Bu çalışma Çin Ulusal Doğa Bilimleri Vakfı (82160550) tarafından desteklenmiştir.

TMEM200A: Mide Kanserinde EMT ve PI3K/AKT'yi Düzenleyen Yeni Bir Onkogen

<ol>
	<li>Torre, L. A., Siegel, R. L., Ward, E. M., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+cancer+incidence+and+mortality+rates+and+trends--an+update.">Global cancer incidence and mortality rates and trends--an update.</a> Cancer Epidemiol Biomarkers Prev. 25 (1), 16-27 (2016).</li><li>Long, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+of+malignant+tumors+-+Yichang+City,+Hubei+Province,+China,+2019.">Economic burden of malignant tumors - Yichang City, Hubei Province, China, 2019.</a> China CDC Wkly. 4 (15), 312-316 (2022).</li><li>Harbeck, N., Gnant, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breast+cancer.">Breast cancer.</a> Lancet. 389 (10074), 1134-1150 (2017).</li><li>Bagchi, S., Yuan, R., Engleman, E. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+the+treatment+of+cancer:+clinical+impact+and+mechanisms+of+response+and+resistance.">Immune checkpoint inhibitors for the treatment of cancer: clinical impact and mechanisms of response and resistance.</a> Annu Rev Pathol. 16, 223-249 (2021).</li><li>Lam, G. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pitfalls+in+cutaneous+melanoma+diagnosis+and+the+need+for+new+reliable+markers.">Pitfalls in cutaneous melanoma diagnosis and the need for new reliable markers.</a> Mol Diagn Ther. 27 (1), 49-60 (2023).</li><li>Gromiha, M. M., Ou, Y. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatics+approaches+for+functional+annotation+of+membrane+proteins.">Bioinformatics approaches for functional annotation of membrane proteins.</a> Brief Bioinform. 15 (2), 155-168 (2014).</li><li>Schmit, K., Michiels, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TMEM+proteins+in+cancer:+a+review.">TMEM proteins in cancer: a review.</a> Front Pharmacol. 9, 1345 (2018).</li><li>Marx, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmembrane+(TMEM)+protein+family+members:+Poorly+characterized+even+if+essential+for+the+metastatic+process.">Transmembrane (TMEM) protein family members: Poorly characterized even if essential for the metastatic process.</a> Semin Cancer Biol. 60, 96-106 (2020).</li><li>Fu, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+transmembrane+protein+168+in+the+mouse+nucleus+accumbens+induces+anxiety+and+sensorimotor+gating+deficit.">Overexpression of transmembrane protein 168 in the mouse nucleus accumbens induces anxiety and sensorimotor gating deficit.</a> PLoS One. 12 (12), e0189006 (2017).</li><li>Cuajungco, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+accumulation+of+human+transmembrane+(TMEM)-176A+and+176B+proteins+is+associated+with+cancer+pathology.">Abnormal accumulation of human transmembrane (TMEM)-176A and 176B proteins is associated with cancer pathology.</a> Acta Histochem. 114 (7), 705-712 (2012).</li><li>Zhang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TMEM116+is+required+for+lung+cancer+cell+motility+and+metastasis+through+PDK1+signaling+pathway.">TMEM116 is required for lung cancer cell motility and metastasis through PDK1 signaling pathway.</a> Cell Death Dis. 12 (12), 1086 (2021).</li><li>Zhang, N., Pan, H., Liang, X., Xie, J., Han, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+roles+of+transmembrane+family+proteins+in+the+regulation+of+store-operated+Ca(2+)+entry.">The roles of transmembrane family proteins in the regulation of store-operated Ca(2+) entry.</a> Cell Mol Life Sci. 79 (2), 118 (2022).</li><li>Zhang, X., Zheng, P., Li, Z., Gao, S., Liu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+somatic+mutation+landscape+and+RNA+prognostic+markers+in+stomach+adenocarcinoma.">The somatic mutation landscape and RNA prognostic markers in stomach adenocarcinoma.</a> Onco Targets Ther. 13, 7735-7746 (2020).</li><li>Jia, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mining+TCGA+database+for+genes+of+prognostic+value+in+glioblastoma+microenvironment.">Mining TCGA database for genes of prognostic value in glioblastoma microenvironment.</a> Aging (Albany NY). 10 (4), 592-605 (2018).</li><li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UCSCXenaShiny:+an+R/CRAN+package+for+interactive+analysis+of+UCSC+Xena+data.">UCSCXenaShiny: an R/CRAN package for interactive analysis of UCSC Xena data.</a> Bioinformatics. 38 (2), 527-529 (2022).</li><li>Li, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TIMER2.0+for+analysis+of+tumor-infiltrating+immune+cells.">TIMER2.0 for analysis of tumor-infiltrating immune cells.</a> Nucleic Acids Res. 48 (W1), W509-W514 (2020).</li><li>Thul, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+subcellular+map+of+the+human+proteome.">A subcellular map of the human proteome.</a> Science. 356 (6340), eaal3321 (2017).</li><li>Li, Y., Ge, D., Lu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SMART+App:+an+interactive+web+application+for+comprehensive+DNA+methylation+analysis+and+visualization.">The SMART App: an interactive web application for comprehensive DNA methylation analysis and visualization.</a> Epigenetics Chromatin. 12 (1), 71 (2019).</li><li>Chandrashekar, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UALCAN:+An+update+to+the+integrated+cancer+data+analysis+platform.">UALCAN: An update to the integrated cancer data analysis platform.</a> Neoplasia. 25, 18-27 (2022).</li><li>Tate, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=COSMIC:+the+Catalogue+Of+Somatic+Mutations+In+Cancer.">COSMIC: the Catalogue Of Somatic Mutations In Cancer.</a> Nucleic Acids Res. 47 (D1), D941-D947 (2019).</li><li>Gao, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+complex+cancer+genomics+and+clinical+profiles+using+the+cBioPortal.">Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal.</a> Sci Signal. 6 (269), pl1 (2013).</li><li>Shen, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sangerbox:+A+comprehensive,+interaction-friendly+clinical+bioinformatics+analysis+platform.">Sangerbox: A comprehensive, interaction-friendly clinical bioinformatics analysis platform.</a> iMeta. 1 (3), e36 (2022).</li><li>Ru, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TISIDB:+an+integrated+repository+portal+for+tumor-immune+system+interactions.">TISIDB: an integrated repository portal for tumor-immune system interactions.</a> Bioinformatics. 35 (20), 4200-4202 (2019).</li><li>Yuan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CancerSEA:+a+cancer+single-cell+state+atlas.">CancerSEA: a cancer single-cell state atlas.</a> Nucleic Acids Res. 47 (D1), D900-D908 (2019).</li><li>Sun, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TISCH:+a+comprehensive+web+resource+enabling+interactive+single-cell+transcriptome+visualization+of+tumor+microenvironment.">TISCH: a comprehensive web resource enabling interactive single-cell transcriptome visualization of tumor microenvironment.</a> Nucleic Acids Res. 49 (D1), D1420-D1430 (2021).</li><li>Warde-Farley, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GeneMANIA+prediction+server:+biological+network+integration+for+gene+prioritization+and+predicting+gene+function.">The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function.</a> Nucleic Acids Res. 38, W214-W220 (2010).</li><li>Zhu, Y., Feng, S., Song, Z., Wang, Z., Chen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+immunological+characteristics+and+immune+subtypes+based+on+single-sample+gene+set+enrichment+analysis+algorithm+in+lower-grade+glioma.">Identification of immunological characteristics and immune subtypes based on single-sample gene set enrichment analysis algorithm in lower-grade glioma.</a> Front Genet. 13, 894865 (2022).</li><li>Mueller Bustin, S. A., R, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+reverse+transcription+PCR+(qRT-PCR)+and+its+potential+use+in+clinical+diagnosis.">Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis.</a> Clin Sci (Lond). 109 (4), 365-379 (2005).</li><li>Sun, L., Zhang, H., Gao, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+reprogramming+and+epigenetic+modifications+on+the+path+to+cancer.">Metabolic reprogramming and epigenetic modifications on the path to cancer.</a> Protein Cell. 13 (12), 877-919 (2022).</li><li>Ntontsi, P., Photiades, A., Zervas, E., Xanthou, G., Samitas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+and+epigenetics+in+asthma.">Genetics and epigenetics in asthma.</a> Int J Mol Sci. 22 (5), 2412 (2021).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+metabolism:+looking+forward.">Cancer metabolism: looking forward.</a> Nat Rev Cancer. 21 (10), 669-680 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PremPS:+Predicting+the+impact+of+missense+mutations+on+protein+stability.">PremPS: Predicting the impact of missense mutations on protein stability.</a> PLoS Comput Biol. 16 (12), e1008543 (2020).</li><li>Li, M., Petukh, M., Alexov, E., Panchenko, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+the+impact+of+missense+mutations+on+protein-protein+binding+affinity.">Predicting the impact of missense mutations on protein-protein binding affinity.</a> J Chem Theory Comput. 10 (4), 1770-1780 (2014).</li><li>Hirsch, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+responses+to+PD-1+inhibition+and+their+molecular+characterization+in+six+patients+with+mismatch+repair-deficient+metastatic+cancer+of+the+digestive+system.">Clinical responses to PD-1 inhibition and their molecular characterization in six patients with mismatch repair-deficient metastatic cancer of the digestive system.</a> J Cancer Res Clin Oncol. 147 (1), 263-273 (2021).</li><li>Poulogiannis, G., Frayling, I. M., Arends, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+mismatch+repair+deficiency+in+sporadic+colorectal+cancer+and+Lynch+syndrome.">DNA mismatch repair deficiency in sporadic colorectal cancer and Lynch syndrome.</a> Histopathology. 56 (2), 167-179 (2010).</li><li>Chintamani, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+mismatched+repair+genes+and+their+correlation+with+clinicopathological+parameters+and+response+to+neo-adjuvant+chemotherapy+in+breast+cancer.">The expression of mismatched repair genes and their correlation with clinicopathological parameters and response to neo-adjuvant chemotherapy in breast cancer.</a> Int Semin Surg Oncol. 4, 5 (2007).</li><li>Deng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+expression+of+TMEM200A+is+associated+with+a+poor+prognosis+and+immune+infiltration+in+gastric+cancer.">High expression of TMEM200A is associated with a poor prognosis and immune infiltration in gastric cancer.</a> Pathol Oncol Res. 29, 1610893 (2023).</li><li>Stemmler, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cadherins+in+development+and+cancer.">Cadherins in development and cancer.</a> Mol Biosyst. 4 (8), 835-850 (2008).</li><li>Bill, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ANO1/TMEM16A+interacts+with+EGFR+and+correlates+with+sensitivity+to+EGFR-targeting+therapy+in+head+and+neck+cancer.">ANO1/TMEM16A interacts with EGFR and correlates with sensitivity to EGFR-targeting therapy in head and neck cancer.</a> Oncotarget. 6 (11), 9173-9188 (2015).</li><li>De Las Rivas, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+drug+resistance+induced+by+EMT:+novel+therapeutic+strategies.">Cancer drug resistance induced by EMT: novel therapeutic strategies.</a> Arch Toxicol. 95 (7), 2279-2297 (2021).</li><li>Tian, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SERPINH1+regulates+EMT+and+gastric+cancer+metastasis+via+the+Wnt/&#946;-catenin+signaling+pathway.">SERPINH1 regulates EMT and gastric cancer metastasis via the Wnt/&#946;-catenin signaling pathway.</a> Aging (Albany NY). 12 (4), 3574-3593 (2020).</li></ol>

Yazarlar herhangi bir çıkar çatışması olmadığını beyan ederler.

TMEM200A , kanser hücrelerinin çoğalması için gerekli olan bir TMEM ailesine aittir38. Farklı malignitelerde TMEM200A'nin değişken ekspresyonu daha az dikkat çekmiştir ve kapsamlı bir pan-kanser araştırması eksiktir. Bununla birlikte, TMEM transmembran protein ailesinin, çeşitli proteinlerle etkileşimler yoluyla kanser hücrelerini kötü huylu tutmada önemli olabileceğini gösteren kanıtlar birikmeye devam ediyor, örneğin, TMEM16A Ca2+ ile aktive...

Kanser, dünya çapında yüksek morbidite ve mortalite oranları nedeniyleküresel olarak insan sağlığını tehlikeye atan kalıcıbir halk sağlığı sorunu olarak ortaya çıkmıştır1 ve topluma ağır bir mali ve tıbbi yük oluşturmaktadır 2. Kanser belirteçlerininkeşfi sayesinde son yıllarda kanser tedavisinde önemli ilerlemeler kaydedilmiştir 3 ve araştırmacılar kanseri tedavi etmek için yeni tanı yöntemleri ve yeni ilaçlar geliştirmiştir. Bununla birlikte, kanserli bazı hastalar, ilaç direnci, ilaçların yan etkileri ve kimyasal duyarlılık gibi faktörler nedeniyle hala kötü prognoza sahiptir4. Bu nedenle, erken evre kanserlerin taranması ve tedavisi için yeni biyobelirteçlerin belirlenmesine acil ihtiyaç vardır5.
Zar proteinleri, hücrelere ve organel zarlarınabağlanabilen ve entegre olabilen proteinlerdir 6. Bunlar, zara bağlanma gücüne ve konumlarına bağlı olarak üç kategoride gruplandırılabilir: lipid bağlantılı proteinler, integral proteinler ve periferik zar proteinleri 7,8. Bir transmembran (TMEM) proteini, biyolojik membrandan tamamen veya kısmen geçen en az bir transmembran segment9'dan oluşan entegre bir membran proteinidir.
TMEM ailesine ait proteinlerin etki mekanizmaları tam olarak anlaşılamamış olsa da, bu proteinlerin çeşitli kanser türlerinde rol oynadığı bilinmektedir10. Birkaç TMEM proteini göçmen, proliferatif ve invaziv fenotiplerle ilişkilidir ve ekspresyonu genellikle hastanın prognozuile ilişkilidir 11. Bu nedenle TMEM ailesi üyeleri araştırmaların hedefi haline gelmiştir. TMEM ile ilgili mevcut raporların kapsamlı bir incelemesi, bunların çoğunlukla hücreler arası ve hücre içi sinyal12, bağışıklık ile ilişkili hastalıklar ve tümöroluşumu 10 ile ilişkili olduğunu ortaya koymuştur. Birçok TMEM ayrıca, örneğin plazma zarındaki iyon kanalları, sinyal iletim yollarının aktivasyonu ve ayrıca hücre kemotaksisi, adezyon, apoptoz ve otofajinin aracılık etmesi gibi önemli fizyolojik işlevlere sahiptir10. Bu nedenle, TMEM proteinlerinin tümörlerin saptanması ve tedavisinde önemli prognostik belirteçler olabileceğini varsaydık.
TMEM200A ekspresyonu mide kanserinde (GK) önemli ölçüde yüksektir. Kromozom 6q23.1 üzerinde sekiz ekzon ve tam uzunluğu 77.536 kb olan TMEM200A13'ün daha yüksek ekspresyonu, GC vakalarında genel sağkalım (OS) için kötü bir prognoz ile ilişkilendirilmiştir. Yine de ekspresyonundaki değişiklikler onkoloji çalışmalarında nadiren bildirilmiştir. Bu makale, halka açık farklı veri kümelerini kullanarak çeşitli kanser çalışmalarında terapötik bir hedef ve tümör tanı belirteci olarak TMEM200A'in yararlılığını karşılaştırmakta ve analiz etmektedir. UCSC Xena ve TCGA veri tabanlarından RNA-seq verilerinin yanı sıra gerçek zamanlı kantitatif polimeraz zincir reaksiyonu (qRT-PCR) ve western blotlama kullanarak pan-kanser tanısal ve prognostik bir biyobelirteç olarak TMEM200A'nin etkinliğini ve çeşitli insan kanseri türlerinde ekspresyon seviyelerini değerlendirdik. 
TMEM200A ekspresyon seviyelerinin mutasyon oranları, düzenleyici süreçler, tümör teşhisi ve prognozu, immün infiltrasyon ve immünoterapi üzerindeki etkisi, hesaplama araçları ve veri seti web sitelerinin bir karışımı kullanılarak daha fazla araştırıldı. TMEM200A'deki mutasyonları incelemek için CBioPortal ve Kanser Hücrelerinde Somatik Mutasyonlar Kataloğu (COSMIC) veri tabanları kullanıldı. TMEM200A immün infiltrasyonu nasıl etkilediğini anlamak için Sangerbox ve TISIDB web siteleri kullanıldı. TMEM200A işlevini araştırmak için Tümör İmmün Tek Hücre Merkezi (TISCH) çevrimiçi aracı ve CancerSEA veritabanı kullanıldı. Son olarak, TMEM200A'in GC hücrelerinin malign davranışı ve tümör gelişim fonksiyonu üzerindeki etkisini değerlendirmek için, bir in vitro testte bir fonksiyon kaybı deneyi yapıldı. Ek olarak, TMEM200A yıkımın PI3K/AKT sinyal yolunu ve GC'deki epitelyal-mezenkimal geçişi (EMT) nasıl etkilediğini değerlendirmek için western blotlama yapıldı.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Anti-AKT antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>60203-2-Ig</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-E-cadherin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>20874-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>10494-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-N-cadherin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>22018-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-P-AKT antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>66444-1-Ig</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-snail antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>13099-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Vimentin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>10366-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>AxyPrepMultisourceTotalRNAMini- 
			prep Kit</td>
			<td>Suzhou Youyi Landi Biotechnology Co., Ltd</td>
			<td>UEL-UE-MN-MS-RNA-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>BCA Protein Assay Kit</td>
			<td>Epizyme Biotech</td>
			<td>ZJ101L</td>
			<td></td>
		</tr>
		<tr>
			<td>CCK-8 reagent</td>
			<td>MedChemExpress</td>
			<td>HY-K0301-500T</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>CYAGEN BIOSCIENCES (GUANGZHOU) INC</td>
			<td>FBSSR-01021</td>
			<td></td>
		</tr>
		<tr>
			<td>GAPDH primer</td>
			<td>Sangon Biotech (Shanghai) Co., Ltd.</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): TGACATCAAGAAGGTG 
			GTGAAGCAG; Reverse primer (5&#8217;-3&#8217;): GTGTCGCTGTTGAAG 
			TCAGAGGAG</td>
		</tr>
		<tr>
			<td>HighGene plus Transfection reagent</td>
			<td>ABclonal</td>
			<td>RM09014P</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP-conjugated Affinipure Goat Anti-Mouse lgG (H+L)</td>
			<td>Proteintech Group, Inc</td>
			<td>SA00001-1</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP-conjugated Affinipure Goat Anti-Rabbit lgG (H+L)</td>
			<td>Proteintech Group, Inc</td>
			<td>SA00001-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Human gastric mucosal epithelial GES-1 cells</td>
			<td>Guangzhou Cellcook Biotech Co.,Ltd.</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Human STAD HGC-27 cells</td>
			<td>Procell Life Science&#38;Technology Co.,Ltd</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Human STAD SGC-7901 cells</td>
			<td>Procell Life Science&#38;Technology Co.,Ltd</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MonAmp SYBR Green qPCR Mix (None ROX)</td>
			<td>Mona (Suzhou) Biotechnology Co., Ltd</td>
			<td>MQ10101S</td>
			<td></td>
		</tr>
		<tr>
			<td>MonScript RTIII All-in-One Mix with dsDNase&#160;&#160;</td>
			<td>Mona (Suzhou) Biotechnology Co., Ltd</td>
			<td>MR05101M</td>
			<td></td>
		</tr>
		<tr>
			<td>Omni-ECL Femto Light Chemiluminescence Kit</td>
			<td>Epizyme Biotech</td>
			<td>SQ201</td>
			<td></td>
		</tr>
		<tr>
			<td>PAGE Gel Fast Preparationb Kit&#160;</td>
			<td>Epizyme Biotech</td>
			<td>PG111</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-streptomycin (Pen-Strep)</td>
			<td>Beijing Solarbio Science &#38; Technology Co.,Ltd</td>
			<td>P1400-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyvinylidene difluoride (PVDF) membrane</td>
			<td>Merck KGaA</td>
			<td>IPVH00010-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein Free Rapid Blocking Buffer</td>
			<td>Epizyme Biotech</td>
			<td>PS108P</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis solution</td>
			<td>Beijing Solarbio Science &#38; Technology Co., Ltd</td>
			<td>R0010</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 complete medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>C11875500BT</td>
			<td></td>
		</tr>
		<tr>
			<td>Skimmed milk</td>
			<td>Campina: Elk</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>TBST buffer solution</td>
			<td>Beijing Solarbio Science &#38; Technology Co., Ltd</td>
			<td>T1082</td>
			<td></td>
		</tr>
		<tr>
			<td>The protein loading buffer</td>
			<td>Epizyme Biotech</td>
			<td>LT101S</td>
			<td></td>
		</tr>
		<tr>
			<td>TMEM200A knockdown plasmid</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>TMEM200A primer</td>
			<td>Sangon Biotech (Shanghai) Co., Ltd.</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): AAGGCGGTGTGGTGGTTCG; Reverse primer (5&#8217;-3&#8217;): GATTTTGGTCTCTTTGTCACGGTT</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA1</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): ACAACTGATGATAAGACCAG; Reverse primer (5&#8217;-3&#8217;): TGTTGACTACTATTCTGGTC</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA2</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): CGTGTGAATGTCAATGACTG; Reverse primer (5&#8217;-3&#8217;): GCACACTTACAGTTACTGAC</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA3</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): ACAACCACAACATCTGCCCG; Reverse primer (5&#8217;-3&#8217;): TGTTGGTGTTGTAGACGGGC</td>
		</tr>
		<tr>
			<td>Transmembrane protein 200A Antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>48081-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CO2 cell culture incubator</td>
			<td>Haier Group</td>
			<td>PYXE-80IR</td>
			<td></td>
		</tr>
		<tr>
			<td>Electrophoresis instrument</td>
			<td>Bio-RAD</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence quantitative PCR instrument</td>
			<td>Bio-RAD</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gel Imaging System (Tanon 5200)</td>
			<td>Tanon Science &#38; Technology Co., Ltd</td>
			<td>LAB-0002-0007-SHTN</td>
			<td></td>
		</tr>
		<tr>
			<td>Multifunctional Enzyme Labeler</td>
			<td>Berthold</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

multiomics analysis of tmem200a as a pan-cancer biomarker

TMEM200A transmembran proteinin insan kanserleri ve immün infiltrasyon ile ilişkili olduğu bilinmektedir. Burada, yaygın kanserlerde TMEM200A fonksiyonunu multiomik analiz ile değerlendirdik ve sonuçları doğrulamak için mide hücrelerinin in vitro hücre kültürlerini kullandık. Çeşitli insan kanser türlerinde TMEM200A ekspresyonu, UCSC Xena veri tabanından alınan RNA-seq verileri kullanılarak değerlendirildi. Biyoinformatik analiz, TMEM200A'in tanısal ve prognostik bir biyobelirteç olarak potansiyel bir rolünü ortaya koymuştur.
Normal mide ve kanser hücre hatlarının kültürleri büyütüldü ve TMEM200A yıkıldı. TMEM200A ekspresyon düzeyleri kantitatif gerçek zamanlı polimeraz zincir reaksiyonu ve western blotlama kullanılarak ölçüldü. Daha sonra mide kanseri (GC) hücrelerinin malign davranışı ve tümör oluşumunda TMEM200A rollerini belirlemek için in vitro fonksiyon kaybı çalışmaları kullanıldı. Yıkımın GC'de epitelyal-mezenkimal geçiş (EMT) ve PI3K/AKT sinyal yolu üzerindeki etkisini değerlendirmek için Western blotları kullanıldı. Biyoinformatik analiz, TMEM200A GC'de yüksek düzeyde eksprese edildiğini göstermiştir.
GC hücrelerinin proliferasyonu, vimentin, N-kaderin ve Snai proteinlerini de azaltan ve AKT fosforilasyonunu inhibe eden TMEM200A yıkımı ile inhibe edildi. PI3K/AKT sinyal yolunun, GC gelişiminin TMEM200A aracılı düzenlenmesinde de rol oynadığı görülmüştür. Burada sunulan sonuçlar , TMEM200A'in EMT'yi etkileyerek tümör mikroçevresini düzenlediğini göstermektedir. TMEM200A ayrıca PI3K / AKT sinyali yoluyla EMT'yi etkileyebilir, böylece tümör mikroçevresini etkileyebilir. Bu nedenle, pan-kanserlerde, özellikle GC'de, TMEM200A potansiyel bir biyobelirteç ve onkogen olabilir.

Cancer has emerged as a persistent public health issue endangering human health globally1due to its high morbidity and mortality rates worldwide, posing a heavy financial and medical burden to society2. Significant advancements in cancer therapy have been achieved in recent years thanks to the discovery of cancer markers3, and researchers have developed novel diagnostic methods and new drugs to treat cancer. However, some patients with cancer still have poor prognoses because of factors such as medication resistance, side effects of drugs, and chemical sensitivity4. Therefore, there is an urgent need for identifying new biomarkers for screening and treating early-stage cancers5.
Membrane proteins are proteins that can bind and integrate into cells and organelle membranes6. These can be grouped into three categories depending on the strength of binding to the membrane and their location: lipid-anchored proteins, integral proteins, and peripheral membrane proteins7,8. A transmembrane (TMEM) protein is an integral membrane protein that consists of at least one transmembrane segment9, which passes either completely or partially through the biological membrane. 
Although the mechanisms of action of proteins belonging to the TMEM family are not well understood, these proteins are known to be involved in several types of cancers10. Several TMEM proteins are associated with migratory, proliferative, and invasive phenotypes, and their expression is often associated with a patient's prognosis11. Therefore, TMEM family members have become the target of research. A comprehensive review of existing reports on TMEM revealed that they are mostly associated with inter- and intracellular signaling12, immune-related diseases, and tumorigenesis10. Many TMEMs also possess important physiological functions, for example, ion channels in the plasma membrane, activation of signal transduction pathways, as well as the mediation of cell chemotaxis, adhesion, apoptosis, and autophagy10. Therefore, we hypothesized that TMEM proteins may be important prognostic markers in the detection and treatment of tumors.
TMEM200A expression is significantly elevated in gastric cancer (GC). Higher expression of TMEM200A13, which has eight exons and a full length of 77.536 kb on chromosome 6q23.1, has been linked to a poor prognosis for overall survival (OS) in cases of GC. Yet the changes in its expression have rarely been reported in oncology studies. This article compares and analyzes the usefulness of TMEM200A as a therapeutic target and tumor diagnostic marker in various cancer studies using different publicly available datasets. We assessed the effectiveness of TMEM200A as a pan-cancer diagnostic and prognostic biomarker as well as its expression levels in various human cancer types using RNA-seq data from the UCSC Xena and TCGA databases, as well as by real-time quantitative polymerase chain reaction (qRT-PCR) and western blotting. 
The effect of TMEM200A expression levels on mutation rates, regulatory processes, tumor diagnosis and prognosis, immune infiltration, and immunotherapy was further investigated using a mix of computational tools and dataset websites. CBioPortal and the Catalog of Somatic Mutations in Cancer Cells (COSMIC) databases were used to examine mutations in TMEM200A. Sangerbox and TISIDB websites were utilized to understand how TMEM200A influences immune infiltration. The Tumor Immune Single Cell Center (TISCH) online tool and CancerSEA database were used to investigate the function of TMEM200A. Finally, to assess the impact of TMEM200A on the malignant behavior and tumor development function of GC cells, a loss-of-function experiment was conducted in an in vitro assay. Additionally, western blotting was performed to assess how TMEM200A knockdown affected the PI3K/AKT signaling pathway and the epithelial-mesenchymal transition (EMT) in GC.

Yazar Gündemi: Mide Kanserinde Transmembran Protein Ailesiyle İlgili Belirteçlerin Ortaya Çıkarılması ve Hedefe Yönelik Tedaviler için Çıkarımlar 

Pan-Kanser Biyobelirteci Olarak TMEM200A'in Multiomik Analizi

Significant advancements have been made in the investigation of cancer biomarkers. Nevertheless, the extract function of tumor-related matters associated with transmembrane protein family remains unidentified. As a result, our research on the TMEM200A in gastric cancer has generated novel research directions for related cells.In this study, we used the combination of online database prediction and experimental technique validation, which simplifies the research steps and the stem cell cost of experiment in related field. In future, our laboratory will focus on exploring the specific mechanism of tumor in gastric cancer, searching for the association between glycosylation modification and the metabolic recording, and identifying find new targets for gastric cancer treatment.

Çeşitli kanserlerde TMEM200A ekspresyonu Şekil 1'de gösterildiği gibi, ilk olarak farklı veri tabanları aracılığıyla çeşitli kanserlerde TMEM200A diferansiyel ekspresyon seviyelerini analiz ettik. Kolanjiokarsinom (CHOL), baş ve boyun skuamöz hücreli karsinomu (HNSC), renal berrak hücreli karsinom (KIRC), renal papiller hücreli karsinom (KIRP), hepatosellüler karsinom (LIHC), STAD ve tiroid karsinomunda (THC...

Watch this Scientific Journal Video about Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies at JoVE.com

Burada, kanserde TMEM200A biyolojik fonksiyonlarını incelemek için çoklu biyoinformatik araçların birleştirildiği bir protokol sunulmaktadır. Ek olarak, biyoinformatik tahminleri deneysel olarak da doğruluyoruz.

The transmembrane protein, TMEM200A, is known to be associated with human cancers and immune infiltration. Here, we assessed the function of TMEM200A in ...

Kanser biyobelirteçlerinin araştırılmasında önemli ilerlemeler kaydedilmiştir. Bununla birlikte, transmembran protein ailesi ile ilişkili tümörle ilgili maddelerin ekstrakt işlevi tanımlanamamıştır. Sonuç olarak, mide kanserindeki TMEM200A üzerine yaptığımız araştırma, ilgili hücreler için yeni araştırma yönleri üretti.Bu çalışmada, ilgili alanda araştırma adımlarını ve kök hücre deney maliyetini basitleştiren çevrimiçi veri tabanı tahmini ve deneysel teknik validasyonu kombinasyonu kullanıldı. Gelecekte, laboratuvarımız mide kanserinde tümörün spesifik mekanizmasını keşfetmeye, glikozilasyon modifikasyonu ile metabolik kayıt arasındaki ilişkiyi araştırmaya ve mide kanseri tedavisi için yeni hedefler bulmaya odaklanacaktır.

multiomics-analysis-of-tmem200a-as-a-pan-cancer-biomarker

Research

JoVE Journal

Cancer Research

Multiomics Analysis of TMEM200A as a Pan-Cancer Biomarker

851 Görüntüleme.  Youjiang Medical University for Nationalities. Kanser biyobelirteçlerinin araştırılmasında önemli ilerlemeler kaydedilmiştir. Bununla birlikte, transmembran protein ailesi ile ilişkili tümörle ilgili maddelerin ekstrakt işlevi tanımlanamamıştır. Sonuç olarak, mide kanserindeki TMEM200A üzerine yaptığımız araştırma, ilgili hücreler için yeni araştırma yönleri üretti.Bu çalışmada, ilgili alanda araştırma adımlarını ve kök hücre deney maliyetini basitleştiren çevrimiçi veri tabanı tahmini ve ...

Video: Yazar Gündemi: Mide Kanserinde Transmembran Protein Ailesiyle İlgili Belirteçlerin Ortaya Çıkarılması ve Hedefe Yönelik Tedaviler için Çıkarımlar 