל dNTP ו פריימרים ב thermocycler על 65 מעלות צלזיוס למשך 5 דקות כדי להסיר כל קונפורמציה מבני משני, ולאחר מכן לצנן עד 4 מעלות צלזיוס למשך 2 דקות לפחות. </li><li style=";text-align:right;direction:rtl"> הוסף 1 μL הפוכה transcriptase (200 U / μL), 4 μL חיץ 2 μL של 0.1 M DTT צינור אחד המכיל את תבנית רנ&quot;א פריימר (שלב 7.4). מערבבים על ידי pipetting בעדינות מעלה ומטה. </li><li style=";text-align:right;direction:rtl"> בצע שעתוק לאחור על ידי דוגר את תערובת התגובה ב thermocycler על 42 מעלות צלזיוס למשך 60 דקות. </li><li style=";text-align:right;direction:rtl"> להשבית transcriptase הפוכה על 65 מעלות צלזיוס למשך 20 דקות. </li><li style=";text-align:right;direction:rtl"> אחסן את cDNA ב -20 ° C או להמשיך לשלב הבא. </li></ol> הגברת 8. של cDNA <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בצע את תגובת PCR עבור הגברה של כל הכנה cDNA (שכותרתו C, D, E, F ו- G עבור ASC1) משלב 7.8 כדלקמן: 3.0 תבנית cDNA μL משלב 7.8, 1.0 B פריימר קדימה μL (10 מיקרומטר), 1.0 מיקרוליטר C פריימר הפוכה או D או E או F או G (10 מיקרומטר), 2.5 μL 10x פולימראז חיץ PCR, 0.5 μL תמהיל dNTP (10 מ&quot;מ כל אחד), 1.0 מיקרוליטר MgCl 2 (2.5 מ&quot;מ), 15.5 מים כיתה μL PCR, ו -0.5 אנזים פולימראז thermostable μL. הערה: דילולים שונים של תבנית cDNA הנעה בין 1: 5 ל -1: 100 צריכים להיבדק כדי לייעל את תשואת מוצר PCR. פריימר קדימה יחיד האמרגן-הפרוקסימלי ישמש כדי להגביר cDNAשהושג באמצעות פריימרים הפוך שונה. לדוגמא, ב פריימר קדימה יחיד הממוקם ליד האמרגן שמש בשילוב עם חמישה פריימרים הפוכים מ C ל G טוב ASC1. BC, BD, BE, BF ו BG שימשו צינורות שכותרתו כמו C, D, E, F ו- G בהתאמה כמוצג באיור 3 א. </li><li style=";text-align:right;direction:rtl"> הפעל את ה- PCR באמצעות פרמטרי רכיבת התרמית הבאות: 1 מחזור 95 מעלות צלזיוס למשך 2 דקות (להתחיל חם עבור הפעלה של פולימראז), 30 - 40 מחזורים 95 מעלות צלזיוס למשך 30 שניות (denaturation), 54 מעלות צלזיוס למשך 15 שניות (חישול) , 68 מעלות צלזיוס במשך דקות 1 (הארכה), מחזור 1 68 מעלות צלזיוס למשך 5 דקות (הארכה הסופית). הערה: טמפרטורת החישול תשתנה בהתאם פריימרים הספציפיים בשימוש והזמן הרחב ישתנה בהתאם לגודל התוצר הצפוי. </li><li style=";text-align:right;direction:rtl"> הפרד את מוצר ה- PCR על ידי אלקטרופורזה על 0.8%, 1.5%, או 2 ג&#39;לים agarose% בהתאם לגודל הצפוי של המוצר. </li><li style=";text-align:right;direction:rtl"> לכמת את מוצר ה- PCR, כמתואר El Kaderi et al. , 2012 11. הערה: לחילופין, להשתמש בזמן אמת אסטרטגיה RT-qPCR כדי לכמת את כמות תמלילי המתהווה. </li></ol>

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The authors have nothing to disclose.

פרוטוקול TRO ספציפי הגדיל משמש כאן הותאם מן הפרוטוקול המשמש GRO-Seq (Global לרוץ על-רצף) ניתוח בתאי יונקים 12. אנחנו בהצלחה שונה בפרוטוקול ללמוד שעתוק המתהווה ב ניצני שמרים. כדי לנתח את פגם סיום שעתוק במיוחד, מתאמנים את הפרוטוקול נוסף על ידי להיפטר צעד הידרוליזה RNA...

מחזור שעתוק איקריוטיים מורכב משלושה שלבים עיקריים; ייזום, התארכות והפסקה. סיומו של שעתוק על ידי RNA פולימראז II מורכב משני שלבים ברורים, תלויים זה בזה 3. השלב הראשון כולל מחשוף, polyadenylation ושחרור mRNA מהתבנית, והוא ומיד אחריו את השלב השני, בסימן ההתנתקות של פולימראז מהתבנית. סיום נכון הוא קריטי עבור המחזור של פולימראז במהלך חניכה / reinitiation של שעתוק, למניעת הפרעה עם השעתוק של גנים במורד זרם, ולשמירתו שעתוק סוטה לבדוק על ידי הגבלת השעתוק של מתפשט ללא קידוד RNA 4, 5. למרות ההתקדמות שחלה באחרונה, סיום הוא ללא ספק צעד הבין לפחות של מחזור שעתוק RNA פולימראז II. Assay סיום אמין חיוני ללימוד מנגנון underlyinסיום שעתוק g ידי RNA פולימראז II in vivo. מספר גישות ניסיוניות המשמשים לאיתור פגם הסיום ב גן transcribing פעיל בתנאים פיסיולוגיים. אלה כוללים כתם הצפון, שבב גורם סיום (הכרומטין immunoprecipitation) ואת assay TRO המסורתית. כל הטכניקות האלה יש כמה יתרונות וחסרונות. את assay TRO המסורתי היה אמור להיות הגישה האמינה והרגישה ביותר לגילוי פגם סיום שעתוק vivo 1. assay זה localizes מולקולות פולימראז הפעילות יעתיק על אזורים שונים של גן בתוך התא. בתנאים רגילים, assay תערוכות מולקולות פולימראז מעורב תעתיק מופץ אך ורק בין אזור האמרגן terminator של (איור 1 א) הגן. עם הסיום פגום, לעומת זאת, פולימראז הוא לא יודע לקרוא את אות הסיוםוהוא זוהה באזור במורד הזרם של 3 &#39;בסוף של הגן (איור 1B). פגם סיום שעתוק מתבטא בנוכחות פולימראז חוש-בהעתקה שיזמה מאזור האמרגן-הפרוקסימלי, ולהיות מסוגל לקרוא את אות הסיום, ממשיך transcribing באזור במורד הזרם של סוף &#39;3 של גן כפי שמוצג באיור 2A. עם ההכרה כי הגנום האיקריוטים מפגין שעתוק מתפשט המכריע במובן וכן כיוונים אנטי תחושה בתוך ומסביב גן 6, 7, 8, 9, 10, עד מהרה התברר כי assay TRO המסורתי אינו יכול לזהות אם האות פולימראז במורד הזרם של גן מייצג תעתיק ביוזמת האמרגן (איור 2 א) או RNA סוטה שיזמה סוםewhere באמצע הגן או במורד הזרם של אלמנט terminator (איור 2 ב), או בהעתקת פולימראז בכיוון אנטי תחושה מסוף &#39;3 של הגן (איור 2 ג). את assay TRO ספציפי גדיל באמצעות BrUTP המתואר כאן ניתן להבחין אם האות פולימראז readthrough ציין מייצג mRNA במשמעות הרחבה ביוזמת האמרגן או תמליל אנטי במובן זה יזם במורד הזרם של הגן תחת בחינה. השתמשנו בהצלחה את הגישה הזאת כדי להדגים את התפקיד של קינאז Kin28 לסיום שעתוק ניצני שמרים 2. תוך שימוש בגישה כאן אנו מראים כי Rna14 נדרשת להפסקת השעתוק של ASC1 ב ניצני שמרים.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Phenol -chloroform-isoamyl alcohol mixture</td>
			<td>Sigma-Aldrich</td>
			<td>77619</td>
			<td>pH 4-5</td>
		</tr>
		<tr>
			<td>TRIzol reagent</td>
			<td>Life technologies</td>
			<td>15596-026</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor, human placenta</td>
			<td>New England Biolabs</td>
			<td>M0307S</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-BrdU beads</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323AC</td>
			<td></td>
		</tr>
		<tr>
			<td>Protoscript II</td>
			<td>New England Biolabs</td>
			<td>M03368L</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>Advantage 2 polymerase Mix</td>
			<td>Clontech</td>
			<td>639201</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>5-Bromouridine 5&#39; triphosphate sodium salt</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-214314A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>New England Biolabs</td>
			<td>N0451AA</td>
			<td></td>
		</tr>
		<tr>
			<td>CTP</td>
			<td></td>
			<td>N0454AA</td>
			<td></td>
		</tr>
		<tr>
			<td>GTP</td>
			<td></td>
			<td>N0452AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-pure bovine serum albumin (BSA)</td>
			<td>MC Labs</td>
			<td>UBSA-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Asc1 B</td>
			<td></td>
			<td></td>
			<td>AGATTCGTCGGTCACAAGTCC</td>
		</tr>
		<tr>
			<td>Asc1 C</td>
			<td></td>
			<td></td>
			<td>GAACTTTATACATATTCTTAGTT 
			AGCAGTC</td>
		</tr>
		<tr>
			<td>Asc1 D</td>
			<td></td>
			<td></td>
			<td>TGTACATATGTATTTTCGCAGCA</td>
		</tr>
		<tr>
			<td>Asc1 E</td>
			<td></td>
			<td></td>
			<td>GCCAAGGAGACTGAATTTAATG</td>
		</tr>
		<tr>
			<td>Asc1 F</td>
			<td></td>
			<td></td>
			<td>CTATGGAATGGGGGTTTTAAG</td>
		</tr>
		<tr>
			<td>Asc1 G</td>
			<td></td>
			<td></td>
			<td>GGTTATGGCAGACATGCCAC</td>
		</tr>
		<tr>
			<td>5s cDNA</td>
			<td></td>
			<td></td>
			<td>AGATTGCAGCACCTGAGT</td>
		</tr>
		<tr>
			<td>5&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>GGTTGCGGCCATATCTAC</td>
		</tr>
		<tr>
			<td>3&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>TGAGTTTCGCGTATGGTC</td>
		</tr>
	</tbody>
</table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

כתב יד זה מתאר פרוטוקול לאיתור פגם סיום שעתוק in vivo. פרוטוקול TRO ספציפי הגדיל באמצעות BrUTP המתואר כאן הוא גישה ניסויית עצמה לניתוח פגם סיום שעתוק בתנאים פיסיולוגיים. כמו assay TRO המסורתי, היא מסתמכת על הנוכחות של פולימראז תעתיק פעיל מעבר סוף &#39;3 של גן כאינדיקטור פגם סיום שעתוק 1. זה מתגבר שתי בעיות עיקריות נתקלו עם assay TRO המסורתי. ראשית, הוא יכול לזהות אם פולימראז שקרא את אות הסיום הוא זה שיזם שעתוק מאזור האמרגן-הפרוקסימלי, או אם זה פשוט מייצג פולימראז transcribing pervasively שיזם הלא במיוחד מאיפשהו בגוף או &#39;3 סוף הגן. שנית, הוא יכול להבחין אם אות פולימראז הפעילה תעתיק מעברבאזור terminator הוא באמת mRNA תחושה readthrough transcribing פולימראז או אות רנ&quot;א אנטי במובן הלא קידוד terminator ביוזמת. בקצרה, פרוטוקול כרוך permeabilizing התאים שמרים גדל באופן אקספוננציאלי, מה שמאפשר את תמלילי כי יזם in vivo כדי להאריך בנוכחות של נוקלאוטיד BrUTP, טיהור RNA שכותרתו BrUTP לפי הגישה זיקה, הפוכה טרח להכין את RNA המתהווה מטוהרים הגברה cDNA באמצעות פריימרים גדיל ספציפי איגוף האמרגן ואת אזורי terminator של הגן 2.

כדי להדגים את תחולת הנוהל TRO BrUTP גדיל ספציפי באיתור מום סיום שעתוק, השתמשנו מוטציה סיום-פגום, רגיש בטמפרטורה של RNA14 שנקרא rna14-1. תפקידו של Rna14 לסיום שעתוק על ידי RNA פולימראז II הודגם באמצעות assay TRO המסורתי שמזוהה RNA באזור terminator-הפרוקסימלי של גנים ?...

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

ניתוח של הפסקת תמלול שימוש BrUTP גדיל ספציפי התמלול Run-על (TRO) גישה

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

analysis-termination-transcription-using-brutp-strand-specific

Research

JoVE Journal

Genetics

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

9.8K Views.  Wayne State University. We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes. 

Video: Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

In Vitro Transcription Assays and Their Application in Drug Discovery

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process requires multi-subunit DNA-dependent RNA polymerase (RNAP) and a series of transcription factors that act to modulate the activity of RNAP during gene expression. Sequencing gel electrophoresis of radiolabeled transcripts is used to provide detailed mechanistic information on how transcription proceeds and what parameters can affect it. In this paper we describe the protocol to study how the essential elongation factor NusA regulates transcriptional pausing, as well as a method to identify an antibacterial agent targeting transcription initiation through inhibition of RNAP holoenzyme formation. These methods can be used a as platform for the development of additional approaches to explore the mechanism of action of the transcription factors which still remain unclear, as well as new antibacterial agents targeting transcription which is an underutilized drug target in antibiotic research and development.

In Vitro Transcription Assays and Their Application in Drug Discovery

In this manuscript, we describe a protocol to functionally examine transcription and the inhibitory activity of antibacterial agents targeting bacterial transcription.

במבחנת תמלול מבחנים ויישומם ותרופות דיסקברי

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process ...

Metagenomic Analysis of Silage

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of the microbial communities present within them. Two main metagenomic approaches exist; sequencing the 16S rRNA gene coding region, which exhibits sufficient variation between taxa for identification, and shotgun sequencing, in which genomes of the organisms that are present in the sample are analyzed and ascribed to "operational taxonomic units"; species, genera or families depending on the extent of sequencing coverage. 
In this study, shotgun sequencing was used to analyze the microbial community present in cattle silage and, coupled with a range of bioinformatics tools to quality check and filter the DNA sequence reads, perform taxonomic classification of the microbial populations present within the sampled silage, and achieve functional annotation of the sequences. These methods were employed to identify potentially harmful bacteria that existed within the silage, an indication of silage spoilage. If spoiled silage is not remediated, then upon ingestion it could be potentially fatal to the livestock.

Metagenomics was used to investigate the microbiome of silage cattle feed. Analysis was performed by shotgun sequencing. This approach was used to characterize the composition of the microbial community within the cattle feed.

Metagenomic ניתוח של תחמיץ

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of ...

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. To assess the impact of PM on nuclear genetic integrity, structural chromosomal aberrations are scored in the metaphase spreads of mouse RAW264.7 macrophage cells. PM is collected from ambient air with a high volume total suspended particles sampler. The collected material is solubilized and filtered to retain the water-soluble, fine portion. The particles are characterized for chemical composition by nuclear magnetic resonance (NMR) spectroscopy. Different concentrations of particle suspension are added onto an in vitro culture of RAW264.7 mouse macrophages for a total exposure time of 72 hr, along with untreated control cells. At the end of exposure, the culture is treated with colcemid to arrest cells in metaphase. Cells are then harvested, treated with hypotonic solution, fixed in acetomethanol, dropped onto glass slides and finally stained with Giemsa solution. Slides are examined to assess the structural chromosomal aberrations (CAs) in metaphase spreads at 1,000X magnification using a bright-field microscope. 50 to 100 metaphase spread are scored for each treatment group. This technique is adapted for the detection of structural chromosomal aberrations (CAs), such as chromatid-type breaks, chromatid-type exchanges, acentric fragments, dicentric and ring chromosomes, double minutes, endoreduplication, and Robertsonian translocations in vitro after exposure to PM. It is a powerful method to associate a well-established cytogenetic endpoint to epigenetic alterations.

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

This protocol describes techniques for the quantification and characterization of chromosomal aberrations in vitro in RAW264.7 mouse macrophages after treatment with ambient air particulate matter.

ניתוח של סטיות כרומוזומליות Matter הנגרמת חלקיקי אמביינט שימוש<em&gt; במבחנה</em&gt; מערכת

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. ...

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. Therefore, DNA-protein interactions regulate multiple physiological, pathophysiological, and biological functions, such as cell differentiation, cell proliferation, cell cycle control, chromosome stability, epigenetic gene regulation, and cell transformation. In eukaryotic cells, the DNA interacts with histone and nonhistone proteins and is condensed into chromatin. Several technical tools can be used to analyze DNA-protein interactions, such as the Electrophoresis (gel) Mobility Shift Assay (EMSA) and DNase I footprinting. However, these techniques analyze the protein-DNA interaction in vitro, not within the cellular context. Chromatin immunoprecipitation (ChIP) is a technique that captures proteins at their specific DNA binding sites, thereby allowing for the identification of DNA-protein interactions within their chromatin context. It is done by fixation&#160;of the DNA-protein interaction, followed by&#160;immunoprecipitation of the protein of interest. Subsequently, the genomic site that the protein was bound to is characterized. Here, we describe and discuss ChIP and demonstrate its analytical value for the identification of the Transforming Growth Factor-&#946; (TGF-&#946;)-induced binding of the transcription factor SMAD2 to SMAD Binding Elements (SBE) within the promoter region of the tyrosine-protein kinase Kit (c-KIT) receptor ligand Stem Cell Factor (SCF).

DNA-protein interactions are essential for multiple biological processes. During the evaluation of cellular functions, the analysis of DNA-protein interactions is indispensable for understanding gene regulation. Chromatin immunoprecipitation (ChIP) is a powerful tool to analyze such interactions in vivo.

ניתוח של C-KIT ליגנד האמרגן באמצעות Immunoprecipitation הכרומטין

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

קביעת Location(s) כרומוזומלית האופטימלית עבור רכיב ה-DNA ב- Escherichia coli באמצעות גישה מוזרה בתיווך Transposon

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

ניתוח בזמן אמת של גורם שעתוק כריכה, תמלול, תרגום, מחזור ולהציג אירועים גלובליים במהלך ההפעלה הסלולרית

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

מעקב ברמת הגנום של שגיאות תיעתוק היצורים האיקריוטים

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to control gene expression. These regulatory proteins control gene expression either at the level of DNA (transcription) or at the level of RNA (pre-mRNA splicing, polyadenylation, mRNA transport, decay, and translation). Identification of regulatory sequences helps understand not only how a gene is switched on or off, but also which downstream genes are regulated by a particular regulatory protein. Here, we describe a one-step approach that allows saturation mutagenesis of a protein binding site in RNA. It involves doping DNA template with non-wild-type nucleotides within the binding site, synthesis of separate RNAs with each phosphorothioate nucleotide, and isolation of the bound fraction following incubation with protein. Interference from non-wild-type nucleotides results in their preferential exclusion from the protein-bound fraction. This is monitored by gel electrophoresis following selective chemical cleavage with iodine of phosphodiester bonds containing phosphorothioates (phosphorothioate mutagenesis or PTM). This single-step saturation mutagenesis approach is applicable to the characterization of any protein binding site in RNA.

Proteins that bind specific RNA sequences play critical roles in gene expression. Detailed characterization of these binding sites is crucial for our understanding of gene regulation. Here, a single-step approach for saturation mutagenesis of protein-binding sites in RNA is described. This approach is relevant for all protein-binding sites in RNA.

בגישה מוטגנזה מכוונת רוויה הרומן: אפיון צעד בודד של חלבון תקינה מחייב אתרים ב- RNA באמצעות Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth defects. The goal of this protocol is to quickly detect ZIKV in both human and mosquito samples. The current gold standard for ZIKV detection is quantitative reverse transcription PCR (qRT-PCR); reverse transcription loop-mediated isothermal amplification (RT-LAMP) may allow for a more efficient and low-cost testing without the need for expensive equipment. In this study, RT-LAMP is used for ZIKV detection in various biological samples within 30 min, without first isolating the RNA from the sample. This technique is demonstrated using ZIKV infected patient urine and serum, and infected mosquito samples. 18S ribosomal ribonucleic acid and actin are used as controls in human and mosquito samples, respectively.

Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

This protocol provides an efficient and low-cost method to detect Zika virus or control targets in human urine and serum samples or in mosquitoes by reverse transcription loop-mediated isothermal amplification (RT-LAMP). This method does not require RNA isolation and can be done within 30 min.

הפוך שעתוק לולאה-בתיווך איזותרמי הגברה (RT-המנורה) Assay Zika וירוס, ניקיון בגנים שתן, סרום, ודוגמאות יתוש

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth ...

Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and host cell proteins on viral DNA synthesis. Here we address the lack of a cell-based, high-coverage, and high-resolution assay that is capable of defining retroviral reverse transcription intermediates within the physiological context of virus infection. The described method captures the 3'-termini of nascent complementary DNA (cDNA) molecules within HIV-1 infected cells at single nucleotide resolution. The protocol involves harvesting of whole cell DNA, targeted enrichment of viral DNA via hybrid capture, adaptor ligation, size fractionation by gel purification, PCR amplification, deep sequencing, and data analysis. A key step is the efficient and unbiased ligation of adaptor molecules to open 3'-DNA termini. Application of the described method determines the abundance of reverse transcripts of each particular length in a given sample. It also provides information about the (internal) sequence variation in reverse transcripts and thereby any potential mutations. In general, the assay is suitable for any questions relating to DNA 3'-extension, provided that the template sequence is known.

Here we present a deep sequencing approach that provides an unbiased determination of nascent 3&#39;-termini as well as mutational profiles of single-stranded DNA molecules. The main application is the characterization of nascent retroviral complementary DNAs (cDNAs), the intermediates generated during the process of retroviral reverse transcription.

3'-Termini הקובע ורצפים של מולקולות Nascent חד גדילי ה-DNA הנגיפי במהלך HIV-1 הפוך שעתוק בתאים נגועים

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and ...