This work was supported by the National Natural Science Foundation of China (82160550).

1. The Cancer Genome Atlas (TCGA) database
NOTE: The Cancer Genome Atlas (TCGA) database contains the sequencing data of genes in different tumor tissues14. RNA-seq data in TCGA for the study of TMEM200A transcripts per part per million (TPM) formats were extracted from the UCSC Xena website15 (https://xenabrowser. net/datapages/) and log2 transformed for comparing the expressions between ...

&lt;em&gt;TMEM200A&lt;/em&gt;: A Novel Oncogene Regulating EMT and PI3K/AKT in Gastric Cancer

<ol>
	<li>Torre, L. A., Siegel, R. L., Ward, E. M., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+cancer+incidence+and+mortality+rates+and+trends--an+update.">Global cancer incidence and mortality rates and trends--an update.</a> Cancer Epidemiol Biomarkers Prev. 25 (1), 16-27 (2016).</li><li>Long, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+of+malignant+tumors+-+Yichang+City,+Hubei+Province,+China,+2019.">Economic burden of malignant tumors - Yichang City, Hubei Province, China, 2019.</a> China CDC Wkly. 4 (15), 312-316 (2022).</li><li>Harbeck, N., Gnant, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breast+cancer.">Breast cancer.</a> Lancet. 389 (10074), 1134-1150 (2017).</li><li>Bagchi, S., Yuan, R., Engleman, E. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+the+treatment+of+cancer:+clinical+impact+and+mechanisms+of+response+and+resistance.">Immune checkpoint inhibitors for the treatment of cancer: clinical impact and mechanisms of response and resistance.</a> Annu Rev Pathol. 16, 223-249 (2021).</li><li>Lam, G. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pitfalls+in+cutaneous+melanoma+diagnosis+and+the+need+for+new+reliable+markers.">Pitfalls in cutaneous melanoma diagnosis and the need for new reliable markers.</a> Mol Diagn Ther. 27 (1), 49-60 (2023).</li><li>Gromiha, M. M., Ou, Y. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatics+approaches+for+functional+annotation+of+membrane+proteins.">Bioinformatics approaches for functional annotation of membrane proteins.</a> Brief Bioinform. 15 (2), 155-168 (2014).</li><li>Schmit, K., Michiels, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TMEM+proteins+in+cancer:+a+review.">TMEM proteins in cancer: a review.</a> Front Pharmacol. 9, 1345 (2018).</li><li>Marx, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmembrane+(TMEM)+protein+family+members:+Poorly+characterized+even+if+essential+for+the+metastatic+process.">Transmembrane (TMEM) protein family members: Poorly characterized even if essential for the metastatic process.</a> Semin Cancer Biol. 60, 96-106 (2020).</li><li>Fu, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+transmembrane+protein+168+in+the+mouse+nucleus+accumbens+induces+anxiety+and+sensorimotor+gating+deficit.">Overexpression of transmembrane protein 168 in the mouse nucleus accumbens induces anxiety and sensorimotor gating deficit.</a> PLoS One. 12 (12), e0189006 (2017).</li><li>Cuajungco, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+accumulation+of+human+transmembrane+(TMEM)-176A+and+176B+proteins+is+associated+with+cancer+pathology.">Abnormal accumulation of human transmembrane (TMEM)-176A and 176B proteins is associated with cancer pathology.</a> Acta Histochem. 114 (7), 705-712 (2012).</li><li>Zhang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TMEM116+is+required+for+lung+cancer+cell+motility+and+metastasis+through+PDK1+signaling+pathway.">TMEM116 is required for lung cancer cell motility and metastasis through PDK1 signaling pathway.</a> Cell Death Dis. 12 (12), 1086 (2021).</li><li>Zhang, N., Pan, H., Liang, X., Xie, J., Han, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+roles+of+transmembrane+family+proteins+in+the+regulation+of+store-operated+Ca(2+)+entry.">The roles of transmembrane family proteins in the regulation of store-operated Ca(2+) entry.</a> Cell Mol Life Sci. 79 (2), 118 (2022).</li><li>Zhang, X., Zheng, P., Li, Z., Gao, S., Liu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+somatic+mutation+landscape+and+RNA+prognostic+markers+in+stomach+adenocarcinoma.">The somatic mutation landscape and RNA prognostic markers in stomach adenocarcinoma.</a> Onco Targets Ther. 13, 7735-7746 (2020).</li><li>Jia, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mining+TCGA+database+for+genes+of+prognostic+value+in+glioblastoma+microenvironment.">Mining TCGA database for genes of prognostic value in glioblastoma microenvironment.</a> Aging (Albany NY). 10 (4), 592-605 (2018).</li><li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UCSCXenaShiny:+an+R/CRAN+package+for+interactive+analysis+of+UCSC+Xena+data.">UCSCXenaShiny: an R/CRAN package for interactive analysis of UCSC Xena data.</a> Bioinformatics. 38 (2), 527-529 (2022).</li><li>Li, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TIMER2.0+for+analysis+of+tumor-infiltrating+immune+cells.">TIMER2.0 for analysis of tumor-infiltrating immune cells.</a> Nucleic Acids Res. 48 (W1), W509-W514 (2020).</li><li>Thul, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+subcellular+map+of+the+human+proteome.">A subcellular map of the human proteome.</a> Science. 356 (6340), eaal3321 (2017).</li><li>Li, Y., Ge, D., Lu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SMART+App:+an+interactive+web+application+for+comprehensive+DNA+methylation+analysis+and+visualization.">The SMART App: an interactive web application for comprehensive DNA methylation analysis and visualization.</a> Epigenetics Chromatin. 12 (1), 71 (2019).</li><li>Chandrashekar, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UALCAN:+An+update+to+the+integrated+cancer+data+analysis+platform.">UALCAN: An update to the integrated cancer data analysis platform.</a> Neoplasia. 25, 18-27 (2022).</li><li>Tate, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=COSMIC:+the+Catalogue+Of+Somatic+Mutations+In+Cancer.">COSMIC: the Catalogue Of Somatic Mutations In Cancer.</a> Nucleic Acids Res. 47 (D1), D941-D947 (2019).</li><li>Gao, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+complex+cancer+genomics+and+clinical+profiles+using+the+cBioPortal.">Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal.</a> Sci Signal. 6 (269), pl1 (2013).</li><li>Shen, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sangerbox:+A+comprehensive,+interaction-friendly+clinical+bioinformatics+analysis+platform.">Sangerbox: A comprehensive, interaction-friendly clinical bioinformatics analysis platform.</a> iMeta. 1 (3), e36 (2022).</li><li>Ru, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TISIDB:+an+integrated+repository+portal+for+tumor-immune+system+interactions.">TISIDB: an integrated repository portal for tumor-immune system interactions.</a> Bioinformatics. 35 (20), 4200-4202 (2019).</li><li>Yuan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CancerSEA:+a+cancer+single-cell+state+atlas.">CancerSEA: a cancer single-cell state atlas.</a> Nucleic Acids Res. 47 (D1), D900-D908 (2019).</li><li>Sun, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TISCH:+a+comprehensive+web+resource+enabling+interactive+single-cell+transcriptome+visualization+of+tumor+microenvironment.">TISCH: a comprehensive web resource enabling interactive single-cell transcriptome visualization of tumor microenvironment.</a> Nucleic Acids Res. 49 (D1), D1420-D1430 (2021).</li><li>Warde-Farley, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GeneMANIA+prediction+server:+biological+network+integration+for+gene+prioritization+and+predicting+gene+function.">The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function.</a> Nucleic Acids Res. 38, W214-W220 (2010).</li><li>Zhu, Y., Feng, S., Song, Z., Wang, Z., Chen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+immunological+characteristics+and+immune+subtypes+based+on+single-sample+gene+set+enrichment+analysis+algorithm+in+lower-grade+glioma.">Identification of immunological characteristics and immune subtypes based on single-sample gene set enrichment analysis algorithm in lower-grade glioma.</a> Front Genet. 13, 894865 (2022).</li><li>Mueller Bustin, S. A., R, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+reverse+transcription+PCR+(qRT-PCR)+and+its+potential+use+in+clinical+diagnosis.">Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis.</a> Clin Sci (Lond). 109 (4), 365-379 (2005).</li><li>Sun, L., Zhang, H., Gao, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+reprogramming+and+epigenetic+modifications+on+the+path+to+cancer.">Metabolic reprogramming and epigenetic modifications on the path to cancer.</a> Protein Cell. 13 (12), 877-919 (2022).</li><li>Ntontsi, P., Photiades, A., Zervas, E., Xanthou, G., Samitas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+and+epigenetics+in+asthma.">Genetics and epigenetics in asthma.</a> Int J Mol Sci. 22 (5), 2412 (2021).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+metabolism:+looking+forward.">Cancer metabolism: looking forward.</a> Nat Rev Cancer. 21 (10), 669-680 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PremPS:+Predicting+the+impact+of+missense+mutations+on+protein+stability.">PremPS: Predicting the impact of missense mutations on protein stability.</a> PLoS Comput Biol. 16 (12), e1008543 (2020).</li><li>Li, M., Petukh, M., Alexov, E., Panchenko, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+the+impact+of+missense+mutations+on+protein-protein+binding+affinity.">Predicting the impact of missense mutations on protein-protein binding affinity.</a> J Chem Theory Comput. 10 (4), 1770-1780 (2014).</li><li>Hirsch, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+responses+to+PD-1+inhibition+and+their+molecular+characterization+in+six+patients+with+mismatch+repair-deficient+metastatic+cancer+of+the+digestive+system.">Clinical responses to PD-1 inhibition and their molecular characterization in six patients with mismatch repair-deficient metastatic cancer of the digestive system.</a> J Cancer Res Clin Oncol. 147 (1), 263-273 (2021).</li><li>Poulogiannis, G., Frayling, I. M., Arends, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+mismatch+repair+deficiency+in+sporadic+colorectal+cancer+and+Lynch+syndrome.">DNA mismatch repair deficiency in sporadic colorectal cancer and Lynch syndrome.</a> Histopathology. 56 (2), 167-179 (2010).</li><li>Chintamani, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+mismatched+repair+genes+and+their+correlation+with+clinicopathological+parameters+and+response+to+neo-adjuvant+chemotherapy+in+breast+cancer.">The expression of mismatched repair genes and their correlation with clinicopathological parameters and response to neo-adjuvant chemotherapy in breast cancer.</a> Int Semin Surg Oncol. 4, 5 (2007).</li><li>Deng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+expression+of+TMEM200A+is+associated+with+a+poor+prognosis+and+immune+infiltration+in+gastric+cancer.">High expression of TMEM200A is associated with a poor prognosis and immune infiltration in gastric cancer.</a> Pathol Oncol Res. 29, 1610893 (2023).</li><li>Stemmler, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cadherins+in+development+and+cancer.">Cadherins in development and cancer.</a> Mol Biosyst. 4 (8), 835-850 (2008).</li><li>Bill, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ANO1/TMEM16A+interacts+with+EGFR+and+correlates+with+sensitivity+to+EGFR-targeting+therapy+in+head+and+neck+cancer.">ANO1/TMEM16A interacts with EGFR and correlates with sensitivity to EGFR-targeting therapy in head and neck cancer.</a> Oncotarget. 6 (11), 9173-9188 (2015).</li><li>De Las Rivas, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+drug+resistance+induced+by+EMT:+novel+therapeutic+strategies.">Cancer drug resistance induced by EMT: novel therapeutic strategies.</a> Arch Toxicol. 95 (7), 2279-2297 (2021).</li><li>Tian, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SERPINH1+regulates+EMT+and+gastric+cancer+metastasis+via+the+Wnt/&#946;-catenin+signaling+pathway.">SERPINH1 regulates EMT and gastric cancer metastasis via the Wnt/&#946;-catenin signaling pathway.</a> Aging (Albany NY). 12 (4), 3574-3593 (2020).</li></ol>

The authors declare there are no conflicts of interest.

TMEM200A belongs to a family of TMEMs that is essential for cancer cells to proliferate38. The variable expression of TMEM200A in different malignancies has received less attention, and a thorough pan-cancer investigation is lacking. However, evidence continues to accumulate, showing that the TMEM transmembrane protein family may be important in keeping cancer cells malignant through interactions with several proteins, for example, activation of TMEM16A Ca2+-activated ...

Cancer has emerged as a persistent public health issue endangering human health globally1due to its high morbidity and mortality rates worldwide, posing a heavy financial and medical burden to society2. Significant advancements in cancer therapy have been achieved in recent years thanks to the discovery of cancer markers3, and researchers have developed novel diagnostic methods and new drugs to treat cancer. However, some patients with cancer still have poor prognoses because of factors such as medication resistance, side effects of drugs, and chemical sensitivity4. Therefore, there is an urgent need for identifying new biomarkers for screening and treating early-stage cancers5.
Membrane proteins are proteins that can bind and integrate into cells and organelle membranes6. These can be grouped into three categories depending on the strength of binding to the membrane and their location: lipid-anchored proteins, integral proteins, and peripheral membrane proteins7,8. A transmembrane (TMEM) protein is an integral membrane protein that consists of at least one transmembrane segment9, which passes either completely or partially through the biological membrane. 
Although the mechanisms of action of proteins belonging to the TMEM family are not well understood, these proteins are known to be involved in several types of cancers10. Several TMEM proteins are associated with migratory, proliferative, and invasive phenotypes, and their expression is often associated with a patient's prognosis11. Therefore, TMEM family members have become the target of research. A comprehensive review of existing reports on TMEM revealed that they are mostly associated with inter- and intracellular signaling12, immune-related diseases, and tumorigenesis10. Many TMEMs also possess important physiological functions, for example, ion channels in the plasma membrane, activation of signal transduction pathways, as well as the mediation of cell chemotaxis, adhesion, apoptosis, and autophagy10. Therefore, we hypothesized that TMEM proteins may be important prognostic markers in the detection and treatment of tumors.
TMEM200A expression is significantly elevated in gastric cancer (GC). Higher expression of TMEM200A13, which has eight exons and a full length of 77.536 kb on chromosome 6q23.1, has been linked to a poor prognosis for overall survival (OS) in cases of GC. Yet the changes in its expression have rarely been reported in oncology studies. This article compares and analyzes the usefulness of TMEM200A as a therapeutic target and tumor diagnostic marker in various cancer studies using different publicly available datasets. We assessed the effectiveness of TMEM200A as a pan-cancer diagnostic and prognostic biomarker as well as its expression levels in various human cancer types using RNA-seq data from the UCSC Xena and TCGA databases, as well as by real-time quantitative polymerase chain reaction (qRT-PCR) and western blotting. 
The effect of TMEM200A expression levels on mutation rates, regulatory processes, tumor diagnosis and prognosis, immune infiltration, and immunotherapy was further investigated using a mix of computational tools and dataset websites. CBioPortal and the Catalog of Somatic Mutations in Cancer Cells (COSMIC) databases were used to examine mutations in TMEM200A. Sangerbox and TISIDB websites were utilized to understand how TMEM200A influences immune infiltration. The Tumor Immune Single Cell Center (TISCH) online tool and CancerSEA database were used to investigate the function of TMEM200A. Finally, to assess the impact of TMEM200A on the malignant behavior and tumor development function of GC cells, a loss-of-function experiment was conducted in an in vitro assay. Additionally, western blotting was performed to assess how TMEM200A knockdown affected the PI3K/AKT signaling pathway and the epithelial-mesenchymal transition (EMT) in GC.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Anti-AKT antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>60203-2-Ig</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-E-cadherin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>20874-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>10494-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-N-cadherin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>22018-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-P-AKT antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>66444-1-Ig</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-snail antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>13099-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Vimentin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>10366-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>AxyPrepMultisourceTotalRNAMini- 
			prep Kit</td>
			<td>Suzhou Youyi Landi Biotechnology Co., Ltd</td>
			<td>UEL-UE-MN-MS-RNA-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>BCA Protein Assay Kit</td>
			<td>Epizyme Biotech</td>
			<td>ZJ101L</td>
			<td></td>
		</tr>
		<tr>
			<td>CCK-8 reagent</td>
			<td>MedChemExpress</td>
			<td>HY-K0301-500T</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>CYAGEN BIOSCIENCES (GUANGZHOU) INC</td>
			<td>FBSSR-01021</td>
			<td></td>
		</tr>
		<tr>
			<td>GAPDH primer</td>
			<td>Sangon Biotech (Shanghai) Co., Ltd.</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): TGACATCAAGAAGGTG 
			GTGAAGCAG; Reverse primer (5&#8217;-3&#8217;): GTGTCGCTGTTGAAG 
			TCAGAGGAG</td>
		</tr>
		<tr>
			<td>HighGene plus Transfection reagent</td>
			<td>ABclonal</td>
			<td>RM09014P</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP-conjugated Affinipure Goat Anti-Mouse lgG (H+L)</td>
			<td>Proteintech Group, Inc</td>
			<td>SA00001-1</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP-conjugated Affinipure Goat Anti-Rabbit lgG (H+L)</td>
			<td>Proteintech Group, Inc</td>
			<td>SA00001-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Human gastric mucosal epithelial GES-1 cells</td>
			<td>Guangzhou Cellcook Biotech Co.,Ltd.</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Human STAD HGC-27 cells</td>
			<td>Procell Life Science&#38;Technology Co.,Ltd</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Human STAD SGC-7901 cells</td>
			<td>Procell Life Science&#38;Technology Co.,Ltd</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MonAmp SYBR Green qPCR Mix (None ROX)</td>
			<td>Mona (Suzhou) Biotechnology Co., Ltd</td>
			<td>MQ10101S</td>
			<td></td>
		</tr>
		<tr>
			<td>MonScript RTIII All-in-One Mix with dsDNase&#160;&#160;</td>
			<td>Mona (Suzhou) Biotechnology Co., Ltd</td>
			<td>MR05101M</td>
			<td></td>
		</tr>
		<tr>
			<td>Omni-ECL Femto Light Chemiluminescence Kit</td>
			<td>Epizyme Biotech</td>
			<td>SQ201</td>
			<td></td>
		</tr>
		<tr>
			<td>PAGE Gel Fast Preparationb Kit&#160;</td>
			<td>Epizyme Biotech</td>
			<td>PG111</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-streptomycin (Pen-Strep)</td>
			<td>Beijing Solarbio Science &#38; Technology Co.,Ltd</td>
			<td>P1400-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyvinylidene difluoride (PVDF) membrane</td>
			<td>Merck KGaA</td>
			<td>IPVH00010-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein Free Rapid Blocking Buffer</td>
			<td>Epizyme Biotech</td>
			<td>PS108P</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis solution</td>
			<td>Beijing Solarbio Science &#38; Technology Co., Ltd</td>
			<td>R0010</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 complete medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>C11875500BT</td>
			<td></td>
		</tr>
		<tr>
			<td>Skimmed milk</td>
			<td>Campina: Elk</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>TBST buffer solution</td>
			<td>Beijing Solarbio Science &#38; Technology Co., Ltd</td>
			<td>T1082</td>
			<td></td>
		</tr>
		<tr>
			<td>The protein loading buffer</td>
			<td>Epizyme Biotech</td>
			<td>LT101S</td>
			<td></td>
		</tr>
		<tr>
			<td>TMEM200A knockdown plasmid</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>TMEM200A primer</td>
			<td>Sangon Biotech (Shanghai) Co., Ltd.</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): AAGGCGGTGTGGTGGTTCG; Reverse primer (5&#8217;-3&#8217;): GATTTTGGTCTCTTTGTCACGGTT</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA1</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): ACAACTGATGATAAGACCAG; Reverse primer (5&#8217;-3&#8217;): TGTTGACTACTATTCTGGTC</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA2</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): CGTGTGAATGTCAATGACTG; Reverse primer (5&#8217;-3&#8217;): GCACACTTACAGTTACTGAC</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA3</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): ACAACCACAACATCTGCCCG; Reverse primer (5&#8217;-3&#8217;): TGTTGGTGTTGTAGACGGGC</td>
		</tr>
		<tr>
			<td>Transmembrane protein 200A Antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>48081-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CO2 cell culture incubator</td>
			<td>Haier Group</td>
			<td>PYXE-80IR</td>
			<td></td>
		</tr>
		<tr>
			<td>Electrophoresis instrument</td>
			<td>Bio-RAD</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence quantitative PCR instrument</td>
			<td>Bio-RAD</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gel Imaging System (Tanon 5200)</td>
			<td>Tanon Science &#38; Technology Co., Ltd</td>
			<td>LAB-0002-0007-SHTN</td>
			<td></td>
		</tr>
		<tr>
			<td>Multifunctional Enzyme Labeler</td>
			<td>Berthold</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

multiomics analysis of tmem200a as a pan-cancer biomarker

The transmembrane protein, TMEM200A, is known to be associated with human cancers and immune infiltration. Here, we assessed the function of TMEM200A in common cancers by multiomics analysis and used in vitro cell cultures of gastric cells to verify the results. The expression of TMEM200A in several human cancer types was assessed using the RNA-seq data from the UCSC Xena database. Bioinformatic analysis revealed a potential role of TMEM200A as a diagnostic and prognostic biomarker. 
Cultures of normal gastric and cancer cell lines were grown and TMEM200A was knocked down. The expression levels of TMEM200A were measured by using quantitative real-time polymerase chain reaction and western blotting. In vitro loss-of-function studies were then used to determine the roles of TMEM200A in the malignant behavior and tumor formation of gastric cancer (GC) cells. Western blots were used to assess the effect of the knockdown on epithelial-mesenchymal transition (EMT) and PI3K/AKT signaling pathway in GC. Bioinformatic analysis showed that TMEM200A was expressed at high levels in GC. 
The proliferation of GC cells was inhibited by TMEM200A knockdown, which also decreased vimentin, N-cadherin, and Snai proteins, and inhibited AKT phosphorylation. The PI3K/AKT signaling pathway also appeared to be involved in TMEM200A-mediated regulation of GC development. The results presented here suggest that TMEM200A regulates the tumor microenvironment by affecting the EMT. TMEM200A may also affect EMT through PI3K/AKT signaling, thus influencing the tumor microenvironment. Therefore, in pan-cancers, especially GC, TMEM200A may be a potential biomarker and oncogene.

Author Spotlight: Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies 

Multiomics Analysis of TMEM200A as a Pan-Cancer Biomarker

Significant advancements have been made in the investigation of cancer biomarkers. Nevertheless, the extract function of tumor-related matters associated with transmembrane protein family remains unidentified. As a result, our research on the TMEM200A in gastric cancer has generated novel research directions for related cells.In this study, we used the combination of online database prediction and experimental technique validation, which simplifies the research steps and the stem cell cost of experiment in related field. In future, our laboratory will focus on exploring the specific mechanism of tumor in gastric cancer, searching for the association between glycosylation modification and the metabolic recording, and identifying find new targets for gastric cancer treatment.

Expression of TMEM200A in various cancers 
As illustrated in Figure 1, we first analyzed the differential expression levels of TMEM200A in various cancers through different databases. TMEM200A expression was elevated in cholangiocarcinoma (CHOL), head and neck squamous cell carcinoma (HNSC), renal clear cell carcinoma (KIRC), renal papillary cell carcinoma (KIRP), hepatocellular carcinoma (LIHC), STAD, and thyroid carcinoma (T...

Watch this Scientific Journal Video about Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies at JoVE.com

Here, a protocol is presented in which multiple bioinformatic tools are combined to study the biological functions of TMEM200A in cancer. In addition, we also experimentally validate the bioinformatics predictions.

The transmembrane protein, TMEM200A, is known to be associated with human cancers and immune infiltration. Here, we assessed the function of TMEM200A in ...

multiomics-analysis-of-tmem200a-as-a-pan-cancer-biomarker

Research

JoVE Journal

Cancer Research

Transfection of TMEM200A siRNA in Stomach Adenocarcinoma Cell Lines

Transfection of TMEM200A siRNA in Stomach Adenocarcinoma Cell Lines  

To begin, navigate to the TIMER2.0 database website interface. Select the Cancer Exploration tab. Input the gene ID into the search box and click Submit to produce the differential expression images of TMEM200A in various tumor types.For transfection, label three micro-centrifuge tubes as siRNA-1, 2, and 3. Then add transfection reagent followed by the basal medium in each tube. add four micrograms of siRNA to the respective tubes and mix thoroughly.Now distribute the mixture into the three wells of the six-well plate containing the adenocarcinoma cells. Gently shake the plate to ensure even distribution of the mixture. Label the three wells where the mixture was added as siRNA 1, siRNA two, and siRNA three.After incubating the cells for four to six hours, replace half of the medium in the labeled wells with fresh complete medium. Incubate the cells for 24 to 48 hours before using them for quantitative RTPCR and Western blotting.

Quantification of mRNA in TMEM200A siRNA Transfected Stomach Adenocarcinoma Cells

Quantification of mRNA in TMEM200A siRNA Transfected Stomach Adenocarcinoma Cells  

To begin, transfect the stomach adenocarcinoma cells with TMEM200A siRNA and incubate for two days. Then, discard the cell culture medium from the wells and gently wash the cells two times with one milliliter of PBS. Using an RNA isolation kit, isolate the total RNA of the cells.Estimate the RNA concentration and synthesize cDNA with one microgram of RNA using a cDNA synthesis kit, following the manufacturer's instructions. Now set up quantitative RTPCR on tenfold dilutions of cDNA in a 10 microliter reaction mix. Add primers and quantitative PCR master mix using the realtime PCR assay system.Use the quantitative PCR reaction conditions shown here and determine the relative expression of each gene using the double delta CT technique. The HGC-27 cell line dramatically over expressed TMEM200A protein and mRNA transcript compared to the GES-1 cell line. The differential mRNA expression of TMEM200A in human gastric cancer cells, SGC-7901, is higher than in GES-1 cells.

Protein Detection in TMEM200A siRNA Transfected Stomach Adenocarcinoma Cells Using Western Blotting

Protein Detection in TMEM200A siRNA Transfected Stomach Adenocarcinoma Cells Using Western Blotting  

To begin, transfect the stomach adenocarcinoma cells with TMEM200A Si-RNA and incubate for two days. Then, discard the cell culture medium from the wells and gently wash the cells two times with one milliliter of PBS. Place the cells on ice and add 150 microliters of pre-cooled radioimmune precipitation assay lysis buffer.Using a plastic cell scraper, carefully detach the adhering cells from the dish and transfer the cell solution gently into a pre-cooled microcentrifuge tube. Then, centrifuge the cell lysate at 1.5 by 10 raised to the power four G for 10 minutes at four degrees Celsius, and transfer the supernatant to a new 1.5-milliliter microcentrifuge tube. Using a BCA protein assay kit, determine the protein content following the manufacturer's instructions.Load 30 grams of protein from each sample onto a 10%SDS-PAGE gel. Run the gel at 80 volts for 0.5 hours, followed by 1.5 hours at 120 volts. Next, transfer the proteins from the gel to a 45-micrometer PVDF membrane at a constant current of 300 milliamperes for 1 to 1.5 hours.Place the PVDF membrane on a shaker for three cycles of five minutes each. After shaking, add TBST to the container with the protein side facing up. Place the membrane in the blocking buffer for 30 minutes at room temperature.Wash the membrane with TBST for three cycles of 10 minutes each. Incubate the membrane with primary antibodies overnight at four degrees Celsius. After washing the membrane three times with TBST, add a rabbit or mouse secondary antibody and incubate for one hour at room temperature.Then, add ECL substrate to the PVDF membrane for 30 seconds and detect the signal using an imaging system. The efficiency of TMEM200A was significantly reduced in gastric cancer cell HGC-27 transfected with Si-RNA, compared to the non-transfected cells. The TMEM200A Si-RNA significantly inhibited the related proteins in epithelial mesenchymal transition, and affected the phosphorylation of AKT in the phosphoinositide 3-kinase signaling pathway.

Determining the Cell Viability of TMEM200A siRNA Transfected HGC-27 Cell Lines Using CCK-8 Assays

Determining the Cell Viability of TMEM200A siRNA Transfected HGC-27 Cell Lines Using CCK-8 Assays  

Begin by seeding HGC-27 cells in good growth condition in 96-well plates. Seed the transfected cells into 96-well plates divided into negative control and TMEM200A siRNA groups. Incubate the cells at 37 degrees Celsius.After specific time intervals, add CCK-8 reagent to each well, and incubate at 37 degrees Celsius for two hours. Finally, measure the absorbance at 450 nanometers using a multifunctional enzyme labeler. The CCK-8 assays showed that TMEM200A knockdown groups showed a notable drop in cell viability as compared to the negative control group.

810 Views.  Youjiang Medical University for Nationalities.  Here, a protocol is presented in which multiple bioinformatic tools are combined to study the biological functions of TMEM200A in cancer. In addition, we also experimentally validate the bioinformatics predictions.

TMEM200A: A Novel Oncogene Regulating EMT and PI3K/AKT in Gastric Cancer

Özet