A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
We describe a strategy for how to use RNA samples from unreferenced Pacific oyster specimens, and evaluate the genetic material by comparison with publicly available genome data to generate a virtually sequenced cDNA library.
The access to biological material of reference species, which were used previously in key experiments such as in the development of novel cell lines or genome sequencing projects, are often difficult to provide for further studies or third parties due to the consumptive nature of the samples. Although now widely distributed over the Pacific coasts of Asia, Australia and North America, individual Pacific oyster specimens are genetically quite diverse and are therefore not directly suitable as the starting material for gene libraries. In this article, we demonstrate the use of unreferenced Pacific oyster specimens obtained from regional seafood markets to generate cDNA libraries. These libraries were then compared to the publicly available oyster genome, and the closest related library was selected using the mitochondrial reference genes Cytochrome C Oxidase subunit I (COX1) and NADH Dehydrogenase (ND). The suitability of the generated cDNA library is also demonstrated by cloning and expression of two genes encoding the enzymes UDP-glucuronic acid dehydrogenase (UGD) and UDP-xylose synthase (UXS), which are responsible for the biosynthesis of UDP-xylose from UDP-glucose.
The acquisition of living referenced biological material may be challenging due to long delivery times, entrepreneurial reasoning, or country-specific customs regulations. As an alternative, the required biological material may be also collected from phenotypically identical specimens. However, these samples may vary significantly at the level of genotype, and therefore comparisons with digitally-stored reference genomes of the same species are often rendered difficult or even futile due to incompatibility of the newly-sourced material with existing DNA amplification methods. Sequencing highly conserved genes of individual samples is a widely used and powerful tool for identifying species1, such as conserved mitochondrial genes that are frequently used as reference genes for the quality assessment of cDNA libraries2,3,4,5,6. The underlying rationale for the herein presented method is that high conservation of mitochondrial gene sequences in individual anonymous oyster samples compared to the corresponding sequences of the reference genome indicates that other genes may also show a low level of divergence, given the generally faster rate of mitochondrial DNA evolution relative to nuclear DNA7, allowing the amplification and isolation of a wide range of scientifically and industrially relevant genes by simply using publicly available sequencing data as a reference.
The overall goal of the herein described method is to present an optimized workflow for generating a virtually sequenced oyster cDNA library which can be used as template DNA for the cloning of oyster genes. In virtual sequencing, de novo genome sequencing is circumvented; instead, a known, digitally-stored reference sequence is used directly to utilize or design primers for production of cDNAs that will eventually comprise a library (or be added to a pre-existing one). The aim is to produce a convergent cDNA library, meaning that similarities between the generated cDNA sequences and the reference sequence can be ranked from low to high divergence. A key advantage of using Cytochrome C Oxidase subunit 1 (COX1) and NADH Dehydrogenase (ND) as reference genes is that even highly geographically disjunct oyster specimens can be profiled due to the high conservation of these mitochondrial genes. Having proven the approach with these well-established markers, we then demonstrate its application to two enzyme candidates which are involved in sugar nucleotide biosynthesis and may be of industrial relevance8,9,10. The biotechnological potential of the Pacific oyster is still unexplored. Thus, we believe that this converging method for preparing a virtually sequenced cDNA library will also be appropriate for non-specialist researchers who want to generate cDNA from this relevant biological material.
Access restricted. Please log in or start a trial to view this content.
NOTE: A schematic overview is shown in Figure 1.
1. Sample collection
2. RNA isolation by guanidinium thiocyanate-phenol extraction
3. cDNA library generation by reverse transcription
4. Mitochondrial gene amplification and purification
5. Mitochondrial gene sequencing and comparison
6. Applying the cDNA library for cloning the genes MgUGD and MgUXS
7. Expression and activity tests of MgUGD and MgUXS
Access restricted. Please log in or start a trial to view this content.
Figure 1 shows a schematic overview of the described preparation method of the convergent cDNA library derived from Pacific oyster individuals. Figure 2 shows the sequences of the COX1 and ND genes of a distantly related oyster specimen with high divergence from the COX1 and ND gene sequences of the reference material. Figure 3 shows the sequences of the COX1 and ND genes of a closely related oyster specimen with low divergence from...
Access restricted. Please log in or start a trial to view this content.
The presented protocol allows the genetic identification of unreferenced oyster specimens with similar phenotype from regional seafood markets by comparison of the COX1 and ND genes with a publicly available oyster DNA genome database. The significance of this method lies in its simplicity, as only a single PCR reaction is needed for the evaluation of the virtual cDNA library. The two conserved mitochondrial COX1 and ND genes were amplified from a cDNA library which was generated by reverse transcription of RNA extracts ...
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
This work was supported in part by the Natural Science Foundation of China (grant numbers 31471703, A0201300537 and 31671854 to J.V. and L.L., grant number 31470435 to G.Y.), and the 100 Foreign Talents Plan (grant number JSB2014012 to J.V.).
Access restricted. Please log in or start a trial to view this content.
Name | Company | Catalog Number | Comments |
Chemicals: | |||
1% Triton X-100 | Solarbio | 9002-93-1 | *Alternative distributors possible |
2,5-Dihydroxybenzoic acid | Alfa Aesar | 490-79-9 | *Alternative distributors possible |
Acetonitrile | Merck | 75-05-8 | *Alternative distributors possible |
Agarose for molecular biology | Biowest Chemicals | 111860 | *Alternative distributors possible |
Ampicilin | Solarbio | 69-52-3 | *Alternative distributors possible |
Chloroform | Lingfeng, Shanghai | 67-66-3 | *Alternative distributors possible |
DEPC water | Thermo Scientific | R0601 | |
Ethanol | Jinhuada, Guangzhou | 64-17-5 | *Alternative distributors possible |
Guanidinium thiocyanate-phenol reagent | Invitrogen | 15596018 | TRIzol reagent |
Imidazole | Energy Chemical | 288-32-4 | *Alternative distributors possible |
Isopropyl alcohol | Nanjing Chemical Reagent | 67-63-0 | *Alternative distributors possible |
Isopropyl β-D-thiogalactopyranoside | Solarbio | 367-93-1 | *Alternative distributors possible |
Kanamycin | Solarbio | 25389-94-0 | *Alternative distributors possible |
LB Agar | Thermo Fisher | 22700025 | *Alternative distributors possible |
LB Broth | Thermo Fisher | 10855021 | *Alternative distributors possible |
Methanol | Jinhuada, Guangzhou | 67-56-1 | *Alternative distributors possible |
MgCl2 hexahydrate | Xilong Huagong | 7791-18-6 | *Alternative distributors possible |
NaCl | Xilong Huagong | 7647-14-5 | *Alternative distributors possible |
NAD+ | Duly Biotech | 53-84-9 | *Alternative distributors possible |
Phenyl-methylsulfonyl fluoride | Macklin | 329-98-6 | *Alternative distributors possible |
Tris | Solarbio | 77-86-1 | *Alternative distributors possible |
UDP-glucose | Wuhu Nuowei Chemicals | 28053-08-9 | *Alternative distributors possible |
UDP-glucuronic acid | SIGMA | 63700-19-6 | *Alternative distributors possible |
Tools/Instruments: | |||
MALDI-TOF mass spectrometer | Bruker | Autoflex | *Alternative distributors possible |
Metal block heater | Long Yang Scientific Instruments | Thermoshaker HB20 | *Alternative distributors possible |
PCR thermocycler | Hema | 9600 | *Alternative distributors possible |
Enzyme and Kits: | |||
10×Ligation buffer | Thermo Scientific | B69 | *Alternative distributors possible |
5×PrimeSTAR buffer | Takara | 9158A | |
Alkaline phosphatase | ThermoFisher FastAP | EF0654 | *Alternative distributors possible |
COX forward primer | Genscript | ATGTCAACAAATCATTTAGACATTG | |
COX reverse primer | Genscript | ACTTGACCAAAAACATAAGACATG | |
Cutsmart Buffer | NEB | B7204S | *Alternative distributors possible |
dNTP mix | Invitrogen | 18427088 | |
MgUGD forward primer | Genscript | ACATATGACCCTGTCCAAGATCTGTTGT | |
MgUGD reverse primer | Genscript | ACTCGAGACTCTGTGAGGCGGTGGAG | |
MgUXS forward primer | Genscript | CCATATGGCAGAATCCTCACAATCAC | |
MgUXS reverse primer | Genscript | ACTCGAGCACATTTTTGAATTTGCAGACGT | |
ND forward primer | Genscript | ATGAGATGGCAATTATTTTTTAAT | |
ND reverse primer | Genscript | ATGTATTTTGGAAAAATCTCCAC | |
PCR Cleanup Kit | AxyGen | AP-PCR-250 | *Alternative distributors possible |
pET-30a(+) vector | Merck Millipore | 69909 |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved