Biz laboratuvar yardım için Angelika Berg teşekkür ederim. Bu çalışma Max Planck Derneği ve Mikrobiyal İletişim (JSMC) için Jena Okulu tarafından desteklenen ve finanse edilmiştir.

1.. Böcek Yetiştirme <ol><li> Satın alma veya spodoptera yumurta clutches elde kendi Yetiştiricilikten littoralis&#39;e. Kuluçka kadar oda sıcaklığında (RT) steril Petri tabaklarında bunları muhafaza edin. </li><li> Aşağıdaki gibi yetiştirme böcekler için yapay bir diyet hazırlayın: <ol><li> 100 ml su gecede 500 g öğütülmüş beyaz fasulye bekletin. </li><li> H 2 O damıtılmış 1.000 ml 9.0 g askorbik asit ve 75 g agar ekleyin ve daha sonra kaynatın. </li><li> Karışım soğumaya olsun ve (beyaz mumsu bir katı madde kanşımına) katılaştığı zaman, kullanılana kadar 4 ° C&#39;de saklayın. </li></ol></li><li> Aydınlatma 16 saat ve 8 saat karanlık ile uzun gün rejimde temiz plastik bir kutu ve 23-25 ​​° C de, suni diyet üzerinde arka bunları için yeni çıkmış larva aktarın. Larvalar altı larva instars geçmesi kadar her gün yiyecek değiştirin. </li></ol> Metabolik olarak aktif Gut Bakterilerde DNA 2.. 13 C-etiketleme <ol><li> Damıtılmış ve iyonu giderilmiş su (GKD 2 O) ile tamamen 13C-etiketli glikoz 186,1 mg çözülür ve SIP deney için suni diyetin 100 g ile iyice karıştırın. Yapay diyet içinde 10 mM&#39;lik bir son 13 C-glikoz konsantrasyonunu sağlamak. Bu S. bağırsakta in situ glikoz konsantrasyonunu taklit Shao et al pamuk bitkileri üzerine littoralis larvası besleme. (teslim). </li><li> Transferi 9-15 taze 13 C-glikoz içeren steril plastik Petri (Petri kabı başına bir larva) için yetiştirme kutusundan sağlıklı ikinci dönem larva yapay diyet çivili. Tarif edildiği gibi, kontrol grubuna beslemek için, doğal glükoz (12 C-glukoz), aynı miktarda ihtiva eden yapay bir diyet kullanın. </li><li> Kuluçka dönemi (1 gün) sırasında sık sık yapay diyet yenileyin. Adım 1.3 &#39;de olduğu gibi yetiştirme koşulları kullanın. </li><li> Daha sonra işleme (DNA ekstraksiyon) için her tedavi dokuz larvaları toplayın. Herüç kişi tarafından teşkil edilir çoğaltmak, muamele başına en az üç suret olun. </li></ol> 3. Böcek Diseksiyon <ol><li> Temiz ve etanol% 70 (Araçlar = Vannas makas, forseps ve ince tek bıçaklı bisturi) ile işin başında kesme aletleri dezenfekte. </li><li> Yumuşak bir forseps ile böcekler al ve damıtılmış su ile yüzeysel olarak kendi yıkayın. Onları uyutmak için en az 30 dakika süreyle buz koyun. </li><li> Hala onları öldürmek için 1 saat boyunca 0 ° C&#39;de yer onları anestezi iken. Birkaç dakika için etanol (% 70) onları daldırarak yüzeysel ölü böcekler dezenfekte edin. </li><li> PH&#39;ı 7.4 &#39;e ayarlayın, yaklaşık 15 ml 1 x PBS, steril bir Petri kabı (1XPBS = 137 mM NaCl, 2.7 mM KCI, 4.3 mM Na 2 HPO 4, 1,47 mM KH 2 PO 4 üzerinde biriken bir hacim içine böcek diseksiyon , otoklav). Tam solut dalmış bütün böcek vücuda sahip emin olunbütün kesme süresi boyunca iyon. </li><li> Kafasına başlar ve anüs bitirmek, sağ ve böceğin sol tarafı boyunca deride bir kesi yaparak diseksiyonu başlayın. Tüm cilt, Malpighi tübüllerini ve vücut yağ çıkarın. Bağırsakları açık kesmeden önce taze tampon değiştirin. Bölüm öne-, orta-, ve hindgut de bağırsak gerekli. Dondurucuda saklayın doku (-80 -20 ° C) kadar DNA ekstraksiyon </li></ol> 4. Ekstraksiyon ve DNA amplifikasyon <ol><li> 1.5 ml steril santrifüj tüpü içerisinde böcek doku koyun ve bir vakum konsantratör cihazında 45 ° C&#39;de tüm örnekleri kurutun. Steril plastik bir havan tokmağı ile kurutuldu, doku ezmek. </li><li> Toprak DNA ekstraksiyonu için uygun bir kit kullanılarak genomik DNA ekstrakte edin. Kitin reaksiyon tüpüne kuru doku aktarın ve üretici tarafından belirtildiği gibi talimatları takip edin. </li><li> Bir spektrofotometre kullanılarak, son Yıkanarak ayrılan DNA ilk konsantrasyonunu belirleyin. </li><li> Verifve 1492r (5 - GGTTACCTTGTTACGACTT -3) - eubacterial genel primerler 27f (AGAGTTTGATCCTGGCTCAG -3 5) kullanılarak, bir PCR teşhis tahlili hazırlayarak böcek bağırsaktan mikrobiyal metagenomic DNA ya başarılı bir şekilde uzaklaştırılması. Aşağıdaki gibi PCR reaksiyonu ayarlayın: <ol><li> 1x tamponu, 1.5 mM MgCI2, 10 mM, dört deoksinükleosit trifosfat (dNTP), 2.5 U Taq DNA Polymerase, her bir primerden 0.5 mM ve şablon olarak ekstre DNA 60 ng ihtiva eden bir 50 ul reaksiyon karışımı ayarlayın. </li><li> 30 saniye boyunca 55 ° C &#39;de 45 saniye, tavlama için 94 ° C ve 1 dakika boyunca 72 ° C&#39;de uzatma:; 35 devir ile takip olunan, ilk 3 dakika boyunca 94 ° C&#39; de denatürasyon aşağıdaki gibidir: bir PCR kullanılarak PCR reaksiyonları . 10 dakika boyunca 72 ° C&#39;de son uzatma adımı kullanın. </li><li> Bir% 1 agaroz başarılı PCR amplifikasyon etidyum bromid (EB) ile boyanmış jel (100 1x TAE tampon ml ve 1 ul EB ile leke agaroz 1 g çözülür) elektroforez edin. Th mevduat 5 uljel cebine 6x yükleme boyası + 1ul e PCR ürünü. (1x TAE pH 8&#39;e ayarlamak, 40 mM Tris-Base, 20 mM buzlu asetik asit, 1 mM EDTA =). </li><li> Ca için 300 V, 115 mA 1xTAE tamponu kullanılarak jel çalıştırın. Bir elektroforez odası içinde 20 dakika. Bir jel dokümantasyon odasını (bir dijital kamera ve bilgisayara bağlı UV transilluminator&#39;de) kullanarak jel gözlemlemek ve aynı zamanda yüklenen gen işaretleyici ile nihai ürünün boyutunu karşılaştırmak, amplikonlarının doğru boyutu yaklaşık 1.5 kb olmalıdır. </li></ol></li><li> Tercihen, derin dondurucu koşullarda PCR ürünlerini saklamak -80 ° C, kullanıma kadar. </li></ol> 5. DNA Ayırma-CsCl Gradient Ultrasantrifüj <ol><li> Aşağıdaki gibi ultra-santrifüj için geçişlerini için reaktifler hazırlayın: <ol><li> Yavaş yavaş GKD 2 O CsCl 603,0 g çözülmesiyle bir 7.163 M sezyum klorür (CsCl) çözeltisi hazırlayın ve 500 ml&#39;lik bir nihai hacme kadar doldurun. </li><li> Doğru deüç kere ile üç basamaklı bir bakiye üzerinde 1.0 ml&#39;lik bir şişe tartılarak hazırlanan CsCl çözeltinin yoğunluğunu termine. Bu genellikle 1,88 ve 1,89 g / ml &#39;den, oda sıcaklığında değişmektedir. </li><li> 1 M Tris-HCl (pH 8.0), 0.5 M EDTA, 1 ml (pH 8) ve son olarak 3.75 g KCl, 50 ml birleştirerek, gradyan tamponu (100 mM Tris, 100 mM KCI, 1 mM EDTA) hazırlanması GKD 2 O. kullanarak 500 ml hacmi (0.22 mikron) filtre bu çözüm ve sterilize otoklav. </li></ol></li><li> DNA Ayırma <ol><li> Noktası 4.3 &#39;de olduğu gibi muamele edilmiş böceklerin ölçülen bireysel DNA konsantrasyonu, tespit edildikten sonra, birlikte bir tekrarında tekabül eden ve her biri, eşit olarak toplanmış numuneye katkı sağlamak için kendi DNA konsantrasyonu normalize bu böcekler havuz. DNA 500-5,000 ng (yine nihai konsantrasyonunun ölçülmesi) içindeki bir nihai konsantrasyonu, ultra santrifüjleme işlemi 21 için uygundur. </li><li> Degrade ortamı kurmak için, sayısal DNA, degrade tampon AN birleştirmekd 4,8, steril bir 15 mL vida kapaklı bir tüp (gradyan orta DNA karışımının üretimi) içinde 6.0 ml &#39;lik bir hacme kadar karışık birlikte 7,163 M CsCl çözeltisi ilave edildi. </li><li> Dikkatli bir şırınga ve iğne kullanılarak (tüp boyun tabanına kadar doldurun) 5.1 ml ultrasantrifüjdeki tüpüne hazırlanmış degrade orta-DNA karışımı yerleştirin. Herhangi bir hava kabarcıkları pompalama veya oluşturmaktan kaçının. Bir referans gradyan olarak her santrifüj vadede (yerine DNA GKD 2 O kullanarak) en az bir boş degrade içerir. </li><li> Gerekli her gradient orta sonra ağırlık 10 mg olan Bakiye tüp çiftleri ilgili bir ultra santrifüj tüpüne dolduruldu. Bir &quot;tüp Topper&quot; ile tüp Seal ve conta sızıntısız tüp ters çevrilerek ve elle orta derecede bir basınç uygulayarak olduğundan emin olun. </li><li> Ultra-santrifüj 5.1 ml tüpler ultrasantrifügasyon tutmak için sekiz kuyucuklu bir dike yakın rotor kullanın. Dikkatle rotor kuyuları mühür ve ma göre ultrasantrifüjdeki içine rotor yüknufacturer talimatları. Ultrasantrifügasyon koşulları ayarlayın: falso vakum ile 40 saat çalışma süresi 50.000 (177.000 xg civarında) rpm, sıcaklık 20 ° C, ve Ultrasantrifügasyon de. Frensiz maksimum hızlanma ve yavaşlama seçin. </li><li> Tamamlandığında, dikkatlice forseps kullanarak santrifüj rotor tüpleri kaldırmak. Boruların içinde oluşturulan geçişlerini bozmadan bir rafa koyun. Kısa sürede herhangi bir difüzyon en aza indirmek için degrade fraksiyon örnekleri işleyin. </li></ol></li><li> Fraksiyonu tarafından İzopiknik Ayrılmış Gradyanların DNA Alma <ol><li> Eşit ultrasantrifüjdeki tüp üst deplasman yöntemi oluşturulan geçişlerini ayıran degrade ayırmasına, yürütmek için doğru bir HPLC pompası sistemi kullanın. GKD 2 O 1 L deplasman ile dolu şişe HPLC pompasını (% 100 akış gradyan) bağlayın ve sıkı şırınga iğnesi bir 23 G 1 açık pompa boru takmak. Yeterli b ekleo koyu mavi renk vermek için GKD 2 O mavi boya romophenol. Bu degrade orta ve GKD 2 O. yerinden arasındaki arayüz görüntülenmesini kolaylaştırır </li><li> 850 | il / dk &#39;lık bir akış hızı için pompayı ayarlayın ve mavi renkli GKD 2 O şırınga iğnesi dışarı çıkan tek bir damla kadar sistem dengeye getirin. </li><li> Dikkatli bir kıskacı için, bir ultra santrifüj tüpüne düzeltmek ve uzun bir iğne bir şırınga 23 G 1, tüpün alt kısmını delmek. Tüpün üst kısmına pompa boru bağlı iğne sokarak ultra santrifüj tüpüne pompası bağlayın ve doğrudan steril 1.5 mL mikrosantrifüj tüpü içine alttan damlaları toplamak. Yaklaşık 425 fraksiyon başına ul ve degrade başına 12 fraksiyonların toplam tutarında, bir fraksiyon her 30 sn toplayın. Son fraksiyon (fraksiyon 12), genellikle değiştirmesini GKD 2 O içerir ve atılmalıdır unutmayın. </li><li> Ayrışımdan sonra banaAdım 5.1.2 &#39;de belirtildiği gibi bir analitik terazi kullanılarak ayrılan tüm kısımların yoğunluğunu ölçünüz. </li><li> Birinci DNA düşük miktarda çökeltilmesi için bir taşıyıcı olarak (otoklav GKD 2 O 20 ug / ml) 1 ul glikojen ilave edilerek (425 ul civarında) her fraksiyondan DNA&#39;nın çökeltilmesi. Inversiyon iyice karıştırın. </li><li> , Polietilen glikol (PEG) çözeltisi (500 ml toplam hacim polietilen glikol 6000 150 g ve 2 GKD NaCl O 46,8 g çözülür, iki hacim (850 ul) ilave edin. Filtre, sterilize ve otoklav. PEG çözeltisi 30&#39;dur % PEG 6000 ve 1.6 M NaCl) ve on kez ters yüz edilerek tekrar karıştırılır. </li><li> (Gerekirse gece boyunca) DNA çökelmesi için en az iki saat boyunca oda sıcaklığında tüpler bırakın. </li><li> Oda sıcaklığında 30 dakika boyunca 13,000 x g&#39;de santrifüjleyin çökeltilerin. Bir görünür pelet oluşturmalıdır. </li><li> Dikkatli bir pipet ile süpernatant kaldırmak ve% 70 etanol 500 ul pelet yıkayın. Aynı altında santrifüjTekrar 10 dakika boyunca koşulları. </li><li> Süpernatantı dikkatlice atmak ve 15 dakika boyunca oda sıcaklığında pelet hava-kurutun. </li><li> GKD 2 O 30 ul kurumuş DNA pelet içinde yeniden çözülür ve tüp hafifçe vurarak karıştırın. Adım 4.3 mağazası -20 ya da -80 ° C altında örnekler, uzun süreli depolama gerekli olduğu takdirde de her degrade fraksiyonunda DNA ölçmek. </li></ol></li></ol> 6. Piro sıralamadır DNA Karakterizasyon <ol><li> 13C-etiketli DNA yaklaşık 1,720-1,735 g / ml &#39;lik bir yoğunluğa sahip iken, etiketlenmemiş doğal (12 C) DNA, 1,705 g / ml&#39; den 1,720 g / ml yoğunluk aralığı kaplar emin olun. Yerli ve çevresel numunelerden ekstre 13C-etiketli DNA hem de çeşitli gradyan fraksiyonları yayılabilir unutmayın. Işık DNA fraksiyonları ve 9-11 fraksiyonları 4-6 ile ilişkili olduğu için, ağır DNA ile ilişkili bekliyoruz. </li><li> Tek bir &quot;derlenmiş&quot; temsili kesir ac yaratmak için kilit kesirler birleştirinyoğunluk çözümlü DNA&#39;nın spesifik piklerin tahsise Cording. Alternatif olarak, bu gradyan jel elektroforez (DGGE) gibi denatüre 23, izotop oranı kütle spektrometrisi (IRMS) 22 ya da bir parmak izi yöntemi kullanarak ayrılan fraksiyonların incelemek için diğer vasıtalar, sıralamadan önce uygun fraksiyonlar seçmek için yardımcı olabilir. </li><li> Her bir gradyan derlenmiş, ağır, orta ve hafif fraksiyonlardan PCR amplifiye bakteriyel 16S rRNA gen, piro sıralamadır yapın. SIP, bu yöntem, soy tanımlanmasını ve metabolik olarak aktif bakteri türlerinin nispi bolluk kullanılması mümkündür örnekleri inkübe edildi. Aşağıdaki gibi piro gerçekleştirin: <ol><li> Titanyum reaktifleri ile bir Roche 454 FLX enstrüman kullanarak Amplikon piro gerçekleştirin. </li><li> Th ile genişletilmiş 24,25 - (- GAGTTTGATCNTGGCTCAG -3 5) ve Gray519r (GTNTTACNGCGGCKGCTG -3 5) Gray28F belirlenen füzyon primer kullanılarak birleştirilmek üzere barkodlu amplikonları hazırlayıne ilgili astar Adaptörü A / B ve örnek özgü multipleks tanımlayıcıları (MID). </li><li> Dizileme kütüphanesi oluşturmak için, bir sıcak başlangıç ​​Taq polimeraz kullanılarak, 30 çevrim ile tek aşamalı bir PCR uygulanır. </li><li> Satıcılar protokolüne dayalı amplikonları sekansı, ve tarif edildiği gibi, ileri yönde (Gray28F) okur uzanır <a href="http://www.researchandtesting.com/">http://www.researchandtesting.com/</a> . </li></ol></li></ol> 7. Piro sıralamadır Veri Analizi <ol><li> Ham dizisi &quot;mikrobiyal ekoloji içine nicel anlayışlar&quot;, QIIME yazılım boru hattı 26 ile 454 piro tarafından oluşturulan okur analiz. Aşağıdaki gibi işleme uygulayın: <ol><li> Başlangıçta, process_sff.py komut ile FAŞTA, qual ve Flowgram dosyaları 454-makine-oluşturulan sff dosyasını dönüştürmek. </li><li> (Check_id_map.py göre) eşleme dosyasını doğrulamak ve çoğaltılmış biyolojik sam okur atamakples split_libraries.py komut ile. Düşük kaliteli 50 sürgülü pencere boyutu ve 25 ortalama bir kalite kesim parametresi ile biter Trim, veri kümesi kısa belirsiz dizileri (uzunluk &lt;200 bp) de ortadan kaldırır. </li><li> Denoise_wrapper.py kullanarak 454 veri denoise. </li><li> Sonra, birden OTU toplama yöntemi (pick_otus.py% 97 sekans benzerliği cut-off ile) kullanılarak yüksek kaliteli işletme taksonomik birimler (otus) içine okur küme. </li><li> Pick_rep_set.py kullanarak her OTU bir temsilci dizisini seçin. </li><li> Assign_taxonomy.py dayalı temsili dizi setine taksonomisini atamak. 0.80 ayarlamak rekor atama için en az güven ile Ribosomal Veritabanı Projesi (RDP) sınıflandırıcı kullanın. </li><li> Algoritması PyNast (align_seqs.py kullanarak Önceden hizalanmış greengenes çekirdek 16S dizilere karşı set temsilcisi dizisini hizalayın75 için minimum sekans özdeşliği yüzde dizi). </li><li> Ayrıca, identify_chimeric_seqs.py çalıştırarak fazla analiz kuruntulardan tüketmek. </li><li> Önce bir filogenetik ağaç (make_phylogeny.py) bina lanemask şablonu (filter_alignment.py) ile (filogenetik çıkarım için yararlı değil) bütün boşluk pozisyonları çıkarın. </li><li> Son olarak, her bir numune içinde bakteri Şlotip oluşumunu anlatan, make_otu_table.py ile OTU tabloları oluşturmak. Bakteriyel bolluk ve aktivitesini karşılaştırmak için ısı haritası oluşturmak için OTU tabloyu kullanın. </li><li> Gerekirse, sırasıyla örnekler içinde ve arasında alfa ve beta çeşitliliği hesaplamak. Aynı şekilde, seyrelme eğrileri (dizileme derinliği karşı çeşitliliğin grafikleri) ve mikrobiyal topluluklar arasında ilişkileri temsil Principal Koordinat Analizi (PCoA) araziler de hazırlanabilir. </li></ol></li></ol>

<ol>
	<li>Pais, R., Lohs, C., Wu, Y. N., Wang, J. W., Aksoy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+obligate+mutualist+Wigglesworthia+glossinidia+influences+reproduction,+digestion,+and+immunity+processes+of+its+host,+the+tsetse+fly.">The obligate mutualist Wigglesworthia glossinidia influences reproduction, digestion, and immunity processes of its host, the tsetse fly.</a> Appl. Environ. Microbiol. 74, 5965-5974 (2008).</li><li>Freitak, D., Heckel, D. G., Vogel, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dietary-dependent+trans-generational+immune+priming+in+an+insect+herbivore.">Dietary-dependent trans-generational immune priming in an insect herbivore.</a> Proc. Biol. Sci. 276, 2617-2624 (2009).</li><li>Dillon, R. J., Vennard, C. T., Charnley, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Note:+Gut+bacteria+produce+components+of+a+locust+cohesion+pheromone.">A Note: Gut bacteria produce components of a locust cohesion pheromone.</a> J. Appl. Microbiol. 92, 759-763 (2002).</li><li>Douglas, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutritional+interactions+in+insect-microbial+symbioses:+Aphids+and+their+symbiotic+bacteria+Buchnera.">Nutritional interactions in insect-microbial symbioses: Aphids and their symbiotic bacteria Buchnera.</a> Annu. Rev. Entomol. 43, 17-37 (1998).</li><li>Reichardt, N., Barclay, A. R., Weaver, L. T., Morrison, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+stable+isotopes+to+measure+the+metabolic+activity+of+the+human+intestinal+microbiota.">Use of stable isotopes to measure the metabolic activity of the human intestinal microbiota.</a> Appl. Environ. Microbiol. 77, 8009-8014 (2011).</li><li>Dumont, M. G., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+isotope+probing+-+linking+microbial+identity+to+function.">Stable isotope probing - linking microbial identity to function.</a> Nat. Rev. Microbiol. 3, 499-504 (2005).</li><li>Gil, R., Latorre, A., Moya, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+endosymbionts+of+insects:+insights+from+comparative+genomics.">Bacterial endosymbionts of insects: insights from comparative genomics.</a> Environ. Microbiol. 6, 1109-1122 (2004).</li><li>Brune, A., VH, R. e. s. h., Card&#233;, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Encyclopedia of Insects. , 1132 (2005).</li><li>Breznak, J. A., Brune, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+microorganisms+in+the+digestion+of+lignocellulose+by+termites.">Role of microorganisms in the digestion of lignocellulose by termites.</a> Annu. Rev. Entomol. 39, 453-487 (1994).</li><li>Broderick, N. A., Raffa, K. F., Goodman, R. M., Handelsman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Census+of+the+bacterial+community+of+the+gypsy+moth+larval+midgut+by+using+culturing+and+culture-independent+methods.">Census of the bacterial community of the gypsy moth larval midgut by using culturing and culture-independent methods.</a> Appl. Environ. Microbiol. 70, 293-300 (2004).</li><li>Funke, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hydrolysis+of+quorum-sensing+molecules+in+the+gut+of+lepidopteran+larvae.">Rapid hydrolysis of quorum-sensing molecules in the gut of lepidopteran larvae.</a> Chembiochem. 9, 1953-1959 (2008).</li><li>Tang, X. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complexity+and+variability+of+gut+commensal+microbiota+in+polyphagous+lepidopteran+larvae.">Complexity and variability of gut commensal microbiota in polyphagous lepidopteran larvae.</a> PloS One. 7, (2012).</li><li>Amann, R. I., Ludwig, W., Schleifer, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phylogenetic+identification+and+in-situ+detection+of+individual+microbial-cells+without+cultivation.">Phylogenetic identification and in-situ detection of individual microbial-cells without cultivation.</a> Microbiol. Rev. 59, 143-169 (1995).</li><li>Olsen, G. J., Lane, D. J., Giovannoni, S. J., Pace, N. R., Stahl, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+ecology+and+evolution+-+a+ribosomal-rna+approach.">Microbial ecology and evolution - a ribosomal-rna approach.</a> Annu. Rev. Microbiol. 40, 337-365 (1986).</li><li>Pilloni, G., von Netzer, F., Engel, M., Lueders, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electron+acceptor-dependent+identification+of+key+anaerobic+toluene+degraders+at+a+tar-oil-contaminated+aquifer+by+Pyro-SIP.">Electron acceptor-dependent identification of key anaerobic toluene degraders at a tar-oil-contaminated aquifer by Pyro-SIP.</a> FEMS Microbiol. Ecol. 78, 165-175 (2011).</li><li>Lu, Y. H., Conrad, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+stable+isotope+probing+of+methanogenic+archaea+in+the+rice+rhizosphere.">In situ stable isotope probing of methanogenic archaea in the rice rhizosphere.</a> Science. 309, 1088-1090 (2005).</li><li>Radajewski, S., Ineson, P., Parekh, N. R., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable-isotope+probing+as+a+tool+in+microbial+ecology.">Stable-isotope probing as a tool in microbial ecology.</a> Nature. 403, 646-649 (2000).</li><li>Lueders, T., Pommerenke, B., Friedrich, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable-isotope+probing+of+microorganisms+thriving+at+thermodynamic+limits:+Syntrophic+propionate+oxidation+in+flooded+soil.">Stable-isotope probing of microorganisms thriving at thermodynamic limits: Syntrophic propionate oxidation in flooded soil.</a> Appl. Environ. Microbiol. 70, 5778-5786 (2004).</li><li>Kunapuli, U., Lueders, T., Meckenstock, R. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+stable+isotope+probing+to+identify+key+iron-reducing+microorganisms+involved+in+anaerobic+benzene+degradation.">The use of stable isotope probing to identify key iron-reducing microorganisms involved in anaerobic benzene degradation.</a> ISME J. 1, 643-653 (2007).</li><li>Fuhrer, T., Fischer, E., Sauer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+identification+and+quantification+of+glucose+metabolism+in+seven+bacterial+species.">Experimental identification and quantification of glucose metabolism in seven bacterial species.</a> J. Bacteriol. 187, 1581-1590 (2005).</li><li>Dunford, E. A., Neufeld, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Stable-Isotope+Probing+(DNA-SIP).">DNA Stable-Isotope Probing (DNA-SIP).</a> J. Vis. Exp. (42), (2010).</li><li>Yamasaki, S., Nomura, N., Nakajima, T., Uchiyama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cultivation-independent+identification+of+candidate+dehalorespiring+bacteria+in+tetrachloroethylene+degradation.">Cultivation-independent identification of candidate dehalorespiring bacteria in tetrachloroethylene degradation.</a> Environ. Sci. Technol. 46, 7709-7716 (2012).</li><li>Lueders, T., Manefield, M., Friedrich, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+sensitivity+of+DNA-+and+rRNA-based+stable+isotope+probing+by+fractionation+and+quantitative+analysis+of+isopycnic+centrifugation+gradients.">Enhanced sensitivity of DNA- and rRNA-based stable isotope probing by fractionation and quantitative analysis of isopycnic centrifugation gradients.</a> Environ. Microbiol. 6, 73-78 (2004).</li><li>Ishak, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+diversity+in+Solenopsis+invicta+and+Solenopsis+geminata+ant+colonies+characterized+by+16S+amplicon+454+pyrosequencing.">Bacterial diversity in Solenopsis invicta and Solenopsis geminata ant colonies characterized by 16S amplicon 454 pyrosequencing.</a> Microb. Ecol. 61, 821-831 (2011).</li><li>Sun, Y., Wolcott, R. D., Dowd, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tag-encoded+FLX+amplicon+pyrosequencing+for+the+elucidation+of+microbial+and+functional+gene+diversity+in+any+environment.">Tag-encoded FLX amplicon pyrosequencing for the elucidation of microbial and functional gene diversity in any environment.</a> Methods Mol. Biol. 733, 129-141 (2011).</li><li>Kuczynski, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+QIIME+to+Analyze+16S+rRNA+Gene+sequences+from+microbial+communities.">Using QIIME to Analyze 16S rRNA Gene sequences from microbial communities.</a> Curr. Protoc. Microbiol. Chapter 1, Unit1E 5 (2012).</li><li>Dillon, R. J., Dillon, V. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gut+bacteria+of+insects:+nonpathogenic+interactions.">The gut bacteria of insects: nonpathogenic interactions.</a> Annu. Rev. Entomol. 49, 71-92 (2004).</li><li>Neufeld, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+stable-isotope+probing.">DNA stable-isotope probing.</a> Nat. Protoc. 2, 860-866 (2007).</li><li>Dumont, M. G., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+isotope+probing+-+linking+microbial+identity+to+function.">Stable isotope probing - linking microbial identity to function.</a> Nat. Rev. Microbiol. 3, 499-504 (2005).</li></ol>

Biz ifşa hiçbir şey yok.

Çoğu böceklerin bağırsak zengin ve karmaşık bir mikrobiyal topluluğu barındırır; genellikle 10 7 -10 9 prokaryotik hücrelerin çoğu durumda konağın kendi hücrelerini outnumbering, orada Köşkü. Böylece, böcek bağırsak karşılıkçılığını 27 yükümlülük altına patogenezden mikrobiyal ilişkilerin birden yönlerini temsil eden çeşitli mikrobiyal faaliyetler için bir &quot;sıcak nokta&quot;, olduğunu. Birçok çalışma böcek bağırsak mikrobiyal toplu...

Böcek-bakteriyel sembiyotik dernekler böcek türlerine 7 çok sayıda için bilinir. Bu simbiyotik dernek, mikroorganizmalar böceklerin büyüme ve gelişmesinde önemli rol oynar. Mikroplar konakçıya böcek temel amino asitler 4 sentezi de dahil olmak üzere üretimi 1, feromon biyosentezi 3, beslenme ve sindirim ulaşılmaz gıda katkı gösterilmiştir. Gut-bakteriyel dernekleri çok çeşitli olmasına rağmen, çok az onlar böcek lehine oynamak işlevsel rolü hakkında bilinmektedir. Sadece termitlerin durumunda, lignoselüloz simbiyotik sindirim prokaryotlar, protozoa ve mantarlar tarafından yürütülen yaygın olarak 8,9 incelenmiştir. Buna zıt olarak, az kültürlü böceklerin bağırsağında pamuk yaprak kurdu yani içinde mevcut olan simbiyotik ilişkisi hakkında bilinen, Spodoptera genel nedeniyle bitki konak sıkça kayması, Ayrıca. Littoralisist böcekler ve bağırsak ilişkili bakteri toplulukları kalıcı olarak beslenme alışkanlıkları fitokimyasallar bir bolluk ile bitkileri tüketen bağlantılı yeni sorunlara maruz kalırlar. Bunun yanında lepidopteranlara olarak bağırsak ortamında, per se çünkü yüksek bağırsak pH 10 Bakterilerin büyümesi için bir sert çevre temsil eder. Özellikle S. durumunda littoralis, bu aralıkları foregut de 10.5 &#39;den, midgut ca. 9. neredeyse 7 hindgut 11&#39;inde, pH. Diğer yandan, bakteri toplum S. gut ile ilişkili littoralis basittir. Tang, Freitak, et al. 12, bu böcek ilişkili bakteri eden tek üyesi olarak 7 farklı bakteri türlerinin toplam ait 36 Şlotip en fazla rapor etmiştir. Bunun yanı sıra, herhangi bir karmaşık bir yetiştirme prosedürü laboratuarda böcek büyümesi için gereklidir. Ayrıca, bu ve böceğin kısa yaşam döngüsü çok g kolaylaştırmakenerational çalışmalar, bağırsak mikrop etkileşimleri çalışmak için ideal bir model sistem içine bu tür dönüm. PCR-tabanlı dizileme teknolojileri ile birlikte, çeşitli organizmaların (yani insan, böcek veya deniz canlıları) gut biota ile ilgili çalışmaların sayısı artmıştır. Ayrıca, sonuçlar, geçmişte olduğu gibi izolasyon ve gut barındıran bakteri yetiştirme bağımsızdır. Bakterilerin% 99&#39;u ekilebilir değildir ve bağırsaktaki hakim çevre koşullarının simülasyonu 12. zordur. PCR kullanarak, 16S rRNA gen fragmanları (bakteriler arasında yaygın olarak kullanılan bir filogenetik geninin markör) seçici olarak dizilenmiştir bağırsak bakteri topluluklarının, karışık bir DNA şablonu amplifiye ve klonlanabilir. Bu bilgi ile, kullanıcı kamu veritabanları 13,14 sekans bilgileri aldıktan sonra bakteri türlerini tespit etmek mümkün değildir. Bununla birlikte, dizileme, bakteri tanımlamak için yaklaşımlartopluluklar nedeniyle toplum içinde bireysel türlerin içsel metabolik katkısı hakkında bilgi eksikliği yetersiz kalır. Kararlı izotop (SIP) sondalama gelecek vaat eden bir kültür-free tekniktir. Bu genellikle belirli metabolik faaliyetlerle bağlantılı mikrobiyal filogenezlerini analiz çevre mikrobiyolojisi kullanılır. Bu, fosfolipid türetilen yağlı asitler, DNA ve RNA gibi mikrobik biyolojik 5, alt-tabakalar olarak istikrarlı, izotop işaretli atomuna takip ederek elde edilir. Nükleik asitler göz önüne alındığında, bu yöntemin yoğunluk gradyan ultrasantrifüjü ile 6 etiketlenmemiş DNA&#39;dan 13 C-etiketli DNA ya da RNA&#39;nın ayrılması üzerine dayanır. Nedeniyle DNA etiket ve metabolik aktivite arasındaki doğrudan bağlantı için, nükleik asitlerin bir alt analiz moleküler türlerin tanımlar ve metabolik faaliyetleri ile ilgili bilgi sağlar. Ayrıca, DNA-ve SIP, piro sıralamadır kombinasyonu tarafından uygulananPilloni, von Netzer, et al. 15 ağır 13C-etiketli DNA fraksiyonunda mevcut olan bakteri türlerinin özellikle basit ve hassas bir şekilde tanımlanmalarına olanak sağlar. Şimdiye kadar, bu teknik, 16,17 aerobik ve anaerobik koşullar altında 18,19 toprakta biyokimyasal süreçlerde bakteriyel toplulukları tarif etmek için uygulanmıştır. Sindirilmeyen karbonhidrat tepki olarak insan intestinal mikrobiyota farklı filogenetik gruplar metabolik faaliyetleri tarif Reichardt, et al. 5 tarafından bildirilen gibi çevresel biliminde kullanım yanı sıra, teknik tıp bilimlerinde uygulanmıştır. Burada bağırsakta metabolik olarak aktif bakteri türlerinin DNA &#39;etiket&#39; için 13 C-glikoz kullanımı. Glukoz durumlar 20 bilinmesine rağmen, yaygın Entner-Doudoroff (ED) yolu boyunca pek çok bakteri türleri tarafından kullanılan bir şekerdir. Builgi metabolitleri ve kurulan yollar boyunca karbon kaynağı arasındaki bir bağlantı sağlayan güvenilir metabolik prob olarak 13 C-glikoz kullanımını haklı. Bilimsel Söz, başka alt-tabakalar, örneğin, 13 C-metan, 13 CO2, ya da bir 13 CO2 atmosferi altında yükseltilmiş bitki bağlı olarak, metabolik faaliyetleri gidermek için kullanılabilir. Bu noktada, bir genel böcek, yani S. bağırsak bakteri topluluğunun metabolik karakterizasyonunda uygulanan protokol mevcut littoralis (Lepidoptera, Noctuidae). Ayrıca, bu metod da yüksek çözünürlük ve hassasiyet ile böcek bağırsağı bakteri topluluğunun belirlenmesini sağlar, piro sıralamadır, bağlanmıştır. Ana tabaka olarak, 13 C-etiketli glikoz deneylerde kullanılmıştır.

<table border="0" cellpadding="0" cellspacing="0" width="872"> 
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:384px;">Dumont #5 Mirror Finish Forceps</td>
			<td style="width:203px;">Fine Science Tools</td>
			<td style="width:135px;">11251-23</td>
			<td style="width:151px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vannas Spring Scissors</td>
			<td>Fine Science Tools</td>
			<td>15000-00</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Speed Vacuum Concentrator 5301</td>
			<td>Eppendorf Germany</td>
			<td>5305 000.304</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Plastic pestle</td>
			<td>Carl Roth GmbH Co. Germany</td>
			<td>P986.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NanoVue spectrophotometer</td>
			<td>GE HealthCare, UK</td>
			<td>28-9569-58</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mastercycler pro/thermocycler</td>
			<td>Eppendorf Germany</td>
			<td>6321 000.515</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agagel Standard Horizontal Gel Electrophoresis chamber</td>
			<td>Biometra</td>
			<td>Discontinued</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultracentrifuge (Optima L-90K)</td>
			<td>Beckman</td>
			<td>A20684</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultracentrifuge rotor (NVT 90)</td>
			<td>Beckman</td>
			<td>362752</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HPLC pump</td>
			<td>Agilent</td>
			<td>1100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Quick-Seal, Polyallomer tube</td>
			<td>Beckman</td>
			<td>342412</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Transilluminator UVstar 15 </td>
			<td>Biometra</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

identification of metabolically active bacteria in the gut of the generalist spodoptera littoralis via dna stable isotope probing using 13c-glucose

Çoğu böceklerin bağırsaklar simbiyotik patojenik bakterilerin karmaşık topluluklar tarafından iskan. Bu tür mikrobiyal topluluklar içinde bu ortakçı veya mutualistik bakteri türleri tanımlamak mümkündür. İkincisi olanlar, örneğin, diğerlerinin yanı sıra, temel amino asitler 4 sentezi de dahil olmak üzere, immün yanıtı 2, feromon üretim 3, hem de beslenme artırılması, böcek üreme 1 &#39;de yardımcı böcek birden fazla fonksiyona hizmet ettiği gözlenmiştir. Nedeniyle bu derneklerin önemine, birçok çabaların bireysel üyeleri aşağı toplulukları karakterize etmek için yapılmıştır. Ancak, bu çabaların çoğu ya ekimi yöntemlerine dayalı veya nihai tanımlama için dizilmiştir 16S rRNA gen parçalarının üretimi dayanıyordu edildi. Ne yazık ki, bu yaklaşım, sadece, bağırsakta mevcut olan bakteri türleri belirlenmiştir ve hiçbir informat ResimMikroorganizmaların metabolik aktivitesi üzerinde iyon. Bir böceğin bağırsağında metabolik olarak aktif bakteri türünü karakterize etmek için, evrensel bir alt-tabaka olarak 13 C-glukoz kullanılarak in vivo (SIP) tarama ve sabit izotop kullanılır. Bu kendi özel metabolik aktivite mikrobiyal filogenilerin bağlantısını sağlayan ümit verici bir kültür-free tekniktir. Bu, DNA ve RNA 5 gibi mikrobiyal belirteçler, içine yüzeylerde istikrarlı, izotop işaretli atomları takip mümkündür. DNA, etiketlenmemiş (12 ° C) ile karşılaştırıldığında etiketlenmiş DNA yoğunluğunu arttırır içine 13 ° C arasında birleşme izotopları. Sonunda, 13C-etiketli DNA ya da RNA, 12 C-etiketli olmayan benzer bir 6 ila yoğunluk gradyanlı ultra-santrifüj ile ayrılır. Ayrılmış olan bir nükleik asit isotopomers daha sonraki moleküler analizi türlerin metabolizma aktivitesi ve kimlik arasındaki bağlantıyı sağlar. Burada, bir kültürlü bir böcek (bizim model sistem), Spodoptera littoralis (Lepidoptera, Noctuidae) bağırsağında metabolik olarak aktif bakterileri tanımlamak için kullanılan bir protokol mevcut. DNA filogenetik analizi, böcek bağırsağı bakteri eden tanımlanmasında yüksek çözünürlük ve hassasiyet izin piro sıralamadır, kullanılarak yapıldı. Ana substrat olarak, 13 C-etiketli glikoz deneylerde kullanılmıştır. Substrat yapay bir diyet kullanılarak böcekler beslenmiştir.

Böcek bağırsağında bulunan metabolik olarak aktif bakteri, yeterli etiketleme elde etmek için, bir böcek, bir etiketlenmemiş hafif kolayca etiketli ağır fraksiyonunun ayrılmasını sağlamak için yeterli bir süre için, daha önce optimize 13 C açısından zengin bir alt tabakaya açık olmalıdır. Bizim durumumuzda, 13C-glükoz 1 gün (Şekil 1A) boyunca 10 mM&#39;lik bir son konsantrasyonda suni diyet takviye edilmiştir. Normal glikoz (Şekil 1 B)...

Watch this Scientific Journal Video about Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose at JoVE.co

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

Spodoptera littoralis gut ile ilişkili aktif bakteriyel topluluk, piro sıralamadır bağlanmış kararlı-izotop-tarama (SIP) ile belirlenmiştir. Bu yöntemi kullanarak, toplum içinde aktif metabolik bakteri türlerinin belirlenmesi, yüksek çözünürlük ve hassasiyet ile yapıldı.

Kültürlü ve Gut metabolik Aktif Bakterilerin Tanımlanması<em&gt; Spodoptera littoralis</em&gt; DNA Kararlı İzotop yoluyla kullanma Probing<sup&gt; 13</sup&gt; C = Glukoz

Guts of most insects are inhabited by complex communities of symbiotic nonpathogenic bacteria. Within such microbial communities it is possible to ...

identification-metabolically-active-bacteria-gut-generalist

Research

JoVE Journal

Biology

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

15.3K Görüntüleme.  Max Planck Institute for Chemical Ecology.  Spodoptera littoralis gut ile ilişkili aktif bakteriyel topluluk, piro sıralamadır bağlanmış kararlı-izotop-tarama (SIP) ile belirlenmiştir. Bu yöntemi kullanarak, toplum içinde aktif metabolik bakteri türlerinin belirlenmesi, yüksek çözünürlük ve hassasiyet ile yapıldı. 

Video: Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

Extracting DNA from the Gut Microbes of the Termite (Zootermopsis Angusticollis) and Visualizing Gut Microbes

Termites are among the few animals known to have the capacity to subsist solely by consuming wood.  The termite gut tract contains a dense and species-rich microbial population that assists in the degradation of lignocellulose predominantly into acetate, the key nutrient fueling termite metabolism (Odelson &amp; Breznak, 1983).  Within these microbial populations are bacteria, methanogenic archaea and, in some ("lower") termites, eukaryotic protozoa. Thus, termites are excellent research subjects for studying the interactions among microbial species and the numerous biochemical functions they perform to the benefit of their host.  The species composition of microbial populations in termite guts as well as key genes involved in various biochemical processes has been explored using molecular techniques (Kudo et al., 1998; Schmit-Wagner et al., 2003; Salmassi &amp; Leadbetter, 2003). These techniques depend on the extraction and purification of high-quality nucleic acids from the termite gut environment.  The extraction technique described in this video is a modified compilation of protocols developed for extraction and purification of nucleic acids from environmental samples (Mor  et al., 1994; Berthelet et al., 1996; Purdy et al., 1996; Salmassi &amp; Leadbetter, 2003; Ottesen et al. 2006) and it produces DNA from termite hindgut material suitable for use as template for polymerase chain reaction (PCR).

Extracting DNA from the Gut Microbes of the Termite Zootermopsis Angusticollis and Visualizing Gut Microbes

This video illustrates the technique for extracting DNA from the species of microbes resident in the termite hindgut. The preparation of a wet mount slide, which is useful for visualizing the gut microbial community is also illustrated, and a tour through the species-rich gut environment is given.

Termit Gut Mikroplar (Zootermopsis Angusticollis) DNA ayıklanıyor ve Gut Mikroplar görselleştirme

Termites are among the few animals known to have the capacity to subsist solely by consuming wood.  The termite gut tract contains a dense and ...

Biyoloji

Visualization of DNA Replication in the Vertebrate Model System DT40 using the DNA Fiber Technique

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not only ensure faithful genome duplication in the face of endogenous and exogenous DNA damage but also prevent genomic instability, a recognized causative factor in tumor development.
Here, we describe a simple and cost-effective fluorescence microscopy-based method to visualize DNA replication in the avian B-cell line DT40. This cell line provides a powerful tool to investigate protein function in vivo by reverse genetics in vertebrate cells1. DNA fiber fluorography in DT40 cells lacking a specific gene allows one to elucidate the function of this gene product in DNA replication and genome stability. Traditional methods to analyze replication fork dynamics in vertebrate cells rely on measuring the overall rate of DNA synthesis in a population of pulse-labeled cells. This is a quantitative approach and does not allow for qualitative analysis of parameters that influence DNA synthesis. In contrast, the rate of movement of active forks can be followed directly when using the DNA fiber technique2-4. In this approach, nascent DNA is labeled in vivo by incorporation of halogenated nucleotides (Fig 1A). Subsequently, individual fibers are stretched onto a microscope slide, and the labeled DNA replication tracts are stained with specific antibodies and visualized by fluorescence microscopy (Fig 1B). Initiation of replication as well as fork directionality is determined by the consecutive use of two differently modified analogues. Furthermore, the dual-labeling approach allows for quantitative analysis of parameters that influence DNA synthesis during the S-phase, i.e. replication structures such as ongoing and stalled forks, replication origin density as well as fork terminations. Finally, the experimental procedure can be accomplished within a day, and requires only general laboratory equipment and a fluorescence microscope.

DT40, a model vertebrate genetic system, provides a powerful tool to analyze protein function. Here we describe a simple method that allows qualitative analysis of parameters that influence DNA synthesis during the S-phase in DT40 cells at the single molecule level.

DNA replikasyonu Görselleştirme Omurgalı Model Sistemi DT40 DNA Fiber Tekniği

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

Plant protein kompleksleri, çevirim sonrası değişikliklerin belirlenmesi

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Super-resolution Imaging of the Cytokinetic Z Ring in Live Bacteria Using Fast 3D-Structured Illumination Microscopy (f3D-SIM)

Imaging of biological samples using fluorescence microscopy has advanced substantially with new technologies to overcome the resolution barrier of the diffraction of light allowing super-resolution of live samples. There are currently three main types of super-resolution techniques &#8211; stimulated emission depletion (STED), single-molecule localization microscopy (including techniques such as PALM, STORM, and GDSIM), and structured illumination microscopy (SIM). While STED and single-molecule localization techniques show the largest increases in resolution, they have been slower to offer increased speeds of image acquisition. Three-dimensional SIM (3D-SIM) is a wide-field fluorescence microscopy technique that offers a number of advantages over both single-molecule localization and STED. Resolution is improved, with typical lateral and axial resolutions of 110 and 280 nm, respectively and depth of sampling of up to 30 &#181;m from the coverslip, allowing for imaging of whole cells. Recent advancements (fast 3D-SIM) in the technology increasing the capture rate of raw images allows for fast capture of biological processes occurring in seconds, while significantly reducing photo-toxicity and photobleaching. Here we describe the use of one such method to image bacterial cells harboring the fluorescently-labelled cytokinetic FtsZ protein to show how cells are analyzed and the type of unique information that this technique can provide.

Super-resolution Imaging of the Cytokinetic Z Ring in Live Bacteria Using Fast 3D-Structured Illumination Microscopy f3D-SIM

Spatiotemporal information about dynamic proteins inside live cells is crucial for understanding biology. A type of super-resolution microscopy called fast 3D-structured illumination microscopy (f3D-SIM) reveals unique information about the cytokinetic Z ring in bacteria: both its bead-like appearance and the rapid dynamics of FtsZ within the ring.

Hızlı 3D-Yapılandırılmış Aydınlatma mikroskopi ile Canlı Bakteri Cytokinetic Z Yüzük Süper çözünürlük Görüntüleme (F3D-SIM)

Imaging of biological samples using fluorescence microscopy has advanced substantially with new technologies to overcome the resolution barrier of the ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

Arabidopsis Protein-DNA Etkileşimleri Tespiti için Kromatin Immunoprecipitation Deneyi<em&gt; İn Vivo</em

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Retroviral Entegrasyon Siteleri Amplifikasyon, Yeni Nesil Sıralama ve Genomik DNA Haritalama

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Nükleik Asitlerin süzülmesi İzolasyonu: basit ve hızlı DNA izolasyonu,

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ecologically-important endpoints, though they are rarely considered in toxicological studies. D. melanogaster is emerging as a toxicology model for the behavioral, neurological, and genetic impacts of toxicants, to name a few. More importantly, species in the genus Drosophila can be utilized as a model system for an integrative framework approach to incorporate emergent properties and answer ecologically-relevant questions in&#160;toxicology research. The aim of this paper is to provide a protocol for exposing species in the genus Drosophila to pollutants to be used as a model system for a range of phenotypic outputs and ecologically-relevant questions. More specifically, this protocol can be used to 1) link multiple biological levels of organization and understand the impact of toxicants on both individual- and population-level fitness; 2) test the impact of toxicants at different stages of developmental exposure; 3) test multigenerational and evolutionary implications of pollutants; and 4) test multiple contaminants and stressors simultaneously.

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

In this paper, we provide a detailed protocol for exposing species in the genus Drosophila to pollutants with the goal of studying the impact of exposure on a range of phenotypic outputs at different developmental stages and for more than one generation.

Drosophila toksisite laboratuvarda test etmek için bir omurgasız Model sistemi olarak kullanmak için deneysel protokol

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ...

Establishing Stable Binary Cultures of Symbiotic Saccharibacteria from the Oral Cavity

Many bacterial species cannot be cultured in the laboratory using standard methods, posing a significant barrier to studying the majority of microbial diversity on earth. Novel approaches are required to culture these uncultured bacteria so that investigators can effectively study their physiology and lifestyle using the powerful tools available in the laboratory. The Candidate Phyla Radiation (CPR) is one of the largest groups of uncultivated bacteria, comprising ~15% of the living diversity on earth. The first isolate of this group was a member of the Saccharibacteria phylum, 'Nanosynbacter lyticus' strain TM7x. TM7x is an unusually small bacterium that lives as a symbiont in direct contact with a bacterial host, Schaalia odontolytica, strain XH001. Taking advantage of the unusually small cell size and its lifestyle as a symbiotic organism, we developed a protocol to rapidly culture Saccharibacteria from dental plaque. This protocol will show how to filter a suspension of dental plaque through a 0.2 &#181;m filter, then concentrate the collected Saccharibacteria cells and infect a culture of host organisms. The resulting coculture can be passaged as any normal bacterial culture and infection is confirmed by PCR. The resulting binary culture can be maintained in the laboratory and used for future experiments. While contamination is a possibility, the binary culture can be purified by either further filtering and reinfection of host, or by plating the binary culture and screening for infected colonies. We hope this protocol can be expanded to other sample types and environments, leading to the cultivation of many more species in the CPR.

We demonstrate a method for isolating difficult-to-grow members of the novel bacterial phylum, Saccharibacteria, by filtering dental plaque and co-culturing with host bacteria.

Ağız Boşluğundan Simbiyotik Sakkarakterinin Kararlı İkili Kültürlerinin Kurulması

Many bacterial species cannot be cultured in the laboratory using standard methods, posing a significant barrier to studying the majority of microbial ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also be utilized to explore other complex regulatory mechanisms at the exon level. Alternative splicing and polyadenylation play a crucial role in the functional diversity of a gene by generating different isoforms to regulate gene expression at the post-transcriptional level, and limiting analyses to the whole gene level can miss this important regulatory layer. Here, we demonstrate detailed step by step analyses for identification and visualization of differential exon and polyadenylation site usage across conditions, using Bioconductor and other packages and functions, including DEXSeq, diffSplice from the Limma package, and rMATS.

Alternative splicing (AS) and alternative polyadenylation (APA) expand the diversity of transcript isoforms and their products. Here, we describe bioinformatic protocols to analyze bulk RNA-seq and 3' end sequencing assays to detect and visualize AS and APA varying across experimental conditions.

RNA-seq Verilerinde Alternatif Ekleme ve Poliadenilasyonun Tanımlanması

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...