Use of LeishGEdit CRISPR-Cas9 Technology for Genetic Manipulation of Protozoan Parasite Leishmania

Summary

The establishment of a robust CRISPR-Cas9 methodology for genetic manipulation of Leishmania has accelerated the understanding of key biological processes of this parasite. Here, we describe in detail all the steps to generate knockout or in situ fluorescent-tagged parasites of virtually any gene of interest using LeishGEdit methodology.

Abstract

The cell biology of a parasitic protozoan as well as the impact of the infection in host cells can be addressed using genome modification techniques. The development of robust methods eases the burden to obtain gene mutants and contributes to answer specific biological questions. Here we describe the LeishGEdit CRISPR-Cas9 high-throughput method that allows for Leishmania in situ gene tagging and deletion in a short span of time (7-10 days). Briefly, a transgenic cell line expressing SpCas9 and T7 RNA polymerase serves as the background for electroporation of DNA fragments generated by PCR: (1) a fragment containing a T7 promoter and the gene specific guide RNA expressed with a Cas9 scaffold; and (2) a homologous recombination (HR) fragment to introduce a resistance marker and/or a fluorescent tag/epitope to the desired genome location. Our protocol will cover (1) primer design, (2) DNA fragment production and confirmation, (3) transfection, and (4) cell line confirmation methods. We hope the article will allow for easy reproduction of the protocol for genome manipulation by CRISPR-Cas9 and make the method largely available to the parasitology community, enabling advances in the understanding of the biology of Leishmania and other protozoan pathogens of medical and veterinary importance.

Introduction

The leishmaniases are a group of neglected tropical diseases present in nearly 100 countries, caused by more than 20 species of parasites from the genus Leishmania. The disease can manifest as a self-healing cutaneous lesion, mucocutaneous lesion, or visceral disease, which if not treated can be fatal. According to the World Health Organization (WHO), around 1 million of new cases of cutaneous leishmaniasis and 50,000-100,000 cases of visceral leishmaniasis are reported annually, resulting in 20,000-30,000 deaths per year¹. During its life cycle Leishmania shifts between an invertebrate and a vertebrate host, forcing the paras....

Protocol

1. Primer design for knockout and in situ tagging

1. To design GOI specific primers, enter the Tritrypdb (https://tritrypdb.org/tritrypdb/app) gene ID at the LeishGEdit website (www.leishgedit.net). First, select the option Primer Design and choose the strategy (N-terminal tagging; C-terminal tagging; Knockout; or Tagging and knockout) and the plasmid system (pT and pPLOT plasmids). See below the combination of primers necessary to generate the choice of mutants:
   1. For ta.......

Discussion

Leishmaniasis is a global health problem affecting millions of people every year, but despite the availability of the genome sequence of several Leishmania species has been available for years, genetic manipulation of this parasite was restricted to time-consuming and low efficient methods. The emergence of CRISPR-Cas9 technology changed this scenario and is contributing substantially to the better understanding of Leishmania biology, and potentially allow the development of new treatments for leis.......

Materials

Name	Company	Catalog Number	Comments
Part I - Primer design for knockout and in situ tagging
pPLOT and pT plasmids			(www.leishgedit.net)
Primers	ThermoScientific		PCR primer design (www.leishgedit.net)
Universal sgRNA reverse primer (G00)	ThermoScientific		5' AAAAGCACCGACTCGG TGCCACTTTTTCAAGTTGA TAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCT AAAAC 3'
Part II - Transfection DNA preparation
1 kb Plus DNA Ladder	ThermoScientific	Cat: 10787018	Molecular weight standards for gel electrophoresis of DNA
Agarose	ThermoScientific	Cat: 16500500	Agarose gels
Ethidium bromide	Sigma Aldrich	Cat: E8751	Agarose gel
Disodium Salt dihydrate (EDTA)	Honeywell	Cat: 34549	TAE Buffer
dNTPs	ThermoScientific	Cat: 10297018	PCR mix
Glacial acetic acid	Anidrol	Cat: A-8684	TAE Buffer
Horizontal Electrophoresis Systems	Bio-Rad	Mini-Sub cell GT	Gel electrophoresis
Magnesium Chloride Anhydrous	Merck	Cat: 7786-30-3	PCR mix
PCR tubes	Sarstedt	Cat: 72.737002	Plastic material
pH meter	Oakton	75233	Calibrate pH solution
Platinum Taq Polymerase High Fidelity	ThermoScientific	Cat: 11304011	For amplification of DNA using PCR
Potassium chloride	Sigma Aldrich	Cat: 31248	Buffer 10x
Thermocycler	Bio-Rad	#1861096	PCR amplification
Tris Base	Fisher Bioreagents	Cat: BP152-1	Buffer 10x
Part III - Transfection and cloning
70% Ethanol	Honeywell	Cat: 02860	Sterilize
96 well cell culture plate	Greiner bio-one	Cat: 655180	Cell culture
Adenine	Interlab	Cat: 321-30-2	Cell culture medium supplement
Amaxa Nucleofector IIb	Lonza	AAB-1001	Cell transfection
Biotin	Sigma Aldrich	58-85-5	Cell culture medium supplement
Blasticidin S hydrochloride	Invivogen	Cat: ant-bl-1	Antibiotics for selection
Bottle Top Filter 0.22 μmm	Kasvi	Cat: K16-1500	Culture medium filter
Cell culture flask - 25 cm2	Sarstedt	Cat: 833910	Plastic material
Centrifuge	Thermo Electron Corporation	75004333	Centrifugation
Conical tubes 50 mL	Corning	Cat: 352070	Plastic material
Conical tubes 15 mL	Corning	Cat: 430766	Plastic material
di-Sodium Hydrogen Phosphate	AppliChem	Cat: 131678.1210	Transfection buffer
Electroporation Cuvettes 0.2 cm gap	Bio-Rad	Cat: 1652086	Transfection
Fetal Bovine Serum (FBS)	ThermoScientific	12657029	Cell culture medium supplement
Glass Pasteur pipets	Corning	Cat: 13-678-4A	Glass material
Geneticin (G418)	Invivogen	Cat: ant-gn-5	Antibiotics for selection
HEPES	Fisher Bioreagents	Cat: BP310-500	Transfection buffer
Hygromycin B	Invivogen	Cat: 10687010	Antibiotics for selection
Incubator	Tecnal	TE-371	Cells maintenance
Inverted microscope	Labomed	TCM 400	Microscope
Medium 199	ThermoScientific	Cat: 31-100-019	Cell culture medium
Microcentrifuge	Eppendorf	5417C	Centrifugation
Microtube 1.5 mL	Sarstedt	Cat: 72.690001	Plastic material
Multichannel Pipette (p200)	HTL Lab Solutions	6283	Pipette reagents
Muse Cell Analyzer	Merck Millipore	0500-3115	Cell counter
Penicillin G	Interlab	Cat: 69-57-1	Cell culture medium supplement
Puromycin dihydrochloride	Invivogen	Cat: ant-pr-5b	Antibiotics for selection
Serological pipette 10 mL	Sarstedt	Cat: 861254001	Plastic material
Serological pipette 5 mL	Sarstedt	Cat: 861253001	Plastic material
Single Channel Pipette (p1000)	HTL Lab Solutions	LMP-1000	Pipette reagents
Single Channel Pipette (p200)	HTL Lab Solutions	LMP-200	Pipette reagents
Single Channel Pipette (p10)	HTL Lab Solutions	LMP-10	Pipette reagents
Single Channel Pipette (p2)	HTL Lab Solutions	LMP-2	Pipette reagents
Sodium bicarbonate	Fisher Bioreagents	Cat: 144-55-8	Cell culture medium supplement
Sodium Phosphate Monobasic	USB Corporation Cleveland	Cat: 20233	Transfection buffer
Streptomycin sulfate salt	Gibco	Cat: 11860-038	Cell culture medium supplement
Syringe Filter 0.2 μmm	ForlabExpress	Cat: K18-230	Filter transfection buffer
Syringe 10 mL	Interlab	Cat: 990173	Plastic material
Part IV - Cell line confirmation and phenotyping
Accuri C6	BD Biosciences	-	Flow cytometer
Ammonium persulfate (APS)	Sigma-Aldrich	Cat: A3678	Casting polyacrylamide gel
Confocal fluorescence microscope	Leica	TCS SP5 II Tandem Scanner	Microscopy
Coverslip	Glasstecnica	Lot: 44888/08	Glass material
Digital Shaker	Labnet	S2030-1000-B	Agitation
Goat Anti-Mouse 800CW antibody	LI-COR Biosciences	Cat: 926-32210	Western blot antidoby
Goat Anti-Rabbit 680RD antibody	LI-COR Biosciences	Cat: 926-68071	Western blot antidoby
Hoechst 33342	Invitrogen	Cat.: H3570	Fluorescence antidoby
Imaris software	Imaris	Version: 6.0	Data analysis
LiCl	Sigma-Aldrich	L4408	TELT solution preparation
Microscope slides	Tekdon Incorporated	Cat: 258-041-120	Glass material
Monoclonal c-Myc epitope antibody	EMD Millipore	Cat: 05-724	Western blot antidoby
Nitrocellulose membrane	Bio-Rad	#1620115	Protein Blotting
Non-fat milk	Molico	-	Blocking solution for Western Blot
Odyssey Fc Imaging System	LI-COR Biosciences	Model number 2800	Antibodies detection
Paraformaldehyde (PFA)	Sigma Aldrich	Cat: P6148	Fixation for fluorescence
PBS 1X	house made	house made	Neutral Buffer
Poly-L-lysine	Sigma Aldrich	Cat: P8920	Adhesion for fluorescence
Polyacrylamide	Invitrogen	Cat: 15512023	Casting denaturing polyacrylamide gel
Polyclonal Aldolase antibody	house made	house made	Western blot antidoby
Protein Ladder	LI-COR Biosciences	928-60000	Ladder
Sample Buffer	Sigma-Aldrich	S3401-1VL	Lysis solution
Sodium dodecyl sulfate (SDS)	Sigma-Aldrich	Cat: L3771	Casting polyacrylamide gel
TEMED	Life Technologies	Cat: 15524-010	Casting polyacrylamide gel
Triton X-100	Sigma-Aldrich	X-100	TELT solution preparation
Wet blotting system	Bio-Rad	1703930	Gel transfer cell