J.L.S. is supported by the German Research Foundation (DFG) under Germany&#39;s Excellence Strategy (EXC2151-390873048), as well as under SCHU 950/8-1; GRK 2168, TP11; CRC SFB 1454 Metaflammation, IRTG GRK 2168, WGGC INST 216/981-1, CCU INST 217/988-1, the BMBF-funded excellence project Diet-Body-Brain (DietBB); and the EU project SYSCID under grant number 733100. M.B. is supported by DFG (IRTG2168-272482170, SFB1454-432325352). L.B. is supported by DFG (ImmuDiet BO 6228/2-1 - Project number 513977171) and Germany&#39;s Excellence Strategy (EXC2151-390873048). Images created with BioRender.com.

This protocol follows the guidelines of the local ethics committees of the University of Bonn.
1. Preparation of buffers, solutions, and equipment
<ol>
	<li>Prepare the solutions and gather the materials described in Table of Materials.</li>
	<li>Heat up the water bath to 37 &#176;C and warm up the complete growth medium (RPMI-1640 + 10% fetal calf serum (FCS) + 1% penicillin/streptomycin).</li>
	<li>For cell harvesting, use ice-cold phosphate-buffered salin...

Transcriptome Profiling for High-Throughput Drug Screening

<ol>
	<li>Hughes, J. P., Rees, S., Kalindjian, S. B., Philpott, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Principles+of+early+drug+discovery.">Principles of early drug discovery.</a> Br J Pharmacol. 162 (6), 1239-1249 (2011).</li><li>Yang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+transcriptome+profiling+in+drug+and+biomarker+discovery.">High-throughput transcriptome profiling in drug and biomarker discovery.</a> Front Genet. 11, 19 (2020).</li><li>Bonaguro, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+guide+to+systems-level+immunomics.">A guide to systems-level immunomics.</a> Nat Immunol. 23 (10), 1412-1423 (2022).</li><li>Carraro, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoding+mechanism+of+action+and+sensitivity+to+drug+candidates+from+integrated+transcriptome+and+chromatin+state.">Decoding mechanism of action and sensitivity to drug candidates from integrated transcriptome and chromatin state.</a> ELife. 11, 78012 (2022).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart-seq2+for+sensitive+full-length+transcriptome+profiling+in+single+cells.">Smart-seq2 for sensitive full-length transcriptome profiling in single cells.</a> Nat Methods. 10 (11), 1096-1098 (2013).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-length+RNA-seq+from+single+cells+using+Smart-seq2.">Full-length RNA-seq from single cells using Smart-seq2.</a> Nat Protoc. 9 (1), 171-181 (2014).</li><li>De Domenico, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+workflow+for+single-cell+transcriptomics+on+infectious+diseases+including+COVID-19.">Optimized workflow for single-cell transcriptomics on infectious diseases including COVID-19.</a> STAR Protoc. 1 (3), 100233 (2020).</li><li>Dobin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ultrafast+universal+RNA-seq+aligner.">ultrafast universal RNA-seq aligner.</a> Bioinformatics. 29 (1), 15-21 (2013).</li><li>Patro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salmon+provides+fast+and+bias-aware+quantification+of+transcript+expression.">Salmon provides fast and bias-aware quantification of transcript expression.</a> Nat Methods. 14 (4), 417-419 (2017).</li><li>Love, M. I., Huber, W., Anders, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Moderated+estimation+of+fold+change+and+dispersion+for+RNA-seq+data+with+DESeq2.">Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.</a> Genome Biol. 15 (12), 550 (2014).</li><li>Frankish, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GENCODE+reference+annotation+for+the+human+and+mouse+genomes.">GENCODE reference annotation for the human and mouse genomes.</a> Nucleic Acids Res. 47, D766-D773 (2019).</li></ol>

The authors declare no competing interests.

Drug discovery and drug development can greatly benefit from the holistic view of cellular processes that bulk transcriptomics can provide. Nevertheless, this approach is often limited by the high cost of the experiment with standard bulk RNA-seq protocol, prohibiting its application in academic settings as well as its potential for industrial scalability.
The most critical steps of the protocol are cell thawing and the initial steps of library preparation. Ensuring high viability of the cells...

The development of new drugs is a complex and time-consuming process that involves identifying potential drugs and their targets, optimizing and synthesizing drug candidates, and testing their efficacy and safety in preclinical and clinical trials1. Traditional methods for drug screening, i.e., the systematic assessment of libraries of candidate compounds for therapeutic purposes, involve the use of animal models or cell-based assays to test the effects on specific targets or pathways. While these methods have been successful in identifying drug candidates, they often did not provide sufficient insights into the complex molecular mechanisms underlying drug efficacy and also toxicity and mechanisms of potential side effects.
Assessing genome-wide transcriptional states presents a powerful approach to overcome current limitations in drug screening, as it enables comprehensive assessments of gene expression in response to drug treatments2. By measuring RNA transcripts in a genome-wide fashion expressed at a given time, transcriptomics aims to provide a holistic view of the transcriptional changes that occur in response to drugs, including changes in gene expression patterns, alternative splicing, and non-coding RNA expression3. This information can be used to determine drug targets, predict drug efficacy and toxicity, and optimize drug dosing and treatment regimens.
One of the key benefits of combining transcriptomics with unbiased drug screening is the potential to identify new drug targets that have not been previously considered. Conventional drug screening approaches often focus on established target molecules or pathways, hindering the identification of new targets and potentially resulting in drugs with unforeseen side effects and restricted effectiveness. Transcriptomics can overcome these limitations by providing insights into the molecular changes that occur in response to drug treatment, uncovering potential targets or pathways that may not have been previously considered2.
In addition to the identification of new drug targets, transcriptomics can also be used to predict drug efficacy and toxicity. By analyzing the gene expression patterns associated with drug responses, biomarkers can be developed that can be used to predict a patient's response to a particular drug or treatment regimen. This can also help to optimize drug dosing and reduce the risk of adverse side effects4.
Despite its potential benefits, the cost of transcriptomics remains a significant barrier to its widespread application in drug screening. Transcriptomic analysis requires specialized equipment, technical expertise, and data analysis, which can make it challenging for smaller research teams or organizations with limited funding to utilize transcriptomics in drug screening. However, the cost of transcriptomics has been steadily decreasing, making it more accessible to the research communities. Additionally, advancements in technology and data analysis methods have made transcriptomics more efficient and cost-effective, further increasing its accessibility2.
In this protocol, we describe a high-dimensional and explorative system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics analysis5,6. With this protocol, it is possible to reduce the cost per sample to 1/6th of the current cost of commercial solutions for full-length mRNA sequencing. The protocol requires only standard laboratory equipment, the only exception being the use of short-read sequencing technologies, which can be outsourced if sequencing instruments are not available in-house. The optimized mini-bulk protocol provides information-rich biological signals at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules.
The aim of the experiment is to screen for drug activity on PBMCs in different biological contexts. This protocol can be applied to any biological question where several drugs should be tested with a transcriptomic readout, giving a transcriptome-wide view of the cellular effect of the treatment.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>50 mL conical tube</td>
			<td>fisher scientific</td>
			<td>10203001</td>
			<td></td>
		</tr>
		<tr>
			<td>Adhesive PCR Plate Seals</td>
			<td>Thermo Fisher Scientific</td>
			<td>AB0558</td>
			<td></td>
		</tr>
		<tr>
			<td>Amplicon Tagment Mix (ATM)</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td>Nextera XT DNA Library Prep Kit (96 samples)</td>
		</tr>
		<tr>
			<td>AMPure XP beads</td>
			<td>Beckman Coulter</td>
			<td>A 63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Betaine&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>61962</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture grade 96-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>260860</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture vacuum pump (VACUSAFE)</td>
			<td>Integra Bioscience</td>
			<td>158300</td>
			<td></td>
		</tr>
		<tr>
			<td>Deoxynucleotide triphosphates (dNTPs) mix 10 mM each</td>
			<td>Fermentas</td>
			<td>R0192</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma-Aldrich</td>
			<td>276855</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT (100 mM)</td>
			<td>Invitrogen</td>
			<td>18064-014</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Sigma-Aldrich</td>
			<td>798681</td>
			<td>for adherent cells</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Sigma-Aldrich</td>
			<td>51976</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Thermo Fisher Scientific</td>
			<td>26140079</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (10 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171203</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (100 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171403</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (20 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171303</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (200 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171503</td>
			<td></td>
		</tr>
		<tr>
			<td>Guanidine Hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td>G3272</td>
			<td></td>
		</tr>
		<tr>
			<td>ISPCR primer (10 &#181;M)</td>
			<td>Biomers.net GmbH</td>
			<td>SP10006</td>
			<td>5&#8242;-AAGCAGTGGTATCAACGCAGAG 
			T-3&#8242;</td>
		</tr>
		<tr>
			<td>KAPA HiFi HotStart ReadyMix (2X)</td>
			<td>KAPA Biosystems</td>
			<td>KK2601</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium chloride (MgCl2)&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>M8266</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic stand 96</td>
			<td>Ambion</td>
			<td>AM10027</td>
			<td></td>
		</tr>
		<tr>
			<td>Neutralize Tagment (NT) Buffer&#160;</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td>Nextera XT DNA Library Prep Kit (96 samples), alternatively 0.2 % SDS</td>
		</tr>
		<tr>
			<td>Nextera-compatible indexing primer</td>
			<td>Illumina</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>Invitrogen</td>
			<td>10977049</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9624</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR 96-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>AB0600</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR plate sealer</td>
			<td>Thermo Fisher Scientific</td>
			<td>HSF0031</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin / Streptomycin&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>15070063</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 4 fluorometer</td>
			<td>Invitrogen</td>
			<td>15723679</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant RNase inhibitor (40 U/ul)</td>
			<td>TAKARA</td>
			<td>2313A</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI-1640 cell culture medium&#160;</td>
			<td>Gibco</td>
			<td>61870036</td>
			<td>If not working with PBMCs, adjust to cell type&#160;</td>
		</tr>
		<tr>
			<td>SMART dT30VN primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#39; Bio-AAGCAGTGGTATCAACGCAGAG 
			TACT30VN-3</td>
		</tr>
		<tr>
			<td>Standard lab equipment</td>
			<td>various</td>
			<td>various</td>
			<td>e.g. centrifuge, ice machine, ice bucket, distilled water, water bath</td>
		</tr>
		<tr>
			<td>SuperScript II Reverse Transcriptase (SSRT II)</td>
			<td>Thermo Fisher Scientific</td>
			<td>18064-014</td>
			<td></td>
		</tr>
		<tr>
			<td>SuperScript II Reverse Transcriptase (SSRT II) buffer (5x)</td>
			<td>Thermo Fisher Scientific</td>
			<td>18064-014</td>
			<td></td>
		</tr>
		<tr>
			<td>Tagment DNA Buffer (TD)</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td>Nextera XT DNA Library Prep Kit (96 samples)</td>
		</tr>
		<tr>
			<td>TapeStation system 4200</td>
			<td>Agilent</td>
			<td>G2991BA</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermocycler (S1000)</td>
			<td>Bio-Rad</td>
			<td>1852148</td>
			<td></td>
		</tr>
		<tr>
			<td>TSO-LNA (100 uM)</td>
			<td>Eurogentec</td>
			<td></td>
			<td>5&#39; Biotin AAGCAGTGGTATCAACGCAGAG 
			TACAT(G)(G){G</td>
		</tr>
		<tr>
			<td>Vortex-Genie 2 Mixer</td>
			<td>Sigma-Aldrich</td>
			<td>Z258415</td>
			<td></td>
		</tr>
	</tbody>
</table>

cost-efficient transcriptomic-based drug screening

Transcriptomics allows&#160;to obtain comprehensive insights into cellular programs and their responses to perturbations. Despite a significant decrease in the costs of library production and sequencing in the last decade, applying these technologies at the scale necessary for drug screening remains prohibitively expensive, obstructing the immense potential of these methods. Our study presents a cost-effective system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics. The optimized mini-bulk protocol provides informative biological signals at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules. Depending on the chosen treatment and incubation time, this protocol will result in sequencing libraries within approximately 2 days. Due to several stopping points within this protocol, the library preparation, as well as the sequencing, can be performed time-independently. Processing simultaneously a high number of samples is possible; measurement of up to 384 samples was tested without loss of data quality. There are also no known limitations to the number of conditions and/or drugs, despite considering variability in optimal drug incubation times.

Author Spotlight: Cost-Effective Transcriptomic Drug Screening - Unlocking New Targets 

Cost-Efficient Transcriptomic-Based Drug Screening

Transcriptomics enable us to gain a deep understanding of cellular program and their reaction towards external changes. However, despite a considerable reduction in library production and sequencing costs over the last decades, the application of this technology, at the scale needed for drug screening, is still unaffordable, hindering the great potential of these methods. Our study present a cost-effective system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics.The optimized mini-bulk protocol provides informative biological signal at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules. One of the key benefits of combining transcriptomics with unbiased drug screening is the potential to identify new drug targets that have not been previously considered. Conventional drug screening approaches often focus on established target molecules or pathways, hindering the identification of new targets, and potentially resulting in drugs with unforeseen side effects and restricted effectiveness.

Following the reported protocol, human PBMCs were seeded, treated with different immunomodulatory drugs and, after different incubation times, harvested for bulk transcriptomic analysis using the sequencing protocol (Figure 1).
Ideal drug concentrations and incubation times for test compounds should be identified upstream this protocol with the help of complementary experimental strategies and based on the specific scientific question. In most cases, 2 - 4 h and 2...

Watch this Scientific Journal Video about Cost-Effective Transcriptomic Drug Screening — Unlocking New Targets at JoVE.com

This protocol describes a workflow from ex vivo or in vitro cell cultures to transcriptomic data pre-processing for cost-effective transcriptome-based drug screening.

Transcriptomics allows&#160;to obtain comprehensive insights into cellular programs and their responses to perturbations. Despite a significant decrease ...

cost-efficient-transcriptomic-based-drug-screening

Research

JoVE Journal

Biology

Drug Screening Using Peripheral Blood Mononuclear Cells (PBMCs) and Cell Lysate Preparation for mRNA Sequencing

cDNA Library Preparation from the Drug Treated-Peripheral Blood Mononuclear Cell (PBMC) Lysate for mRNA Sequencing

CDNA Library Preparation from the Drug Treated-Peripheral Blood Mononuclear Cell (PBMC) Lysate for mRNA Sequencing  

mRNA Sequencing to Understand the Cellular Effect of Drug Treatment

MRNA Sequencing to Understand the Cellular Effect of Drug Treatment  

815 Views.  German Center for Neurodegenerative Diseases (DZNE) eV..  This protocol describes a workflow from ex vivo or in vitro cell cultures to transcriptomic data pre-processing for cost-effective transcriptome-based drug screening. 

Transcriptome Profiling for High-Throughput Drug Screening

Özet